Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TDRD10	126668	broad.mit.edu	37	1	154516937	154516937	+	Silent	SNP	C	T	T	rs151222618	byFrequency	TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154516937C>T	uc009wow.2	+	10	1579	c.741C>T	c.(739-741)CGC>CGT	p.R247R	TDRD10_uc001ffd.2_Silent_p.R247R|TDRD10_uc001ffe.2_Silent_p.R168R	NM_001098475	NP_001091945	Q5VZ19	TDR10_HUMAN	tudor domain containing 10 isoform a	247	Tudor.						nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCGTTATGCGCGGGACTCGCT	0.632													12	17	---	---	---	---	capture	Silent	SNP	154516937	154516937	TDRD10	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15616	29
LY9	4063	broad.mit.edu	37	1	160784327	160784327	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160784327T>G	uc001fwu.2	+	4	898	c.848T>G	c.(847-849)TTG>TGG	p.L283W	LY9_uc010pjs.1_Missense_Mutation_p.L283W|LY9_uc001fwv.2_Missense_Mutation_p.L283W|LY9_uc001fww.2_Missense_Mutation_p.L283W|LY9_uc001fwx.2_Missense_Mutation_p.L283W|LY9_uc001fwy.1_Missense_Mutation_p.L185W|LY9_uc001fwz.2_5'UTR	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	283	Extracellular (Potential).|Ig-like V-type 2.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GTTGTCTGGTTGTTTAACACA	0.547													54	77	---	---	---	---	capture	Missense_Mutation	SNP	160784327	160784327	LY9	1	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	9016	29
CR2	1380	broad.mit.edu	37	1	207647215	207647215	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207647215C>T	uc001hfw.2	+	11	2142	c.2048C>T	c.(2047-2049)ACG>ATG	p.T683M	CR2_uc001hfv.2_Missense_Mutation_p.T742M|CR2_uc009xch.2_Missense_Mutation_p.T683M	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	683	Sushi 11.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						CTAGTTAATACGTCCTGCCAA	0.438													63	102	---	---	---	---	capture	Missense_Mutation	SNP	207647215	207647215	CR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3807	29
ACBD3	64746	broad.mit.edu	37	1	226347010	226347010	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226347010G>C	uc001hpy.2	-	5	825	c.778C>G	c.(778-780)CAG>GAG	p.Q260E		NM_022735	NP_073572	Q9H3P7	GCP60_HUMAN	acyl-Coenzyme A binding domain containing 3	260	Gln-rich.				steroid biosynthetic process|transport	Golgi membrane|integral to membrane|mitochondrion	fatty-acyl-CoA binding|protein binding				0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		GCTGCATACTGCTGGAACTGC	0.448													47	97	---	---	---	---	capture	Missense_Mutation	SNP	226347010	226347010	ACBD3	1	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	123	29
NUP133	55746	broad.mit.edu	37	1	229577744	229577744	+	Silent	SNP	T	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:229577744T>C	uc001htn.2	-	26	3470	c.3378A>G	c.(3376-3378)CTA>CTG	p.L1126L		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	1126					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GATCCGCTTGTAGCAGGTCTT	0.343													11	215	---	---	---	---	capture	Silent	SNP	229577744	229577744	NUP133	1	T	C	C	C	1	0	0	0	0	0	0	0	1	730	57	3	3	10661	29
OR13G1	441933	broad.mit.edu	37	1	247836129	247836129	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247836129G>T	uc001idi.1	-	1	215	c.215C>A	c.(214-216)ACA>AAA	p.T72K		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	72	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TATGATGCTTGTTGTGCAGAT	0.443													29	50	---	---	---	---	capture	Missense_Mutation	SNP	247836129	247836129	OR13G1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	10846	29
OR2L8	391190	broad.mit.edu	37	1	248112665	248112665	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248112665G>A	uc001idt.1	+	1	506	c.506G>A	c.(505-507)CGA>CAA	p.R169Q	OR2L13_uc001ids.2_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CCTTATTGCCGATCCAGGGCC	0.478													44	129	---	---	---	---	capture	Missense_Mutation	SNP	248112665	248112665	OR2L8	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10913	29
ANO5	203859	broad.mit.edu	37	11	22291884	22291884	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22291884G>A	uc001mqi.2	+	18	2242	c.1925G>A	c.(1924-1926)CGA>CAA	p.R642Q	ANO5_uc001mqj.2_Missense_Mutation_p.R641Q	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	642	Extracellular (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						TGGAGACGCCGAAAAGCTCGG	0.413													18	139	---	---	---	---	capture	Missense_Mutation	SNP	22291884	22291884	ANO5	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	694	29
GDPD4	220032	broad.mit.edu	37	11	76956338	76956338	+	Silent	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76956338G>A	uc001oyf.2	-	11	1325	c.1074C>T	c.(1072-1074)ATC>ATT	p.I358I		NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain	358	GDPD.|Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						GATGTTGCTCGATTTTAGAGG	0.438													54	120	---	---	---	---	capture	Silent	SNP	76956338	76956338	GDPD4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	6266	29
GRM5	2915	broad.mit.edu	37	11	88338071	88338071	+	Silent	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:88338071G>A	uc001pcq.2	-	4	1409	c.1209C>T	c.(1207-1209)GCC>GCT	p.A403A	GRM5_uc009yvm.2_Silent_p.A403A	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	403	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	TCGAATAGATGGCGTTGATCA	0.458													77	84	---	---	---	---	capture	Silent	SNP	88338071	88338071	GRM5	11	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	6733	29
NAALAD2	10003	broad.mit.edu	37	11	89902152	89902152	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89902152C>G	uc001pdf.3	+	12	1443	c.1334C>G	c.(1333-1335)TCT>TGT	p.S445C	NAALAD2_uc009yvx.2_Missense_Mutation_p.S412C|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	445	Extracellular (Potential).|NAALADase.				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TCGGATTCATCTATAGAAGGT	0.294													38	52	---	---	---	---	capture	Missense_Mutation	SNP	89902152	89902152	NAALAD2	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	10038	29
APOF	319	broad.mit.edu	37	12	56755752	56755752	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56755752C>G	uc001sle.1	-	2	292	c.238G>C	c.(238-240)GCC>CCC	p.A80P		NM_001638	NP_001629	Q13790	APOF_HUMAN	apolipoprotein F precursor	80					cholesterol metabolic process	high-density lipoprotein particle|low-density lipoprotein particle	cholesterol binding|lipid transporter activity|receptor binding				0						GGTAGAGGGGCCATGTGGCTG	0.547													69	87	---	---	---	---	capture	Missense_Mutation	SNP	56755752	56755752	APOF	12	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	796	29
MDM1	56890	broad.mit.edu	37	12	68716856	68716856	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68716856C>T	uc001stz.2	-	5	934	c.798G>A	c.(796-798)AGG>AGA	p.R266R	MDM1_uc010stc.1_Silent_p.R221R|MDM1_uc009zqv.1_5'UTR	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1	266						nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TGAATACCTTCCTTTCAGGAG	0.328													37	76	---	---	---	---	capture	Silent	SNP	68716856	68716856	MDM1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	9325	29
RALGAPA1	253959	broad.mit.edu	37	14	36211763	36211763	+	Silent	SNP	T	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:36211763T>C	uc001wti.2	-	11	1651	c.1260A>G	c.(1258-1260)TTA>TTG	p.L420L	RALGAPA1_uc001wtj.2_Silent_p.L420L|RALGAPA1_uc010tpv.1_Silent_p.L420L|RALGAPA1_uc010tpw.1_Silent_p.L420L|RALGAPA1_uc001wtk.1_Silent_p.L271L	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	420					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						AAATTGGTAATAAAAATGCCT	0.308													34	58	---	---	---	---	capture	Silent	SNP	36211763	36211763	RALGAPA1	14	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	12908	29
RFX7	64864	broad.mit.edu	37	15	56435018	56435018	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56435018G>A	uc010bfn.2	-	4	359	c.359C>T	c.(358-360)CCG>CTG	p.P120L		NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	23	RFX-type winged-helix.				regulation of transcription, DNA-dependent	nucleus	DNA binding				0						TGAAGTCTCCGGATGTTCCTC	0.388													23	37	---	---	---	---	capture	Missense_Mutation	SNP	56435018	56435018	RFX7	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13163	29
WDR90	197335	broad.mit.edu	37	16	703568	703568	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:703568C>T	uc002cii.1	+	12	1331	c.1277C>T	c.(1276-1278)TCG>TTG	p.S426L	WDR90_uc002cig.1_Missense_Mutation_p.S426L|WDR90_uc002cih.1_Missense_Mutation_p.S427L|WDR90_uc002cij.1_RNA|WDR90_uc002cik.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	426	WD 1.									ovary(1)	1		Hepatocellular(780;0.0218)				CTATTGGCCTCGGCCCAGGCA	0.657													65	112	---	---	---	---	capture	Missense_Mutation	SNP	703568	703568	WDR90	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17218	29
CORO7	79585	broad.mit.edu	37	16	4391505	4391505	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4391505G>C	uc002cwf.2	-	29	3301	c.2858C>G	c.(2857-2859)GCC>GGC	p.A953G	CORO7_uc002cwe.2_RNA|TIMM16_uc002cwd.2_Missense_Mutation_p.A30G	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						GGCCCGGCTGGCTGTGTGGAC	0.657													4	15	---	---	---	---	capture	Missense_Mutation	SNP	4391505	4391505	CORO7	16	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	3724	29
SLC25A11	8402	broad.mit.edu	37	17	4842250	4842250	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4842250C>T	uc002fzo.1	-	3	382	c.269G>A	c.(268-270)CGT>CAT	p.R90H	SLC25A11_uc002fzp.1_Missense_Mutation_p.R86H|RNF167_uc002fzq.2_5'Flank|RNF167_uc002fzr.2_5'Flank|RNF167_uc002fzs.2_5'Flank|RNF167_uc002fzt.2_5'Flank|RNF167_uc002fzu.2_5'Flank|RNF167_uc002fzv.2_5'Flank|RNF167_uc002fzw.1_5'Flank|RNF167_uc002fzx.2_5'Flank	NM_003562	NP_003553	Q02978	M2OM_HUMAN	solute carrier family 25 member 11 isoform 1	90	Helical; Name=2; (Potential).|Solcar 1.				gluconeogenesis	integral to plasma membrane|mitochondrial inner membrane	oxoglutarate:malate antiporter activity				0						GGTGGCCTGACGCAGCAGGCC	0.612													43	66	---	---	---	---	capture	Missense_Mutation	SNP	4842250	4842250	SLC25A11	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14365	29
TMEM102	284114	broad.mit.edu	37	17	7340213	7340213	+	Silent	SNP	T	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7340213T>A	uc002ggx.1	+	3	1188	c.915T>A	c.(913-915)GCT>GCA	p.A305A	FGF11_uc010vtw.1_Intron|TMEM102_uc002ggy.1_Silent_p.A305A|FGF11_uc010cmh.1_5'Flank|FGF11_uc010cmi.2_5'Flank|FGF11_uc002ggz.2_5'Flank	NM_178518	NP_848613	Q8N9M5	TM102_HUMAN	transmembrane protein 102	305	Cytoplasmic (Potential).				regulation of apoptosis|response to cytokine stimulus|signal transduction	cell surface|integral to membrane|intracellular	protein binding				0		Prostate(122;0.173)				TCCTCCTGGCTACCCCTGAGC	0.721													30	51	---	---	---	---	capture	Silent	SNP	7340213	7340213	TMEM102	17	T	A	A	A	1	0	0	0	0	0	0	0	1	678	53	4	4	15902	29
KRBA2	124751	broad.mit.edu	37	17	8274702	8274702	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8274702T>G	uc002glf.1	-	1	157	c.151A>C	c.(151-153)AAT>CAT	p.N51H	KRBA2_uc002glg.1_Intron	NM_213597	NP_998762	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	51	KRAB.				DNA integration|regulation of transcription, DNA-dependent	intracellular	DNA binding				0						TCTAAATAATTCCAATCTTTG	0.453													40	196	---	---	---	---	capture	Missense_Mutation	SNP	8274702	8274702	KRBA2	17	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	8360	29
UNC45B	146862	broad.mit.edu	37	17	33497185	33497185	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33497185G>A	uc002hja.2	+	12	1697	c.1600G>A	c.(1600-1602)GGC>AGC	p.G534S	UNC45B_uc002hjb.2_Missense_Mutation_p.G534S|UNC45B_uc002hjc.2_Missense_Mutation_p.G534S|UNC45B_uc010cto.2_Intron	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	534					cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				GGCAGTGGAGGGCCTGGCCTA	0.627													38	75	---	---	---	---	capture	Missense_Mutation	SNP	33497185	33497185	UNC45B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16871	29
TMC6	11322	broad.mit.edu	37	17	76120076	76120076	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76120076A>C	uc002juj.1	-	8	1202	c.1076T>G	c.(1075-1077)GTG>GGG	p.V359G	TMC6_uc002jui.1_5'Flank|TMC6_uc010dhf.1_Missense_Mutation_p.V192G|TMC6_uc002juk.2_Missense_Mutation_p.V359G|TMC6_uc010dhg.1_Missense_Mutation_p.V359G|TMC6_uc002jul.1_Missense_Mutation_p.V359G|TMC6_uc002jum.3_Missense_Mutation_p.V150G|TMC6_uc002jun.3_Missense_Mutation_p.V359G|TMC6_uc002juo.2_Missense_Mutation_p.V132G	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	359	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TTACCTGTACACCAGGGTGAT	0.428									Epidermodysplasia_Verruciformis_Familial_Clustering_of				40	60	---	---	---	---	capture	Missense_Mutation	SNP	76120076	76120076	TMC6	17	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	15874	29
CANT1	124583	broad.mit.edu	37	17	76989644	76989644	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76989644G>C	uc002jwn.2	-	6	1633	c.1194C>G	c.(1192-1194)ATC>ATG	p.I398M	CANT1_uc002jwk.2_Missense_Mutation_p.I398M|CANT1_uc002jwj.2_Missense_Mutation_p.I398M|CANT1_uc002jwl.2_Intron|CANT1_uc002jwm.1_RNA	NM_001159772	NP_001153244	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	398	Lumenal (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity				0			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AAATGAACTCGATGCCTTCGT	0.478			T	ETV4	prostate						OREG0024788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	57	---	---	---	---	capture	Missense_Mutation	SNP	76989644	76989644	CANT1	17	G	C	C	C	1	0	0	0	0	1	0	0	0	473	37	4	4	2593	29
RPTOR	57521	broad.mit.edu	37	17	78797000	78797000	+	Silent	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78797000G>A	uc002jyt.1	+	9	1918	c.1113G>A	c.(1111-1113)CCG>CCA	p.P371P	RPTOR_uc002jys.2_Silent_p.P371P|RPTOR_uc010wuf.1_Silent_p.P186P|RPTOR_uc010wug.1_Silent_p.P371P	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	371					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						CGCGTCTGCCGCCCACGTACA	0.562													86	145	---	---	---	---	capture	Silent	SNP	78797000	78797000	RPTOR	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13557	29
TMX3	54495	broad.mit.edu	37	18	66377374	66377374	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:66377374G>A	uc002lkf.2	-	4	284	c.149C>T	c.(148-150)GCG>GTG	p.A50V	TMX3_uc010xez.1_5'UTR|TMX3_uc010xfa.1_Missense_Mutation_p.A50V|TMX3_uc002lkg.3_Missense_Mutation_p.A50V	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor	50	Thioredoxin.|Lumenal (Potential).				cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						ACACCATGGCGCATAAAACTT	0.323													4	35	---	---	---	---	capture	Missense_Mutation	SNP	66377374	66377374	TMX3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16151	29
RTTN	25914	broad.mit.edu	37	18	67718690	67718690	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67718690C>T	uc002lkp.2	-	39	5348	c.5280G>A	c.(5278-5280)CCG>CCA	p.P1760P	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Silent_p.P848P|RTTN_uc010dqp.2_Silent_p.P12P	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1760							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				CGGTAACAAACGGGAGTGTGA	0.428													62	158	---	---	---	---	capture	Silent	SNP	67718690	67718690	RTTN	18	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	13629	29
ODF3L2	284451	broad.mit.edu	37	19	463966	463966	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:463966C>T	uc002lor.2	-	4	984	c.748G>A	c.(748-750)GTG>ATG	p.V250M	SHC2_uc002loq.3_5'Flank|ODF3L2_uc010drp.2_Missense_Mutation_p.V214M	NM_182577	NP_872383	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	250	DUF1309 3.										0						GCTTTGTTCACGGTGACCTGC	0.627													18	50	---	---	---	---	capture	Missense_Mutation	SNP	463966	463966	ODF3L2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10737	29
PIAS4	51588	broad.mit.edu	37	19	4012940	4012940	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4012940G>A	uc002lzg.2	+	2	57	c.47G>A	c.(46-48)CGA>CAA	p.R16Q		NM_015897	NP_056981	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	16	SAP.				positive regulation of protein sumoylation|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|PML body	DNA binding|SUMO ligase activity|ubiquitin protein ligase binding|zinc ion binding			pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGAGTTTTCGAGTCTCCGAC	0.597													16	371	---	---	---	---	capture	Missense_Mutation	SNP	4012940	4012940	PIAS4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11781	29
ICAM4	3386	broad.mit.edu	37	19	10398368	10398368	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10398368C>G	uc002mns.1	+	2	590	c.551C>G	c.(550-552)ACC>AGC	p.T184S	ICAM4_uc002mnr.1_Missense_Mutation_p.H158Q|ICAM4_uc002mnt.1_Missense_Mutation_p.T184S|ICAM5_uc002mnu.3_5'Flank	NM_001544	NP_001535	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 isoform 1	184	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	extracellular region|integral to membrane|plasma membrane	integrin binding			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			GAGCGCTTCACCGGCCTGGAT	0.627													4	164	---	---	---	---	capture	Missense_Mutation	SNP	10398368	10398368	ICAM4	19	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	7407	29
RGL3	57139	broad.mit.edu	37	19	11526629	11526629	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11526629C>T	uc002mrp.2	-	5	685	c.621G>A	c.(619-621)CCG>CCA	p.P207P	RGL3_uc002mrn.2_5'UTR|RGL3_uc002mrm.2_5'UTR|RGL3_uc002mro.2_Silent_p.P207P	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	207					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						ACACCTGAGGCGGCTCCTCTT	0.567													127	424	---	---	---	---	capture	Silent	SNP	11526629	11526629	RGL3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13173	29
ZNF91	7644	broad.mit.edu	37	19	23545038	23545038	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:23545038T>C	uc002nre.2	-	4	856	c.743A>G	c.(742-744)AAG>AGG	p.K248R	ZNF91_uc010xrj.1_Missense_Mutation_p.K216R	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	248	C2H2-type 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGAGAGCTGCTTAAAAGCTTT	0.363													38	228	---	---	---	---	capture	Missense_Mutation	SNP	23545038	23545038	ZNF91	19	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	18076	29
HIPK4	147746	broad.mit.edu	37	19	40886782	40886782	+	Silent	SNP	C	T	T	rs148513270	byFrequency	TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40886782C>T	uc002onp.2	-	3	1401	c.1116G>A	c.(1114-1116)TCG>TCA	p.S372S		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	372						cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CCACTTGCAGCGAGAGGCGGT	0.667													36	126	---	---	---	---	capture	Silent	SNP	40886782	40886782	HIPK4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7044	29
NLRP11	204801	broad.mit.edu	37	19	56320789	56320789	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56320789C>T	uc010ygf.1	-	5	1898	c.1187G>A	c.(1186-1188)CGT>CAT	p.R396H	NLRP11_uc002qlz.2_Missense_Mutation_p.R297H|NLRP11_uc002qmb.2_Missense_Mutation_p.R297H|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	396	NACHT.						ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CAAACACAGACGTTTTAGGAG	0.493													65	168	---	---	---	---	capture	Missense_Mutation	SNP	56320789	56320789	NLRP11	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10380	29
ZNF814	730051	broad.mit.edu	37	19	58385762	58385762	+	Silent	SNP	C	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385762C>G	uc002qqo.2	-	3	1268	c.996G>C	c.(994-996)TCG>TCC	p.S332S	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332	C2H2-type 5.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ATTTGCTAAACGATTTCCCAC	0.358													4	14	---	---	---	---	capture	Silent	SNP	58385762	58385762	ZNF814	19	C	G	G	G	1	0	0	0	0	0	0	0	1	236	19	4	4	18052	29
SLC3A1	6519	broad.mit.edu	37	2	44527119	44527119	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44527119C>T	uc002ruc.3	+	5	979	c.901C>T	c.(901-903)CGG>TGG	p.R301W	SLC3A1_uc002rty.2_Missense_Mutation_p.R301W|SLC3A1_uc002rtz.2_Missense_Mutation_p.R301W|SLC3A1_uc002rua.2_Missense_Mutation_p.R301W|SLC3A1_uc002rub.2_Missense_Mutation_p.R301W|SLC3A1_uc002rud.3_Missense_Mutation_p.R23W	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	301	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	GGAAATTTTACGGTTCTGGCT	0.363													7	244	---	---	---	---	capture	Missense_Mutation	SNP	44527119	44527119	SLC3A1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	14518	29
TSPYL6	388951	broad.mit.edu	37	2	54483145	54483145	+	Silent	SNP	C	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:54483145C>G	uc002rxr.2	-	1	265	c.144G>C	c.(142-144)GTG>GTC	p.V48V	ACYP2_uc002rxq.3_Intron	NM_001003937	NP_001003937	Q8N831	TSYL6_HUMAN	TSPY-like 6	48					nucleosome assembly	nucleus					0						GCGGTGGGAACACGATTGGCT	0.607													63	106	---	---	---	---	capture	Silent	SNP	54483145	54483145	TSPYL6	2	C	G	G	G	1	0	0	0	0	0	0	0	1	210	17	4	4	16545	29
C2orf62	375307	broad.mit.edu	37	2	219222293	219222293	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219222293C>T	uc002vhr.2	+	3	184	c.155C>T	c.(154-156)ACG>ATG	p.T52M	C2orf62_uc002vhs.2_RNA	NM_198559	NP_940961	Q7Z7H3	CB062_HUMAN	hypothetical protein LOC375307	52											0		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCTCTGAGACGCTGGCCATG	0.577													22	32	---	---	---	---	capture	Missense_Mutation	SNP	219222293	219222293	C2orf62	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2161	29
DES	1674	broad.mit.edu	37	2	220290674	220290674	+	Missense_Mutation	SNP	G	A	A	rs73991549	byFrequency;by1000genomes	TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220290674G>A	uc002vll.2	+	9	1461	c.1375G>A	c.(1375-1377)GTC>ATC	p.V459I		NM_001927	NP_001918	P17661	DESM_HUMAN	desmin	459	Tail.				cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton	p.V459I(1)		central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCCCCAGGTCGTCAGTGAGGC	0.607													73	108	---	---	---	---	capture	Missense_Mutation	SNP	220290674	220290674	DES	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4407	29
SEMG1	6406	broad.mit.edu	37	20	43836290	43836290	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43836290A>G	uc002xni.2	+	2	409	c.352A>G	c.(352-354)AAA>GAA	p.K118E	SEMG1_uc002xnj.2_Missense_Mutation_p.K118E|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.K118E	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	118					insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				AGACCATGATAAATCAAAAGG	0.408													54	145	---	---	---	---	capture	Missense_Mutation	SNP	43836290	43836290	SEMG1	20	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	13937	29
MC3R	4159	broad.mit.edu	37	20	54824329	54824329	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54824329G>A	uc002xxb.2	+	1	542	c.430G>A	c.(430-432)GTC>ATC	p.V144I		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	181	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			CGACAGGTACGTCACCATCTT	0.582													71	194	---	---	---	---	capture	Missense_Mutation	SNP	54824329	54824329	MC3R	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9278	29
ITGB2	3689	broad.mit.edu	37	21	46320234	46320234	+	Splice_Site	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46320234C>T	uc002zgd.2	-	6	941	c.897_splice	c.e6+1	p.F299_splice	ITGB2_uc002zge.2_Splice_Site_p.F299_splice|ITGB2_uc002zgf.3_Splice_Site_p.F299_splice|ITGB2_uc011afl.1_Splice_Site_p.F221_splice|ITGB2_uc010gpw.2_Splice_Site_p.F242_splice|ITGB2_uc002zgg.2_Splice_Site_p.F299_splice	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor						apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity	p.?(1)		ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	TGGGGACTTACGAATTCGTTG	0.632													37	71	---	---	---	---	capture	Splice_Site	SNP	46320234	46320234	ITGB2	21	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	7817	29
SGSM1	129049	broad.mit.edu	37	22	25315903	25315903	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:25315903C>T	uc003abg.2	+	25	3458	c.3301C>T	c.(3301-3303)CGT>TGT	p.R1101C	SGSM1_uc003abh.2_Missense_Mutation_p.R1040C|SGSM1_uc010guu.1_Missense_Mutation_p.R1046C|SGSM1_uc003abj.2_Missense_Mutation_p.R985C|SGSM1_uc003abi.1_Missense_Mutation_p.R1021C	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	1101						Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						GGAAGTCTACCGTGACATCAT	0.507													9	49	---	---	---	---	capture	Missense_Mutation	SNP	25315903	25315903	SGSM1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14115	29
THOC5	8563	broad.mit.edu	37	22	29913061	29913061	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29913061C>T	uc003afr.2	-	18	1973	c.1638G>A	c.(1636-1638)GGG>GGA	p.G546G	THOC5_uc003afq.2_Silent_p.G207G|THOC5_uc003afs.2_Silent_p.G546G|THOC5_uc003aft.2_Silent_p.G546G|THOC5_uc003afu.2_Silent_p.G546G|THOC5_uc010gvo.2_Silent_p.G290G	NM_001002878	NP_001002878	Q13769	THOC5_HUMAN	THO complex 5	546					intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding			breast(3)	3						GATTGGTGTCCCCAGCCAGTC	0.527													7	163	---	---	---	---	capture	Silent	SNP	29913061	29913061	THOC5	22	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	15753	29
KCNH8	131096	broad.mit.edu	37	3	19575121	19575121	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:19575121A>T	uc003cbk.1	+	16	3049	c.2854A>T	c.(2854-2856)AGT>TGT	p.S952C	KCNH8_uc010hex.1_Missense_Mutation_p.S413C	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	952	Ser-rich.|Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						ACTTTGTAGCAGTAATATCAC	0.532													70	109	---	---	---	---	capture	Missense_Mutation	SNP	19575121	19575121	KCNH8	3	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	7960	29
CCR8	1237	broad.mit.edu	37	3	39374303	39374303	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39374303G>A	uc010hhr.2	+	2	619	c.481G>A	c.(481-483)GCC>ACC	p.A161T	CCR8_uc003cjm.2_Missense_Mutation_p.A78T	NM_005201	NP_005192	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	161	Helical; Name=4; (Potential).				cell adhesion|chemotaxis|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	coreceptor activity			ovary(1)|lung(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		ATGGCTAACCGCCATTATGGC	0.488													121	79	---	---	---	---	capture	Missense_Mutation	SNP	39374303	39374303	CCR8	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2918	29
COL6A6	131873	broad.mit.edu	37	3	130284156	130284156	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:130284156G>A	uc010htl.2	+	3	1011	c.980G>A	c.(979-981)CGG>CAG	p.R327Q		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	327	Nonhelical region.|VWFA 2.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						AATGGCAGTCGGAAGAATCAG	0.532													30	261	---	---	---	---	capture	Missense_Mutation	SNP	130284156	130284156	COL6A6	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3668	29
AMBN	258	broad.mit.edu	37	4	71467259	71467259	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71467259T>A	uc003hfl.2	+	6	494	c.419T>A	c.(418-420)CTG>CAG	p.L140Q		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	140					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			GCCACAGCACTGAAAGAAGCA	0.557											OREG0016218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	113	162	---	---	---	---	capture	Missense_Mutation	SNP	71467259	71467259	AMBN	4	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	563	29
ADAM29	11086	broad.mit.edu	37	4	175896768	175896768	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175896768C>T	uc003iuc.2	+	5	762	c.92C>T	c.(91-93)CCG>CTG	p.P31L	ADAM29_uc003iud.2_Missense_Mutation_p.P31L|ADAM29_uc010irr.2_Missense_Mutation_p.P31L|ADAM29_uc011cki.1_Missense_Mutation_p.P31L	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	31			P -> L (in a colorectal cancer sample; somatic mutation).		proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding	p.P31L(1)		skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CACAGCCCTCCGGATGTGGTG	0.517													10	115	---	---	---	---	capture	Missense_Mutation	SNP	175896768	175896768	ADAM29	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	247	29
ZDHHC11	79844	broad.mit.edu	37	5	837585	837585	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:837585C>T	uc011cma.1	-	6	1179	c.795G>A	c.(793-795)AAG>AAA	p.K265K	ZDHHC11_uc003jbj.2_RNA|ZDHHC11_uc010itd.1_RNA	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	265						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			AGGTGGTCATCTTCTTGGCCT	0.502													7	266	---	---	---	---	capture	Silent	SNP	837585	837585	ZDHHC11	5	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	17481	29
EDIL3	10085	broad.mit.edu	37	5	83433171	83433171	+	Silent	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:83433171G>A	uc003kio.1	-	5	776	c.357C>T	c.(355-357)AAC>AAT	p.N119N	EDIL3_uc003kip.1_Silent_p.N109N	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like	119	EGF-like 3.				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		ATTCATTTATGTCTAAGAAAA	0.338													71	130	---	---	---	---	capture	Silent	SNP	83433171	83433171	EDIL3	5	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	4870	29
PCDHGA10	56106	broad.mit.edu	37	5	140794507	140794507	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140794507G>A	uc003lkl.1	+	1	1765	c.1765G>A	c.(1765-1767)GGC>AGC	p.G589S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Missense_Mutation_p.G589S|PCDHGB7_uc003lkm.2_5'Flank|PCDHGB7_uc003lkn.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	589	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCAGAGCCCGGCTACCTGGT	0.677													83	158	---	---	---	---	capture	Missense_Mutation	SNP	140794507	140794507	PCDHGA10	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11454	29
TRIM38	10475	broad.mit.edu	37	6	25966964	25966964	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25966964C>T	uc003nfm.2	+	3	649	c.214C>T	c.(214-216)CGA>TGA	p.R72*	TRIM38_uc003nfn.2_Nonsense_Mutation_p.R72*	NM_006355	NP_006346	O00635	TRI38_HUMAN	tripartite motif-containing 38	72					positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular	signal transducer activity|zinc ion binding				0						GGATAGCCTCCGACCCAACAA	0.498													31	67	---	---	---	---	capture	Nonsense_Mutation	SNP	25966964	25966964	TRIM38	6	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	16395	29
HLA-F	3134	broad.mit.edu	37	6	29694676	29694676	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29694676C>T	uc003nno.3	+	7	1177	c.1053C>T	c.(1051-1053)AGC>AGT	p.S351S	HLA-F_uc011dlx.1_Silent_p.S351S|HLA-F_uc011dly.1_RNA|LOC285830_uc003nnp.2_RNA|LOC285830_uc011dlz.1_RNA	NM_001098479	NP_001091949	P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	Error:Variant_position_missing_in_P30511_after_alignment					antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity				0						CAGTGGTCAGCGGAAACTTGA	0.493													39	195	---	---	---	---	capture	Silent	SNP	29694676	29694676	HLA-F	6	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	7136	29
CRISP3	10321	broad.mit.edu	37	6	49704218	49704218	+	Silent	SNP	A	G	G			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49704218A>G	uc003ozs.2	-	3	90	c.75T>C	c.(73-75)GAT>GAC	p.D25D		NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor	25					innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TAAAAGCGGGATCCTAAGGGA	0.363													132	211	---	---	---	---	capture	Silent	SNP	49704218	49704218	CRISP3	6	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	3846	29
POM121L12	285877	broad.mit.edu	37	7	53103391	53103391	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103391C>T	uc003tpz.2	+	1	43	c.27C>T	c.(25-27)TCC>TCT	p.S9S		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	9											0						CGGCCGAGTCCGCAGACCTCG	0.697													8	25	---	---	---	---	capture	Silent	SNP	53103391	53103391	POM121L12	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12143	29
EGFR	1956	broad.mit.edu	37	7	55211080	55211080	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55211080G>A	uc003tqk.2	+	3	569	c.323G>A	c.(322-324)AGA>AAA	p.R108K	EGFR_uc003tqh.2_Missense_Mutation_p.R108K|EGFR_uc003tqi.2_Missense_Mutation_p.R108K|EGFR_uc003tqj.2_Missense_Mutation_p.R108K|EGFR_uc010kzg.1_Missense_Mutation_p.R108K|EGFR_uc011kco.1_Missense_Mutation_p.R55K	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	108	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.R108K(7)|p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGATCATCAGAGGAAATATG	0.423		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			72	871	---	---	---	---	capture	Missense_Mutation	SNP	55211080	55211080	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4922	29
EGFR	1956	broad.mit.edu	37	7	55233036	55233036	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233036C>T	uc003tqk.2	+	15	2032	c.1786C>T	c.(1786-1788)CCG>TCG	p.P596S	EGFR_uc003tqi.2_Missense_Mutation_p.P596S|EGFR_uc003tqj.2_Missense_Mutation_p.P596S|EGFR_uc010kzg.1_Missense_Mutation_p.P551S|EGFR_uc011kco.1_Missense_Mutation_p.P543S|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	596	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.P596L(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAAGACCTGCCCGGCAGGAGT	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			15	900	---	---	---	---	capture	Missense_Mutation	SNP	55233036	55233036	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4922	29
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	C	C	rs139236063		TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>C	uc003tqk.2	+	15	2039	c.1793G>C	c.(1792-1794)GGA>GCA	p.G598A	EGFR_uc003tqi.2_Missense_Mutation_p.G598A|EGFR_uc003tqj.2_Missense_Mutation_p.G598A|EGFR_uc010kzg.1_Missense_Mutation_p.G553A|EGFR_uc011kco.1_Missense_Mutation_p.G545A|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			14	906	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	29
PCLO	27445	broad.mit.edu	37	7	82764904	82764904	+	Silent	SNP	C	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82764904C>T	uc003uhx.2	-	3	2251	c.1962G>A	c.(1960-1962)CCG>CCA	p.P654P	PCLO_uc003uhv.2_Silent_p.P654P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	600	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGGGTGATGACGGAACTGGAG	0.478													35	47	---	---	---	---	capture	Silent	SNP	82764904	82764904	PCLO	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11486	29
NPTX2	4885	broad.mit.edu	37	7	98254472	98254472	+	Silent	SNP	C	T	T	rs149672697		TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98254472C>T	uc003upl.2	+	3	1059	c.882C>T	c.(880-882)AAC>AAT	p.N294N		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	294	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding	p.N294N(1)		central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			TGCTCATCAACGACAAGGTGA	0.667													26	53	---	---	---	---	capture	Silent	SNP	98254472	98254472	NPTX2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10510	29
LAMB1	3912	broad.mit.edu	37	7	107600136	107600136	+	Missense_Mutation	SNP	G	A	A	rs140619520		TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107600136G>A	uc003vew.2	-	19	2793	c.2458C>T	c.(2458-2460)CCT>TCT	p.P820S	LAMB1_uc003vev.2_Missense_Mutation_p.P844S|LAMB1_uc003vex.2_Missense_Mutation_p.R820C	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	820	Laminin EGF-like 6.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGGAACCTACGTTTGCATCCA	0.527													6	119	---	---	---	---	capture	Missense_Mutation	SNP	107600136	107600136	LAMB1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8530	29
ASB15	142685	broad.mit.edu	37	7	123276864	123276864	+	Silent	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123276864G>A	uc003vku.1	+	12	1888	c.1596G>A	c.(1594-1596)GAG>GAA	p.E532E	ASB15_uc003vkw.1_Silent_p.E532E	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box-containing 15	532	SOCS box.				intracellular signal transduction					skin(2)|lung(1)	3						TTCTTTTAGAGAATCCTTGTT	0.383													67	104	---	---	---	---	capture	Silent	SNP	123276864	123276864	ASB15	7	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	1010	29
NUP205	23165	broad.mit.edu	37	7	135300745	135300745	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:135300745G>A	uc003vsw.2	+	24	3423	c.3392G>A	c.(3391-3393)CGT>CAT	p.R1131H		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1131					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						TCTCTGAATCGTCAGCGGTCA	0.403													55	91	---	---	---	---	capture	Missense_Mutation	SNP	135300745	135300745	NUP205	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10666	29
TRPA1	8989	broad.mit.edu	37	8	72948640	72948640	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:72948640G>A	uc003xza.2	-	21	2613	c.2438C>T	c.(2437-2439)ACG>ATG	p.T813M	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	813	Helical; Name=3; (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	GATGCCCGTCGTGTAGATAAT	0.363													40	79	---	---	---	---	capture	Missense_Mutation	SNP	72948640	72948640	TRPA1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16460	29
SPTAN1	6709	broad.mit.edu	37	9	131395212	131395212	+	Missense_Mutation	SNP	T	A	A	rs148173166		TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131395212T>A	uc004bvl.3	+	55	7384	c.7271T>A	c.(7270-7272)GTG>GAG	p.V2424E	SPTAN1_uc004bvm.3_Missense_Mutation_p.V2429E|SPTAN1_uc004bvn.3_Missense_Mutation_p.V2404E|SPTAN1_uc004bvo.3_Missense_Mutation_p.V191E|SPTAN1_uc004bvp.3_Missense_Mutation_p.V167E	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	2424	EF-hand 3.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						AAGCCTTACGTGACCAAGGAG	0.547													18	248	---	---	---	---	capture	Missense_Mutation	SNP	131395212	131395212	SPTAN1	9	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	15009	29
C9orf171	389799	broad.mit.edu	37	9	135374872	135374872	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135374872G>C	uc004cbn.2	+	4	565	c.517G>C	c.(517-519)GAG>CAG	p.E173Q	C9orf171_uc004cbo.2_Missense_Mutation_p.E137Q	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799	173										ovary(4)|large_intestine(1)	5						GACTGCCCGGGAGAACTTGCT	0.592													74	117	---	---	---	---	capture	Missense_Mutation	SNP	135374872	135374872	C9orf171	9	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	2446	29
FAM46D	169966	broad.mit.edu	37	X	79699116	79699116	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79699116A>T	uc004edl.1	+	5	1412	c.1078A>T	c.(1078-1080)AGG>TGG	p.R360W	FAM46D_uc004edm.1_Missense_Mutation_p.R360W	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN	hypothetical protein LOC169966	360										lung(2)	2						AGCTGAGGCAAGGTACCCTAT	0.428													63	12	---	---	---	---	capture	Missense_Mutation	SNP	79699116	79699116	FAM46D	23	A	T	T	T	1	0	0	0	0	1	0	0	0	36	3	4	4	5516	29
SPRY3	10251	broad.mit.edu	37	X	155004303	155004303	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:155004303G>A	uc004fnq.1	+	2	1224	c.770G>A	c.(769-771)CGA>CAA	p.R257Q	SPRY3_uc010nvl.1_Missense_Mutation_p.R158Q	NM_005840	NP_005831	O43610	SPY3_HUMAN	sprouty homolog 3	257	SPR.|Cys-rich.				multicellular organismal development|regulation of signal transduction	cytoplasm|membrane					0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGCCTCCGGCGACCAGGCTGC	0.582													69	146	---	---	---	---	capture	Missense_Mutation	SNP	155004303	155004303	SPRY3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14999	29
FLG	2312	broad.mit.edu	37	1	152276467	152276468	+	In_Frame_Ins	INS	-	GGA	GGA			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152276467_152276468insGGA	uc001ezu.1	-	3	10930_10931	c.10894_10895insTCC	c.(10894-10896)CAG>CTCCAG	p.3631_3632insL		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3631_3632	Filaggrin 22.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCTGCTGACTGCTGGTGGTGG	0.554									Ichthyosis				9	1242	---	---	---	---	capture_indel	In_Frame_Ins	INS	152276467	152276468	FLG	1	-	GGA	GGA	GGA	1	0	1	1	0	0	0	0	0	715	55	5	5	5867	29
R3HDM2	22864	broad.mit.edu	37	12	57674205	57674207	+	In_Frame_Del	DEL	TGC	-	-			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57674205_57674207delTGC	uc009zpm.1	-	12	1271_1273	c.1236_1238delGCA	c.(1234-1239)CAGCAA>CAA	p.412_413QQ>Q	R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_In_Frame_Del_p.73_74QQ>Q|R3HDM2_uc001snr.2_In_Frame_Del_p.139_140QQ>Q|R3HDM2_uc001sns.2_In_Frame_Del_p.412_413QQ>Q|R3HDM2_uc001snt.2_In_Frame_Del_p.426_427QQ>Q|R3HDM2_uc009zpn.1_In_Frame_Del_p.35_36QQ>Q	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	412_413	Gln-rich.					nucleus	nucleic acid binding			ovary(2)	2						AGCAGGAAGTtgctgctgctgct	0.488													8	166	---	---	---	---	capture_indel	In_Frame_Del	DEL	57674205	57674207	R3HDM2	12	TGC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	12783	29
MST1	4485	broad.mit.edu	37	3	49724141	49724144	+	Frame_Shift_Del	DEL	CTCG	-	-			TCGA-06-0158-01	TCGA-06-0158-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49724141_49724144delCTCG	uc003cxg.2	-	7	892_895	c.820_823delCGAG	c.(820-825)CGAGAGfs	p.R274fs	MST1_uc011bcs.1_Frame_Shift_Del_p.S272fs|MST1_uc010hkx.2_Frame_Shift_Del_p.R195fs|MST1_uc011bct.1_Frame_Shift_Del_p.R274fs|MST1_uc011bcu.1_RNA|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	260_261	Kringle 2.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCACAGAACTCTCGCTCGATCTGC	0.662													10	17	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	49724141	49724144	MST1	3	CTCG	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	9800	29
