Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF12	390999	broad.mit.edu	37	1	12836029	12836029	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12836029T>C	uc001aui.2	+	2	658	c.631T>C	c.(631-633)TGC>CGC	p.C211R		NM_001080830	NP_001074299	O95522	PRA12_HUMAN	PRAME family member 12	211										ovary(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGGAAGTGTGCTGCCCGTG	0.517													7	217	---	---	---	---	capture	Missense_Mutation	SNP	12836029	12836029	PRAMEF12	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	12329	34
SGIP1	84251	broad.mit.edu	37	1	67133216	67133216	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67133216C>T	uc001dcr.2	+	9	692	c.475C>T	c.(475-477)CGC>TGC	p.R159C	SGIP1_uc010opd.1_5'UTR|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|uc010ope.1_Intron	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	159					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						ATCACAGAGGCGCAGCCCGGT	0.418													69	202	---	---	---	---	capture	Missense_Mutation	SNP	67133216	67133216	SGIP1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14099	34
GBP1	2633	broad.mit.edu	37	1	89521850	89521850	+	Missense_Mutation	SNP	C	T	T	rs140785577		TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89521850C>T	uc001dmx.2	-	8	1437	c.1217G>A	c.(1216-1218)CGT>CAT	p.R406H		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	406					interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		AGCTGAGCAACGATCTGATGA	0.408													84	266	---	---	---	---	capture	Missense_Mutation	SNP	89521850	89521850	GBP1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6213	34
NBPF10	100132406	broad.mit.edu	37	1	145311916	145311916	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145311916A>G	uc001end.3	+	14	2019	c.1984A>G	c.(1984-1986)ATA>GTA	p.I662V	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_5'UTR|NBPF10_uc010oyl.1_5'UTR|NBPF10_uc010oyj.1_5'UTR|NBPF10_uc010oym.1_5'Flank	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGCCTTTTACATATTGGAGCA	0.458													3	164	---	---	---	---	capture	Missense_Mutation	SNP	145311916	145311916	NBPF10	1	A	G	G	G	1	0	0	0	0	1	0	0	0	92	8	3	3	10100	34
HRNR	388697	broad.mit.edu	37	1	152188002	152188002	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152188002T>C	uc001ezt.1	-	3	6179	c.6103A>G	c.(6103-6105)AGC>GGC	p.S2035G		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2035	22.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACCTGAGCTAGCTCCATGT	0.567													38	640	---	---	---	---	capture	Missense_Mutation	SNP	152188002	152188002	HRNR	1	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	7284	34
BCAN	63827	broad.mit.edu	37	1	156617796	156617796	+	Silent	SNP	A	G	G			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156617796A>G	uc001fpp.2	+	5	999	c.663A>G	c.(661-663)CGA>CGG	p.R221R	BCAN_uc001fpo.2_Silent_p.R221R	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	221	Link 1.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGACCCCACGAGAGGCCTGTT	0.532													33	136	---	---	---	---	capture	Silent	SNP	156617796	156617796	BCAN	1	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	1334	34
PYHIN1	149628	broad.mit.edu	37	1	158914718	158914718	+	Silent	SNP	C	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158914718C>A	uc001ftb.2	+	7	1490	c.1245C>A	c.(1243-1245)CCC>CCA	p.P415P	PYHIN1_uc001ftc.2_Silent_p.P406P|PYHIN1_uc001ftd.2_Silent_p.P415P|PYHIN1_uc001fte.2_Silent_p.P406P	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	415					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					TGGCACTACCCCAGGAACAGA	0.433													39	81	---	---	---	---	capture	Silent	SNP	158914718	158914718	PYHIN1	1	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	12760	34
OR2T6	254879	broad.mit.edu	37	1	248551593	248551593	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248551593G>T	uc001iei.1	+	1	684	c.684G>T	c.(682-684)ATG>ATT	p.M228I		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	228	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGCATCAGATGACATCGGCTG	0.502													45	141	---	---	---	---	capture	Missense_Mutation	SNP	248551593	248551593	OR2T6	1	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	10933	34
ANO9	338440	broad.mit.edu	37	11	420522	420522	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:420522T>C	uc001lpi.2	-	19	1812	c.1727A>G	c.(1726-1728)GAC>GGC	p.D576G	ANO9_uc001lph.2_Missense_Mutation_p.D269G|ANO9_uc010qvv.1_Missense_Mutation_p.D432G	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	576	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						CTTGATGGCGTCCAGGCGGAT	0.687													3	28	---	---	---	---	capture	Missense_Mutation	SNP	420522	420522	ANO9	11	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	698	34
OR51L1	119682	broad.mit.edu	37	11	5020398	5020398	+	Silent	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5020398T>C	uc010qyu.1	+	1	186	c.186T>C	c.(184-186)TAT>TAC	p.Y62Y		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	62	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCCCATGTATTACTTTATTT	0.448													30	277	---	---	---	---	capture	Silent	SNP	5020398	5020398	OR51L1	11	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	11006	34
LYVE1	10894	broad.mit.edu	37	11	10580685	10580685	+	Silent	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:10580685G>A	uc001miv.2	-	6	1228	c.942C>T	c.(940-942)ACC>ACT	p.T314T	uc001miu.2_Intron|LYVE1_uc010rca.1_Silent_p.T210T	NM_006691	NP_006682	Q9Y5Y7	LYVE1_HUMAN	lymphatic vessel endothelial hyaluronan receptor	314	Cytoplasmic (Potential).				anatomical structure morphogenesis|cell-matrix adhesion|cellular component movement|response to wounding|transport	integral to plasma membrane|membrane fraction		p.T314T(1)		central_nervous_system(1)|skin(1)	2				all cancers(16;7.22e-08)|Epithelial(150;1.03e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0609)		GGCATCGCACGGTAGTTTTGC	0.463													124	361	---	---	---	---	capture	Silent	SNP	10580685	10580685	LYVE1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9044	34
MRGPRX1	259249	broad.mit.edu	37	11	18955854	18955854	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18955854A>C	uc001mpg.2	-	1	696	c.478T>G	c.(478-480)TTA>GTA	p.L160V		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	160	Helical; Name=4; (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						AAGCCACATAACATCCACTCC	0.557													22	101	---	---	---	---	capture	Missense_Mutation	SNP	18955854	18955854	MRGPRX1	11	A	C	C	C	1	0	0	0	0	1	0	0	0	24	2	4	4	9676	34
ATG2A	23130	broad.mit.edu	37	11	64663974	64663974	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64663974G>A	uc001obx.2	-	39	5502	c.5387C>T	c.(5386-5388)GCC>GTC	p.A1796V	ATG2A_uc001obw.2_Missense_Mutation_p.A561V	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1796							protein binding			ovary(1)|central_nervous_system(1)	2						TTCCAGGGCGGCAGAGGCTGT	0.637											OREG0004026	type=REGULATORY REGION|Gene=BC027481|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	3	27	---	---	---	---	capture	Missense_Mutation	SNP	64663974	64663974	ATG2A	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1084	34
DSCAML1	57453	broad.mit.edu	37	11	117306485	117306485	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117306485C>T	uc001prh.1	-	27	4933	c.4931G>A	c.(4930-4932)GGT>GAT	p.G1644D		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1584	Extracellular (Potential).				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ATCCCCTTCACCTTGAGCAGA	0.522													31	78	---	---	---	---	capture	Missense_Mutation	SNP	117306485	117306485	DSCAML1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	4724	34
VPS11	55823	broad.mit.edu	37	11	118941054	118941054	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118941054C>T	uc010ryx.1	+	5	625	c.583C>T	c.(583-585)CGC>TGC	p.R195C	VPS11_uc010ryy.1_Missense_Mutation_p.R41C	NM_021729	NP_068375	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11	195					protein transport	endocytic vesicle|HOPS complex|late endosome membrane|lysosomal membrane	nucleotide binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		ATTGGCCTTTCGCCAAGCAGG	0.517													9	28	---	---	---	---	capture	Missense_Mutation	SNP	118941054	118941054	VPS11	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17070	34
ROBO4	54538	broad.mit.edu	37	11	124765757	124765757	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124765757A>C	uc001qbg.2	-	5	871	c.731T>G	c.(730-732)CTG>CGG	p.L244R	ROBO4_uc010sas.1_Missense_Mutation_p.L99R|ROBO4_uc001qbh.2_Missense_Mutation_p.L134R|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	244					angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CACATTTTCCAGCTGAATTCG	0.602													22	88	---	---	---	---	capture	Missense_Mutation	SNP	124765757	124765757	ROBO4	11	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	13408	34
PTPN6	5777	broad.mit.edu	37	12	7069548	7069548	+	Silent	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7069548T>C	uc001qsb.2	+	14	1865	c.1623T>C	c.(1621-1623)TAT>TAC	p.Y541Y	PTPN6_uc001qsa.1_Silent_p.Y543Y|PTPN6_uc010sfr.1_Silent_p.Y502Y|PTPN6_uc009zfl.1_Silent_p.Y541Y|PTPN6_uc010sfs.1_Silent_p.Y529Y	NM_002831	NP_002822	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type	541					apoptosis|cell junction assembly|G-protein coupled receptor protein signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|negative regulation of peptidyl-tyrosine phosphorylation|platelet activation|positive regulation of cell proliferation|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of G1/S transition of mitotic cell cycle|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol|membrane|nucleus	protein binding|protein tyrosine phosphatase activity			breast(1)	1						ACATCACCTATCCCCCAGCCA	0.647													4	38	---	---	---	---	capture	Silent	SNP	7069548	7069548	PTPN6	12	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	12687	34
ZC3H13	23091	broad.mit.edu	37	13	46559437	46559437	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:46559437T>C	uc010tfw.1	-	9	1721	c.1715A>G	c.(1714-1716)GAA>GGA	p.E572G	ZC3H13_uc001vas.1_Missense_Mutation_p.E572G|ZC3H13_uc001vat.1_Missense_Mutation_p.E572G	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	572	Arg/Ser-rich.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CTTACCCTTTTCAGGTAACTC	0.358													37	92	---	---	---	---	capture	Missense_Mutation	SNP	46559437	46559437	ZC3H13	13	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	17445	34
OR4K13	390433	broad.mit.edu	37	14	20502502	20502502	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20502502C>T	uc010tkz.1	-	1	416	c.416G>A	c.(415-417)CGG>CAG	p.R139Q		NM_001004714	NP_001004714	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AGTGAGCACCCGTGGGCTCAT	0.488													79	205	---	---	---	---	capture	Missense_Mutation	SNP	20502502	20502502	OR4K13	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10972	34
NIPA2	81614	broad.mit.edu	37	15	23006662	23006662	+	Silent	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23006662C>T	uc001yux.2	-	8	1255	c.642G>A	c.(640-642)CGG>CGA	p.R214R	NIPA2_uc001yuy.2_Silent_p.R214R|NIPA2_uc001yuz.2_Silent_p.R214R|NIPA2_uc001yva.2_Silent_p.R195R|NIPA2_uc001yvb.2_Silent_p.R214R|NIPA2_uc010ayb.2_Silent_p.R195R	NM_030922	NP_112184	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome	214	Extracellular (Potential).					early endosome|integral to membrane|plasma membrane				haematopoietic_and_lymphoid_tissue(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		CCAGGGGATGCCGCAGCACAG	0.502													4	193	---	---	---	---	capture	Silent	SNP	23006662	23006662	NIPA2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	10330	34
MKRN3	7681	broad.mit.edu	37	15	23811322	23811322	+	Silent	SNP	C	T	T	rs36072495	byFrequency;by1000genomes	TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23811322C>T	uc001ywh.3	+	1	869	c.393C>T	c.(391-393)GGC>GGT	p.G131G	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.G131G	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	131						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CTGAGGGTGGCGTTTCGCCGC	0.622													26	82	---	---	---	---	capture	Silent	SNP	23811322	23811322	MKRN3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9520	34
CLCN7	1186	broad.mit.edu	37	16	1507700	1507700	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1507700C>T	uc002clv.2	-	8	843	c.733G>A	c.(733-735)GGA>AGA	p.G245R	CLCN7_uc002clw.2_Missense_Mutation_p.G221R	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	245	Selectivity filter part_2 (By similarity).					integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				GTTACCTTTCCCACGGCCAGG	0.632													27	54	---	---	---	---	capture	Missense_Mutation	SNP	1507700	1507700	CLCN7	16	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3433	34
PKD1	5310	broad.mit.edu	37	16	2147417	2147417	+	Silent	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2147417C>T	uc002cos.1	-	33	10517	c.10308G>A	c.(10306-10308)CAG>CAA	p.Q3436Q	PKD1_uc002cot.1_Silent_p.Q3435Q|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	3436	Cytoplasmic (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						CCCGTGCCAGCTGCCGCAGAT	0.677													7	27	---	---	---	---	capture	Silent	SNP	2147417	2147417	PKD1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	11866	34
GPR139	124274	broad.mit.edu	37	16	20043354	20043354	+	Silent	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20043354C>T	uc002dgu.1	-	2	927	c.765G>A	c.(763-765)GCG>GCA	p.A255A	GPR139_uc010vaw.1_Silent_p.A162A	NM_001002911	NP_001002911	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	255	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(2)	2						TCTGGATGGGCGCCCCATAGA	0.532													29	97	---	---	---	---	capture	Silent	SNP	20043354	20043354	GPR139	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6582	34
KRT13	3860	broad.mit.edu	37	17	39659672	39659672	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39659672C>T	uc002hwu.1	-	3	665	c.602G>A	c.(601-603)CGC>CAC	p.R201H	KRT13_uc002hwv.1_Missense_Mutation_p.R201H|KRT13_uc002hww.2_Missense_Mutation_p.R94H|KRT13_uc010wfr.1_Missense_Mutation_p.R94H|KRT13_uc010cxo.2_Missense_Mutation_p.R201H|KRT13_uc002hwx.1_Missense_Mutation_p.R189H	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	201	Coil 1B.|Rod.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				CACGCTCTGGCGCAGGGCCAG	0.478													37	98	---	---	---	---	capture	Missense_Mutation	SNP	39659672	39659672	KRT13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8370	34
KRT14	3861	broad.mit.edu	37	17	39741254	39741254	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39741254C>T	uc002hxf.1	-	2	642	c.581G>A	c.(580-582)CGT>CAT	p.R194H	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Missense_Mutation_p.R194H	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	194	Coil 1B.|Rod.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				CGCGGCCAGACGGGCATTGTC	0.502													14	64	---	---	---	---	capture	Missense_Mutation	SNP	39741254	39741254	KRT14	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8371	34
MED13	9969	broad.mit.edu	37	17	60060308	60060308	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60060308C>T	uc002izo.2	-	16	3133	c.3056G>A	c.(3055-3057)CGG>CAG	p.R1019Q		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1019					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						ACGAGGAGTCCGAGGAGTCCT	0.512													3	93	---	---	---	---	capture	Missense_Mutation	SNP	60060308	60060308	MED13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9343	34
TMEM146	257062	broad.mit.edu	37	19	5778542	5778542	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5778542G>A	uc002mda.2	+	22	2313	c.2252G>A	c.(2251-2253)CGC>CAC	p.R751H		NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	751	Cytoplasmic (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						CGCACAGCACGCGGCCGCAGG	0.612													26	67	---	---	---	---	capture	Missense_Mutation	SNP	5778542	5778542	TMEM146	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15944	34
PAPL	390928	broad.mit.edu	37	19	39591660	39591660	+	Silent	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39591660C>T	uc002oki.2	+	8	1153	c.879C>T	c.(877-879)AAC>AAT	p.N293N	PAPL_uc010egl.2_Missense_Mutation_p.T252M	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	293						extracellular region	acid phosphatase activity|metal ion binding				0						ACTGCTCCAACGCAGATCTGG	0.612													27	65	---	---	---	---	capture	Silent	SNP	39591660	39591660	PAPL	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11331	34
KDELR1	10945	broad.mit.edu	37	19	48887570	48887570	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48887570C>T	uc002pjb.1	-	4	716	c.521G>A	c.(520-522)GGC>GAC	p.G174D	KDELR1_uc002pja.1_Missense_Mutation_p.G112D	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum	174	Lumenal (Potential).				intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		GTCGAAGAAGCCCTCGAAATG	0.542													7	30	---	---	---	---	capture	Missense_Mutation	SNP	48887570	48887570	KDELR1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8041	34
ANKRD53	79998	broad.mit.edu	37	2	71209104	71209104	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71209104C>T	uc002shl.3	+	4	857	c.656C>T	c.(655-657)GCC>GTC	p.A219V	ANKRD53_uc002shk.3_Missense_Mutation_p.A219V|ANKRD53_uc002shm.3_Intron	NM_001115116	NP_001108588	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53 isoform a	219	ANK 3.										0						CACCTGGCAGCCCGTGACGGC	0.577													4	97	---	---	---	---	capture	Missense_Mutation	SNP	71209104	71209104	ANKRD53	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	674	34
DYSF	8291	broad.mit.edu	37	2	71871138	71871138	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71871138T>C	uc002sie.2	+	41	4830	c.4454T>C	c.(4453-4455)ATA>ACA	p.I1485T	DYSF_uc010feg.2_Missense_Mutation_p.I1516T|DYSF_uc010feh.2_Missense_Mutation_p.I1492T|DYSF_uc002sig.3_Missense_Mutation_p.I1471T|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.I1506T|DYSF_uc010fef.2_Missense_Mutation_p.I1523T|DYSF_uc010fei.2_Missense_Mutation_p.I1502T|DYSF_uc010fek.2_Missense_Mutation_p.I1503T|DYSF_uc010fej.2_Missense_Mutation_p.I1493T|DYSF_uc010fel.2_Missense_Mutation_p.I1472T|DYSF_uc010feo.2_Missense_Mutation_p.I1517T|DYSF_uc010fem.2_Missense_Mutation_p.I1507T|DYSF_uc010fen.2_Missense_Mutation_p.I1524T|DYSF_uc002sif.2_Missense_Mutation_p.I1486T|DYSF_uc010yqy.1_Missense_Mutation_p.I366T|DYSF_uc010yqz.1_Missense_Mutation_p.I246T	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1485	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						TTTGCCTCCATAGGGGAGAGG	0.502													7	20	---	---	---	---	capture	Missense_Mutation	SNP	71871138	71871138	DYSF	2	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	4814	34
FAM123C	205147	broad.mit.edu	37	2	131521578	131521578	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131521578C>T	uc002trw.2	+	2	2123	c.1933C>T	c.(1933-1935)CCT>TCT	p.P645S	FAM123C_uc010fmv.2_Missense_Mutation_p.P645S|FAM123C_uc010fms.1_Missense_Mutation_p.P645S|FAM123C_uc010fmt.1_Missense_Mutation_p.P645S|FAM123C_uc010fmu.1_Missense_Mutation_p.P645S	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	645										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CCAGAAGGAGCCTGGGCCACC	0.602													13	23	---	---	---	---	capture	Missense_Mutation	SNP	131521578	131521578	FAM123C	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5378	34
SCN9A	6335	broad.mit.edu	37	2	167085307	167085307	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167085307C>T	uc010fpl.2	-	22	4408	c.4067G>A	c.(4066-4068)CGT>CAT	p.R1356H	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1367	III.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	ACATTCGGAACGATTTGGAAC	0.398													87	347	---	---	---	---	capture	Missense_Mutation	SNP	167085307	167085307	SCN9A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13818	34
HDLBP	3069	broad.mit.edu	37	2	242173290	242173290	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242173290A>G	uc002waz.2	-	24	3461	c.3233T>C	c.(3232-3234)ATC>ACC	p.I1078T	HDLBP_uc002wba.2_Missense_Mutation_p.I1078T|HDLBP_uc002wbb.2_Missense_Mutation_p.I1030T	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	1078	KH 13.				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CTCCAACCGGATTTGGGTAAT	0.498													34	140	---	---	---	---	capture	Missense_Mutation	SNP	242173290	242173290	HDLBP	2	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	6952	34
SLC24A3	57419	broad.mit.edu	37	20	19677519	19677519	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:19677519C>T	uc002wrl.2	+	14	1767	c.1570C>T	c.(1570-1572)CCT>TCT	p.P524S		NM_020689	NP_065740	Q9HC58	NCKX3_HUMAN	solute carrier family 24	524	Alpha-2.|Helical; (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1						GACCAGCGTGCCTGACTGCAT	0.448													4	109	---	---	---	---	capture	Missense_Mutation	SNP	19677519	19677519	SLC24A3	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14359	34
ZSWIM1	90204	broad.mit.edu	37	20	44512381	44512381	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44512381T>C	uc010ghi.2	+	2	1263	c.1150T>C	c.(1150-1152)TGC>CGC	p.C384R	ZSWIM1_uc010zxh.1_Missense_Mutation_p.C257R	NM_080603	NP_542170	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	384	SWIM-type.						zinc ion binding			skin(1)	1		Myeloproliferative disorder(115;0.028)				CAGCTGCAGCTGCTACTTTAA	0.597													17	59	---	---	---	---	capture	Missense_Mutation	SNP	44512381	44512381	ZSWIM1	20	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	18116	34
COL20A1	57642	broad.mit.edu	37	20	61938888	61938888	+	Silent	SNP	C	G	G			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61938888C>G	uc011aau.1	+	6	643	c.543C>G	c.(541-543)GTC>GTG	p.V181V	COL20A1_uc011aav.1_Silent_p.V2V	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	181	VWFA.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CTGACATGGTCTTCCTGGTGG	0.652													7	41	---	---	---	---	capture	Silent	SNP	61938888	61938888	COL20A1	20	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	3644	34
TMPRSS2	7113	broad.mit.edu	37	21	42842599	42842599	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:42842599C>T	uc002yzj.2	-	11	1281	c.1147G>A	c.(1147-1149)GGG>AGG	p.G383R	TMPRSS2_uc010gor.2_Missense_Mutation_p.G420R|TMPRSS2_uc010gos.1_Missense_Mutation_p.G383R	NM_005656	NP_005647	O15393	TMPS2_HUMAN	transmembrane protease, serine 2 isoform 2	383	Peptidase S1.|Extracellular (Potential).				proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity		TMPRSS2/ERG(2499)|TMPRSS2/ETV1(24)	prostate(2523)|central_nervous_system(1)	2524		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				GCCCCCCACCCGGAAATCCAG	0.488			T	ERG|ETV1|ETV4|ETV5	prostate 								11	32	---	---	---	---	capture	Missense_Mutation	SNP	42842599	42842599	TMPRSS2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16130	34
FBXO7	25793	broad.mit.edu	37	22	32887162	32887162	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32887162C>T	uc003amq.2	+	6	1244	c.961C>T	c.(961-963)CGA>TGA	p.R321*	FBXO7_uc003amp.1_3'UTR|FBXO7_uc003amr.2_Nonsense_Mutation_p.R207*|FBXO7_uc003ams.2_Nonsense_Mutation_p.R165*|FBXO7_uc003amt.2_Nonsense_Mutation_p.R242*|FBXO7_uc003amu.2_Nonsense_Mutation_p.R207*|FBXO7_uc003amv.2_5'Flank	NM_012179	NP_036311	Q9Y3I1	FBX7_HUMAN	F-box only protein 7 isoform 1	321					cell death|regulation of protein stability|ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						GGCTTTTACCCGACAAGGTAA	0.368													26	96	---	---	---	---	capture	Nonsense_Mutation	SNP	32887162	32887162	FBXO7	22	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	5706	34
CCK	885	broad.mit.edu	37	3	42305011	42305011	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42305011C>T	uc003clc.1	-	2	321	c.112G>A	c.(112-114)GAG>AAG	p.E38K	CCK_uc003cld.1_Missense_Mutation_p.E38K|CCK_uc011azk.1_Missense_Mutation_p.E38K	NM_000729	NP_000720	P06307	CCKN_HUMAN	cholecystokinin preproprotein	38					axonogenesis|eating behavior|neuron migration		neuropeptide hormone activity	p.E38K(1)		central_nervous_system(1)	1		Ovarian(412;0.0728)		KIRC - Kidney renal clear cell carcinoma(284;0.219)		CGGGGCGCCTCCTCTGCCCGC	0.711													17	38	---	---	---	---	capture	Missense_Mutation	SNP	42305011	42305011	CCK	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2852	34
MANF	7873	broad.mit.edu	37	3	51425306	51425306	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51425306T>C	uc003dbc.2	+	3	432	c.370T>C	c.(370-372)TAT>CAT	p.Y124H		NM_006010	NP_006001	P55145	MANF_HUMAN	mesencephalic astrocyte-derived neurotrophic	121					response to unfolded protein	extracellular region	growth factor activity				0						TGAGCTTAAGTATGGTGAGTA	0.458													12	31	---	---	---	---	capture	Missense_Mutation	SNP	51425306	51425306	MANF	3	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	9137	34
DKK2	27123	broad.mit.edu	37	4	107847047	107847047	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:107847047G>T	uc003hyi.2	-	2	987	c.282C>A	c.(280-282)CAC>CAA	p.H94Q	DKK2_uc010ilw.1_RNA|DKK2_uc003hyj.1_Missense_Mutation_p.H94Q	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor	94	DKK-type Cys-1.				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		ATGATCCTTGGTGGGGACTGT	0.502													44	120	---	---	---	---	capture	Missense_Mutation	SNP	107847047	107847047	DKK2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	4503	34
DCHS2	54798	broad.mit.edu	37	4	155305544	155305544	+	Silent	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155305544G>A	uc003inw.2	-	2	210	c.210C>T	c.(208-210)AAC>AAT	p.N70N	DCHS2_uc003inx.2_Intron	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	70	Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ctggttttgcgttctcttcct	0.010													25	62	---	---	---	---	capture	Silent	SNP	155305544	155305544	DCHS2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4247	34
ODZ3	55714	broad.mit.edu	37	4	183713527	183713527	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183713527C>T	uc003ivd.1	+	25	5739	c.5702C>T	c.(5701-5703)ACC>ATC	p.T1901I		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1901	YD 7.|Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		GCTCGCCACACCATGCAGACC	0.547													10	18	---	---	---	---	capture	Missense_Mutation	SNP	183713527	183713527	ODZ3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	10741	34
GPR98	84059	broad.mit.edu	37	5	89969926	89969926	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89969926G>A	uc003kju.2	+	23	5081	c.4985G>A	c.(4984-4986)CGT>CAT	p.R1662H	GPR98_uc003kjt.2_Translation_Start_Site|GPR98_uc010jba.1_RNA	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1662	Calx-beta 11.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GAGTATTTCCGTGTGACATTG	0.393													19	53	---	---	---	---	capture	Missense_Mutation	SNP	89969926	89969926	GPR98	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6654	34
PCDHB9	56127	broad.mit.edu	37	5	140568233	140568233	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140568233G>A	uc003liw.1	+	3	1342	c.1342G>A	c.(1342-1344)GCC>ACC	p.A448T		NM_019119	NP_061992	Q9Y5E1	PCDB9_HUMAN	protocadherin beta 9 precursor	448	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAATGACAACGCCCCCGCCTT	0.592													61	151	---	---	---	---	capture	Missense_Mutation	SNP	140568233	140568233	PCDHB9	5	G	A	A	A	1	0	0	0	0	1	0	0	0	483	38	1	1	11452	34
FAT2	2196	broad.mit.edu	37	5	150923883	150923883	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150923883G>T	uc003lue.3	-	9	6818	c.6805C>A	c.(6805-6807)CCT>ACT	p.P2269T	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2269	Cadherin 19.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAAGTGGGAGGGTTATCATTG	0.502													40	119	---	---	---	---	capture	Missense_Mutation	SNP	150923883	150923883	FAT2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	5636	34
FAM71B	153745	broad.mit.edu	37	5	156592924	156592924	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156592924C>T	uc003lwn.2	-	1	356	c.256G>A	c.(256-258)GTC>ATC	p.V86I		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	86						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGAACCATGACGTCAGGCAGT	0.542													23	108	---	---	---	---	capture	Missense_Mutation	SNP	156592924	156592924	FAM71B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5556	34
HLA-B	3106	broad.mit.edu	37	6	31322411	31322411	+	Silent	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31322411C>T	uc003nth.2	-	6	1098	c.1044G>A	c.(1042-1044)GCG>GCA	p.A348A	HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_Silent_p.A227A|HLA-B_uc003nti.1_RNA	NM_005514	NP_005505	P01889	1B07_HUMAN	major histocompatibility complex, class I, B	348	Cytoplasmic (Potential).				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						ACCACTTACACGCAGCCTGAG	0.572									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				22	75	---	---	---	---	capture	Silent	SNP	31322411	31322411	HLA-B	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	7121	34
TRAM2	9697	broad.mit.edu	37	6	52370483	52370483	+	Silent	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52370483G>A	uc003paq.2	-	9	938	c.789C>T	c.(787-789)GCC>GCT	p.A263A	EFHC1_uc011dwv.1_Intron|TRAM2_uc003par.1_RNA	NM_012288	NP_036420	Q15035	TRAM2_HUMAN	translocation-associated membrane protein 2	263	TLC.|Helical; (Potential).				collagen biosynthetic process|protein transport|transmembrane transport	integral to membrane	protein binding				0	Lung NSC(77;0.109)					TGGCCAGCACGGCAAGGGTGA	0.542													3	115	---	---	---	---	capture	Silent	SNP	52370483	52370483	TRAM2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16336	34
TCP10	6953	broad.mit.edu	37	6	167790118	167790118	+	Silent	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167790118G>A	uc003qvv.1	-	5	704	c.492C>T	c.(490-492)CCC>CCT	p.P164P	TCP10_uc003qvu.2_Silent_p.P164P|TCP10_uc003qvw.2_Silent_p.P140P	NM_004610	NP_004601	Q12799	TCP10_HUMAN	t-complex 10	191						cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GACGTCTCCCGGGAGGACTTT	0.493													43	72	---	---	---	---	capture	Silent	SNP	167790118	167790118	TCP10	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15595	34
NXPH1	30010	broad.mit.edu	37	7	8791118	8791118	+	Missense_Mutation	SNP	G	C	C	rs145299363	by1000genomes	TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:8791118G>C	uc003srv.2	+	3	1446	c.535G>C	c.(535-537)GCA>CCA	p.A179P	NXPH1_uc011jxh.1_Missense_Mutation_p.A62P	NM_152745	NP_689958	P58417	NXPH1_HUMAN	neurexophilin 1 precursor	179	IV (linker domain).					extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		ATTTGACTTGGCACAACAAAC	0.398													9	85	---	---	---	---	capture	Missense_Mutation	SNP	8791118	8791118	NXPH1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	10695	34
THSD7A	221981	broad.mit.edu	37	7	11422186	11422186	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:11422186G>A	uc003ssf.3	-	23	4721	c.4469C>T	c.(4468-4470)ACA>ATA	p.T1490I	uc003ssb.2_Intron|THSD7A_uc003ssd.3_5'Flank	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1490	Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ACACCACACTGTTCGGGAAGA	0.418										HNSCC(18;0.044)			16	71	---	---	---	---	capture	Missense_Mutation	SNP	11422186	11422186	THSD7A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	15764	34
DNAH11	8701	broad.mit.edu	37	7	21599234	21599234	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21599234G>A	uc003svc.2	+	4	737	c.706G>A	c.(706-708)GAA>AAA	p.E236K		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	236	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ACCGTCAAACGAAAGGATAAT	0.313									Kartagener_syndrome				12	38	---	---	---	---	capture	Missense_Mutation	SNP	21599234	21599234	DNAH11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4557	34
GRB10	2887	broad.mit.edu	37	7	50742172	50742172	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50742172C>G	uc003tpi.2	-	3	354	c.323G>C	c.(322-324)AGG>ACG	p.R108T	GRB10_uc003tph.3_Missense_Mutation_p.R50T|GRB10_uc003tpj.2_Missense_Mutation_p.R108T|GRB10_uc003tpk.2_Missense_Mutation_p.R108T|GRB10_uc010kzb.2_Missense_Mutation_p.R50T|GRB10_uc003tpl.2_Missense_Mutation_p.R102T|GRB10_uc003tpm.2_Missense_Mutation_p.R50T|GRB10_uc003tpn.2_Missense_Mutation_p.R50T	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform	108					insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					GCGCTGCACCCTCTGCCTCGG	0.657									Russell-Silver_syndrome				17	54	---	---	---	---	capture	Missense_Mutation	SNP	50742172	50742172	GRB10	7	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	6689	34
PCLO	27445	broad.mit.edu	37	7	82763793	82763793	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82763793T>C	uc003uhx.2	-	3	3362	c.3073A>G	c.(3073-3075)AAA>GAA	p.K1025E	PCLO_uc003uhv.2_Missense_Mutation_p.K1025E	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	971	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGTGGCTTTTTTTCTGTTTCT	0.408													19	72	---	---	---	---	capture	Missense_Mutation	SNP	82763793	82763793	PCLO	7	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	11486	34
RELN	5649	broad.mit.edu	37	7	103270455	103270455	+	Silent	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103270455C>T	uc003vca.2	-	20	2794	c.2634G>A	c.(2632-2634)GAG>GAA	p.E878E	RELN_uc010liz.2_Silent_p.E878E	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	878					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACTGAGTGACCTCCACAAGAT	0.408													34	208	---	---	---	---	capture	Silent	SNP	103270455	103270455	RELN	7	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	13115	34
TAS2R39	259285	broad.mit.edu	37	7	142881262	142881262	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142881262G>A	uc011ksw.1	+	1	751	c.751G>A	c.(751-753)GAC>AAC	p.D251N		NM_176881	NP_795362	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	251	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1	Melanoma(164;0.059)					AGGGTCCAACGACCCCAGCAT	0.498													54	243	---	---	---	---	capture	Missense_Mutation	SNP	142881262	142881262	TAS2R39	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15464	34
OR2A5	393046	broad.mit.edu	37	7	143748162	143748162	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143748162C>T	uc011ktw.1	+	1	668	c.668C>T	c.(667-669)GCG>GTG	p.A223V		NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)					CGCATCCTGGCGGCCATCTTG	0.607													85	280	---	---	---	---	capture	Missense_Mutation	SNP	143748162	143748162	OR2A5	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10885	34
TEX15	56154	broad.mit.edu	37	8	30695500	30695500	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30695500G>A	uc003xil.2	-	3	7151	c.7151C>T	c.(7150-7152)ACG>ATG	p.T2384M		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2384										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTTTTTTGGCGTTAAATGATT	0.388													71	269	---	---	---	---	capture	Missense_Mutation	SNP	30695500	30695500	TEX15	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15664	34
ADAM18	8749	broad.mit.edu	37	8	39502901	39502901	+	Silent	SNP	T	C	C			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39502901T>C	uc003xni.2	+	11	954	c.954T>C	c.(952-954)GCT>GCC	p.A318A	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Silent_p.A294A	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	318	Peptidase M12B.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TTATTATAGCTCAACTGCTTG	0.333													3	214	---	---	---	---	capture	Silent	SNP	39502901	39502901	ADAM18	8	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	239	34
IL7	3574	broad.mit.edu	37	8	79710323	79710323	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:79710323C>T	uc003ybg.2	-	2	732	c.131G>A	c.(130-132)AGC>AAC	p.S44N	IL7_uc003ybe.2_Missense_Mutation_p.S3N|IL7_uc011lfm.1_RNA|IL7_uc003ybh.2_Intron|IL7_uc003ybi.3_RNA	NM_000880	NP_000871	P13232	IL7_HUMAN	interleukin 7 precursor	44					bone resorption|cell-cell signaling|humoral immune response|organ morphogenesis|positive regulation of B cell proliferation|positive regulation of T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-7 receptor binding				0						TTGATCGATGCTGACCATTAG	0.353													35	120	---	---	---	---	capture	Missense_Mutation	SNP	79710323	79710323	IL7	8	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	7627	34
GPR20	2843	broad.mit.edu	37	8	142366995	142366995	+	Silent	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142366995G>A	uc003ywf.2	-	2	1118	c.1029C>T	c.(1027-1029)GCC>GCT	p.A343A		NM_005293	NP_005284	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	343	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			CGTGAGGGCCGGCACTGAGGA	0.667													11	43	---	---	---	---	capture	Silent	SNP	142366995	142366995	GPR20	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6614	34
C9orf131	138724	broad.mit.edu	37	9	35045456	35045456	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35045456A>G	uc003zvw.2	+	2	2859	c.2830A>G	c.(2830-2832)AAG>GAG	p.K944E	C9orf131_uc003zvu.2_Missense_Mutation_p.K896E|C9orf131_uc003zvv.2_Missense_Mutation_p.K871E|C9orf131_uc003zvx.2_Missense_Mutation_p.K909E	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	944											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CTCAGCCAAAAAGAGAGAGCA	0.532													63	111	---	---	---	---	capture	Missense_Mutation	SNP	35045456	35045456	C9orf131	9	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	2434	34
COL15A1	1306	broad.mit.edu	37	9	101797331	101797331	+	Silent	SNP	G	A	A			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101797331G>A	uc004azb.1	+	18	2321	c.2115G>A	c.(2113-2115)CCG>CCA	p.P705P		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	705	Triple-helical region 2 (COL2).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				CTGGACCCCCGGGGAAAAAGG	0.612													35	115	---	---	---	---	capture	Silent	SNP	101797331	101797331	COL15A1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3637	34
FHOD3	80206	broad.mit.edu	37	18	34261459	34261460	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:34261459_34261460delAG	uc002kzt.1	+	12	1468_1469	c.1371_1372delAG	c.(1369-1374)GCAGAGfs	p.A457fs	FHOD3_uc002kzr.1_Frame_Shift_Del_p.A457fs|FHOD3_uc002kzs.1_Frame_Shift_Del_p.A457fs|FHOD3_uc010dmz.1_Frame_Shift_Del_p.A172fs	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	457_458	Potential.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CACTGGCAGCAGAGAGAGAGAG	0.460													7	91	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	34261459	34261460	FHOD3	18	AG	-	-	-	1	0	1	0	1	0	0	0	0	80	7	5	5	5829	34
MUC16	94025	broad.mit.edu	37	19	9067788	9067788	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9067788delG	uc002mkp.2	-	3	19862	c.19658delC	c.(19657-19659)ACAfs	p.T6553fs		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6555	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGCATATCTGTGGTCTTCAC	0.473													23	77	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	9067788	9067788	MUC16	19	G	-	-	-	1	0	1	0	1	0	0	0	0	624	48	5	5	9883	34
TRPM4	54795	broad.mit.edu	37	19	49705399	49705400	+	Splice_Site	INS	-	T	T			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49705399_49705400insT	uc002pmw.2	+	20	3203	c.3131_splice	c.e20+1	p.S1044_splice	TRPM4_uc010emu.2_Splice_Site_p.S899_splice|TRPM4_uc010yak.1_Splice_Site_p.S508_splice|TRPM4_uc002pmx.2_Splice_Site_p.S870_splice|TRPM4_uc010emv.2_Splice_Site_p.S929_splice|TRPM4_uc010yal.1_Splice_Site_p.S690_splice|TRPM4_uc002pmy.2_Splice_Site_p.S386_splice	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,						dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CCATGTTCAGGTGAGGCCTGAC	0.550													57	156	---	---	---	---	capture_indel	Splice_Site	INS	49705399	49705400	TRPM4	19	-	T	T	T	1	0	1	1	0	0	0	1	0	572	44	5	5	16471	34
EIF2S3	1968	broad.mit.edu	37	X	24094874	24094877	+	Frame_Shift_Del	DEL	CAAT	-	-			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24094874_24094877delCAAT	uc004dbc.2	+	12	1412_1415	c.1391_1394delCAAT	c.(1390-1395)ACAATCfs	p.T464fs		NM_001415	NP_001406	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2,	464_465						cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			lung(1)	1						AGAGGAGTGACAATCAAGCCAACA	0.348													57	65	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	24094874	24094877	EIF2S3	23	CAAT	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	4966	34
NAP1L2	4674	broad.mit.edu	37	X	72433664	72433666	+	In_Frame_Del	DEL	TCC	-	-			TCGA-06-0169-01	TCGA-06-0169-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:72433664_72433666delTCC	uc004ebi.2	-	1	1019_1021	c.663_665delGGA	c.(661-666)GAGGAC>GAC	p.E221del	NAP1L2_uc011mqj.1_In_Frame_Del_p.E79del	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	221	Glu-rich (acidic).				nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					CTCAATGTCGtcctcctcctcct	0.330													7	79	---	---	---	---	capture_indel	In_Frame_Del	DEL	72433664	72433666	NAP1L2	23	TCC	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	10065	34
