Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
RTF1	23168	broad.mit.edu	37	15	41763442	41763442	+	Silent	SNP	G	A	A			TCGA-06-0167-01	TCGA-06-0167-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41763442G>A	uc001zny.2	+	8	1110	c.1098G>A	c.(1096-1098)CGG>CGA	p.R366R		NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component	366	Plus3.				histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		GATTATCACGGCATAAGCTAG	0.458													5	219	---	---	---	---	capture	Silent	SNP	41763442	41763442	RTF1	15	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	13613	32
MRPL10	124995	broad.mit.edu	37	17	45905957	45905957	+	Silent	SNP	C	T	T			TCGA-06-0167-01	TCGA-06-0167-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45905957C>T	uc002ilz.2	-	2	158	c.132G>A	c.(130-132)CGG>CGA	p.R44R	MRPL10_uc010wky.1_Silent_p.R5R|MRPL10_uc002ily.2_Silent_p.R54R	NM_145255	NP_660298	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10 precursor	44					ribosome biogenesis|translation	mitochondrial large ribosomal subunit	structural constituent of ribosome			ovary(1)	1						TCAGCTTCTGCCGCTGAAAGT	0.597													4	46	---	---	---	---	capture	Silent	SNP	45905957	45905957	MRPL10	17	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	9685	32
ITGB2	3689	broad.mit.edu	37	21	46326937	46326937	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0167-01	TCGA-06-0167-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46326937G>A	uc002zgd.2	-	3	265	c.221C>T	c.(220-222)GCG>GTG	p.A74V	ITGB2_uc002zge.2_Missense_Mutation_p.A74V|ITGB2_uc002zgf.3_Missense_Mutation_p.A74V|ITGB2_uc011afl.1_5'UTR|ITGB2_uc010gpw.2_Missense_Mutation_p.A74V|ITGB2_uc002zgg.2_Missense_Mutation_p.A74V	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	74	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	GTCGTCAGCCGCACAGCCCCT	0.617													4	137	---	---	---	---	capture	Missense_Mutation	SNP	46326937	46326937	ITGB2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7817	32
NPNT	255743	broad.mit.edu	37	4	106888371	106888371	+	Missense_Mutation	SNP	G	A	A	rs146652028		TCGA-06-0167-01	TCGA-06-0167-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:106888371G>A	uc003hya.2	+	11	1577	c.1372G>A	c.(1372-1374)GCC>ACC	p.A458T	NPNT_uc011cfc.1_Missense_Mutation_p.A475T|NPNT_uc011cfd.1_Missense_Mutation_p.A488T|NPNT_uc011cfe.1_Missense_Mutation_p.A459T|NPNT_uc010ilt.1_Missense_Mutation_p.A429T|NPNT_uc011cff.1_Missense_Mutation_p.A429T|NPNT_uc010ilu.1_Intron	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	458	MAM.				cell differentiation	membrane	calcium ion binding	p.A458T(1)		skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		AGTGTCGGCAGCCAAAGCCCC	0.552													3	67	---	---	---	---	capture	Missense_Mutation	SNP	106888371	106888371	NPNT	4	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10497	32
SEC24B	10427	broad.mit.edu	37	4	110437770	110437770	+	Silent	SNP	C	T	T			TCGA-06-0167-01	TCGA-06-0167-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110437770C>T	uc003hzk.2	+	11	2155	c.2100C>T	c.(2098-2100)TGC>TGT	p.C700C	SEC24B_uc003hzl.2_Silent_p.C665C|SEC24B_uc011cfp.1_Silent_p.C730C|SEC24B_uc011cfq.1_Silent_p.C699C|SEC24B_uc011cfr.1_Silent_p.C664C	NM_006323	NP_006314	O95487	SC24B_HUMAN	SEC24 (S. cerevisiae) homolog B isoform a	700					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CAATTTTGTGCCAGTCACTCC	0.318													3	61	---	---	---	---	capture	Silent	SNP	110437770	110437770	SEC24B	4	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	13888	32
C6orf203	51250	broad.mit.edu	37	6	107372330	107372330	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0167-01	TCGA-06-0167-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:107372330C>T	uc003prq.2	+	4	694	c.613C>T	c.(613-615)CGG>TGG	p.R205W	C6orf203_uc011eaj.1_Missense_Mutation_p.R210W|C6orf203_uc010kde.2_Missense_Mutation_p.R205W	NM_016487	NP_057571	Q9P0P8	CF203_HUMAN	hypothetical protein LOC51250 isoform a	205											0	Breast(9;0.00124)|all_epithelial(6;0.0729)	all_cancers(87;0.00461)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|Colorectal(196;0.171)|all_epithelial(87;0.23)	BRCA - Breast invasive adenocarcinoma(8;0.000395)|all cancers(7;0.00065)|Epithelial(6;0.000834)|OV - Ovarian serous cystadenocarcinoma(5;0.244)	BRCA - Breast invasive adenocarcinoma(108;0.117)		GACAGTTATGCGGATTCTCTT	0.383													4	137	---	---	---	---	capture	Missense_Mutation	SNP	107372330	107372330	C6orf203	6	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	2329	32
MSL3	10943	broad.mit.edu	37	X	11790350	11790350	+	Missense_Mutation	SNP	G	A	A	rs140880282		TCGA-06-0167-01	TCGA-06-0167-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11790350G>A	uc004cuw.2	+	11	1462	c.1357G>A	c.(1357-1359)GCA>ACA	p.A453T	MSL3_uc004cux.2_Missense_Mutation_p.A394T|MSL3_uc011mig.1_Missense_Mutation_p.A304T|MSL3_uc011mih.1_Missense_Mutation_p.A441T|MSL3_uc004cuy.2_Missense_Mutation_p.A287T	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a	453					histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CATTTATGGGGCACAACATTT	0.463													4	126	---	---	---	---	capture	Missense_Mutation	SNP	11790350	11790350	MSL3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9789	32
