Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HFM1	164045	broad.mit.edu	37	1	91784871	91784871	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91784871G>A	uc001doa.3	-	24	2759	c.2659C>T	c.(2659-2661)CAT>TAT	p.H887Y	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.H566Y|HFM1_uc001dob.3_Missense_Mutation_p.H119Y|HFM1_uc010osv.1_Missense_Mutation_p.H571Y	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	887	SEC63.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CGGGAGCCATGTCTGAAAATC	0.323													20	103	---	---	---	---	capture	Missense_Mutation	SNP	91784871	91784871	HFM1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	7008	35
SPRR4	163778	broad.mit.edu	37	1	152944576	152944576	+	Silent	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152944576C>T	uc001fav.1	+	2	273	c.210C>T	c.(208-210)GCC>GCT	p.A70A		NM_173080	NP_775103	Q96PI1	SPRR4_HUMAN	small proline-rich protein 4	70	Gln-rich.				keratinization|peptide cross-linking	cell cortex					0	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCCCTCAGCCCAGCAAGCCT	0.522													29	83	---	---	---	---	capture	Silent	SNP	152944576	152944576	SPRR4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14996	35
KCNH1	3756	broad.mit.edu	37	1	211093222	211093222	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:211093222C>T	uc001hib.2	-	7	1392	c.1222G>A	c.(1222-1224)GAG>AAG	p.E408K	KCNH1_uc001hic.2_Missense_Mutation_p.E381K	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	408	Extracellular (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TTGGTGTCCTCGTCAAAGATC	0.547													46	143	---	---	---	---	capture	Missense_Mutation	SNP	211093222	211093222	KCNH1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7953	35
OR4D5	219875	broad.mit.edu	37	11	123810393	123810393	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123810393C>T	uc001pzk.1	+	1	70	c.70C>T	c.(70-72)CGG>TGG	p.R24W		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTGGGAGCTTCGGTTTGTTTT	0.468													7	196	---	---	---	---	capture	Missense_Mutation	SNP	123810393	123810393	OR4D5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	10961	35
PTPN11	5781	broad.mit.edu	37	12	112910837	112910837	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112910837C>G	uc001ttx.2	+	7	1226	c.846C>G	c.(844-846)ATC>ATG	p.I282M	PTPN11_uc001ttw.1_Missense_Mutation_p.I282M	NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	282	Tyrosine-protein phosphatase.		I -> V (in NS1).		axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding	p.I282M(1)		haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						ataaaaacaTCCTGCCCTGTA	0.383			Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				28	91	---	---	---	---	capture	Missense_Mutation	SNP	112910837	112910837	PTPN11	12	C	G	G	G	1	0	0	0	0	1	0	0	0	382	30	4	4	12675	35
NRL	4901	broad.mit.edu	37	14	24550696	24550696	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24550696C>G	uc001wlo.2	-	3	594	c.463G>C	c.(463-465)GAC>CAC	p.D155H	NRL_uc001wlp.2_Missense_Mutation_p.D155H|NRL_uc001wlq.2_Missense_Mutation_p.D155H	NM_006177	NP_006168	P54845	NRL_HUMAN	neural retina leucine zipper	155					response to stimulus|transcription from RNA polymerase II promoter|visual perception	nucleus	leucine zipper domain binding|sequence-specific DNA binding				0				GBM - Glioblastoma multiforme(265;0.0181)		AGCGCCTCGTCGCGCCCGCAG	0.711													2	7	---	---	---	---	capture	Missense_Mutation	SNP	24550696	24550696	NRL	14	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	10563	35
KIAA0284	283638	broad.mit.edu	37	14	105360904	105360904	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105360904C>T	uc010axb.2	+	18	4620	c.4396C>T	c.(4396-4398)CGG>TGG	p.R1466W	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Missense_Mutation_p.R1396W|KIAA0284_uc001yps.2_Missense_Mutation_p.R1407W|KIAA0284_uc001ypt.2_Missense_Mutation_p.R134W	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	1501						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		GGAACTGAGGCGGGTGCAGAA	0.632													5	20	---	---	---	---	capture	Missense_Mutation	SNP	105360904	105360904	KIAA0284	14	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	8088	35
CSPG4	1464	broad.mit.edu	37	15	75982433	75982433	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75982433C>T	uc002baw.2	-	3	1066	c.973G>A	c.(973-975)GGG>AGG	p.G325R		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	325	Extracellular (Potential).|Neurite growth inhibition (By similarity).|Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 2.				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						TCCAGCCCCCCGAGAAGGAGA	0.627													11	15	---	---	---	---	capture	Missense_Mutation	SNP	75982433	75982433	CSPG4	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3925	35
AKAP13	11214	broad.mit.edu	37	15	86076975	86076975	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:86076975C>A	uc002blv.1	+	4	512	c.342C>A	c.(340-342)AAC>AAA	p.N114K	AKAP13_uc002bls.2_Missense_Mutation_p.N114K|AKAP13_uc002blt.1_Missense_Mutation_p.N114K|AKAP13_uc002blu.1_Missense_Mutation_p.N114K	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	114					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						AGGCTTTGAACTTTACCCGTT	0.498													36	146	---	---	---	---	capture	Missense_Mutation	SNP	86076975	86076975	AKAP13	15	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	449	35
FAM169B	283777	broad.mit.edu	37	15	99023998	99023998	+	Silent	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99023998C>T	uc002buk.1	-	4	265	c.15G>A	c.(13-15)TCG>TCA	p.S5S		NM_182562	NP_872368	Q8N8A8	F169B_HUMAN	hypothetical protein LOC283777	5											0						TTTCCCCAAACGACTGAACCT	0.378													15	34	---	---	---	---	capture	Silent	SNP	99023998	99023998	FAM169B	15	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5441	35
INPP5K	51763	broad.mit.edu	37	17	1417264	1417264	+	Silent	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1417264G>A	uc002fsr.2	-	2	443	c.54C>T	c.(52-54)GTC>GTT	p.V18V	INPP5K_uc002fss.2_5'UTR|INPP5K_uc002fsq.2_5'UTR|INPP5K_uc010cjr.2_5'UTR|INPP5K_uc010vql.1_Intron|INPP5K_uc010vqm.1_Silent_p.V18V|INPP5K_uc010cjs.2_Silent_p.V18V	NM_016532	NP_057616	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K isoform	18	Catalytic (Potential).				actin cytoskeleton organization	cytosol|endoplasmic reticulum|membrane fraction|neuron projection|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol bisphosphate phosphatase activity|inositol bisphosphate phosphatase activity|inositol trisphosphate phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|lipid phosphatase activity|protein binding				0						TCCAAGTCACGACGTGTATGC	0.448													23	60	---	---	---	---	capture	Silent	SNP	1417264	1417264	INPP5K	17	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	7683	35
RPTOR	57521	broad.mit.edu	37	17	78938060	78938060	+	Splice_Site	SNP	A	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78938060A>G	uc002jyt.1	+	34	4745	c.3940_splice	c.e34-2	p.P1314_splice	RPTOR_uc010wug.1_Splice_Site_p.P1156_splice|RPTOR_uc002jyu.1_Splice_Site_p.P207_splice	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						CTCTCCTTGCAGCCTCACCTG	0.677													26	71	---	---	---	---	capture	Splice_Site	SNP	78938060	78938060	RPTOR	17	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	13557	35
DSC2	1824	broad.mit.edu	37	18	28671091	28671091	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28671091G>T	uc002kwl.3	-	4	828	c.374C>A	c.(373-375)ACT>AAT	p.T125N	DSC2_uc002kwk.3_Missense_Mutation_p.T125N	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	125					homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TTTTTCTTTAGTATGTCTTTT	0.368													27	57	---	---	---	---	capture	Missense_Mutation	SNP	28671091	28671091	DSC2	18	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	4721	35
ONECUT2	9480	broad.mit.edu	37	18	55143848	55143848	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55143848G>A	uc002lgo.2	+	2	1440	c.1408G>A	c.(1408-1410)GTC>ATC	p.V470I		NM_004852	NP_004843	O95948	ONEC2_HUMAN	one cut domain, family member 2	470	Homeobox.				organ morphogenesis	nucleus	sequence-specific DNA binding	p.V470I(1)		ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GCTCACAACCGTCAGCAACTT	0.587													35	89	---	---	---	---	capture	Missense_Mutation	SNP	55143848	55143848	ONECUT2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10773	35
SERPINB13	5275	broad.mit.edu	37	18	61256912	61256912	+	Missense_Mutation	SNP	C	T	T	rs61733412	byFrequency	TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61256912C>T	uc002ljc.2	+	3	356	c.188C>T	c.(187-189)ACG>ATG	p.T63M	SERPINB13_uc002ljd.2_Translation_Start_Site|SERPINB13_uc010xep.1_Missense_Mutation_p.T63M|SERPINB13_uc010xeq.1_Translation_Start_Site|SERPINB13_uc010xer.1_Translation_Start_Site	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN	serine (or cysteine) proteinase inhibitor, clade	63					regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1						GAAAAAGAGACGAAGAGCTCA	0.418													10	41	---	---	---	---	capture	Missense_Mutation	SNP	61256912	61256912	SERPINB13	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13993	35
ZNF407	55628	broad.mit.edu	37	18	72775723	72775723	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72775723G>A	uc002llw.2	+	8	6103	c.6046G>A	c.(6046-6048)GCC>ACC	p.A2016T		NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	2016					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CAGGCCCGGCGCCAAAGACGT	0.672													12	16	---	---	---	---	capture	Missense_Mutation	SNP	72775723	72775723	ZNF407	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17767	35
PLIN4	729359	broad.mit.edu	37	19	4511532	4511532	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4511532C>T	uc002mar.1	-	3	2398	c.2398G>A	c.(2398-2400)GTC>ATC	p.V800I	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	800	22.|27 X 33 AA approximate tandem repeat.					lipid particle|plasma membrane					0						CCCATCTGGACGGCCCCCTTG	0.612													44	306	---	---	---	---	capture	Missense_Mutation	SNP	4511532	4511532	PLIN4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11995	35
KHSRP	8570	broad.mit.edu	37	19	6418513	6418513	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6418513C>T	uc002mer.3	-	9	970	c.860G>A	c.(859-861)GGG>GAG	p.G287E		NM_003685	NP_003676	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	287	Gly-rich.|KH 2.				mRNA processing|mRNA transport|regulation of transcription, DNA-dependent|RNA splicing, via transesterification reactions|transcription, DNA-dependent	cytosol|nucleus	DNA binding|protein binding|RNA binding			skin(1)	1						GTAAGGATCCCCAATGATGCG	0.567													9	40	---	---	---	---	capture	Missense_Mutation	SNP	6418513	6418513	KHSRP	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8073	35
CYP4F11	57834	broad.mit.edu	37	19	16024697	16024697	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16024697C>T	uc002nbu.2	-	13	1456	c.1420G>A	c.(1420-1422)GCC>ACC	p.A474T	CYP4F11_uc010eab.1_Missense_Mutation_p.R452H|CYP4F11_uc002nbt.2_Missense_Mutation_p.A474T	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	474					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						TCAGCCATGGCGAACGCCTGC	0.617													6	44	---	---	---	---	capture	Missense_Mutation	SNP	16024697	16024697	CYP4F11	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4146	35
LILRB4	11006	broad.mit.edu	37	19	55175475	55175475	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55175475C>A	uc002qgp.2	+	3	696	c.334C>A	c.(334-336)CCC>ACC	p.P112T	LILRB4_uc002qgo.1_Missense_Mutation_p.P153T|LILRB4_uc002qgq.2_Missense_Mutation_p.P112T|LILRB4_uc010ers.1_Missense_Mutation_p.P25T|LILRB4_uc002qgr.2_Missense_Mutation_p.P153T|LILRB4_uc010ert.2_Missense_Mutation_p.P153T|LILRB4_uc010eru.2_Missense_Mutation_p.P141T	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	112	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		GCCCAGTGACCCCCTGGAGCT	0.602													17	181	---	---	---	---	capture	Missense_Mutation	SNP	55175475	55175475	LILRB4	19	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	8713	35
FAM98A	25940	broad.mit.edu	37	2	33813426	33813426	+	Silent	SNP	T	C	C			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:33813426T>C	uc002rpa.1	-	4	572	c.498A>G	c.(496-498)CAA>CAG	p.Q166Q	FAM98A_uc010yne.1_Intron|FAM98A_uc010ynd.1_5'Flank|FAM98A_uc002roz.1_Silent_p.Q43Q	NM_015475	NP_056290	Q8NCA5	FA98A_HUMAN	hypothetical protein LOC25940	166										ovary(1)	1	all_hematologic(175;0.115)					CGCTGAAGAATTGGAACATAG	0.363													84	174	---	---	---	---	capture	Silent	SNP	33813426	33813426	FAM98A	2	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	5602	35
COL6A3	1293	broad.mit.edu	37	2	238253186	238253186	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238253186G>A	uc002vwl.2	-	36	7760	c.7475C>T	c.(7474-7476)TCG>TTG	p.S2492L	COL6A3_uc002vwo.2_Missense_Mutation_p.S2286L|COL6A3_uc010znj.1_Missense_Mutation_p.S1885L|COL6A3_uc002vwj.2_5'Flank|COL6A3_uc002vwp.1_Missense_Mutation_p.S313L	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2492	VWFA 11.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGCCACAAACGACATGGCAGT	0.507													60	122	---	---	---	---	capture	Missense_Mutation	SNP	238253186	238253186	COL6A3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3666	35
PDYN	5173	broad.mit.edu	37	20	1961118	1961118	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1961118G>A	uc010gaj.2	-	3	858	c.616C>T	c.(616-618)CGC>TGC	p.R206C	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.R206C|PDYN_uc010zpt.1_Missense_Mutation_p.R51C	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	206					cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						CCCCCATAGCGTTTGTACAGG	0.592													75	254	---	---	---	---	capture	Missense_Mutation	SNP	1961118	1961118	PDYN	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11602	35
RBPJL	11317	broad.mit.edu	37	20	43940278	43940278	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43940278G>A	uc002xns.2	+	4	379	c.307G>A	c.(307-309)GTG>ATG	p.V103M	RBPJL_uc002xnt.2_Missense_Mutation_p.V103M	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L	103					signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				TGGCTGGAGGGTGAAGCCAGG	0.642											OREG0025979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	19	67	---	---	---	---	capture	Missense_Mutation	SNP	43940278	43940278	RBPJL	20	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	13057	35
NFATC2	4773	broad.mit.edu	37	20	50051820	50051820	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50051820C>G	uc002xwd.2	-	8	2157	c.1937G>C	c.(1936-1938)CGG>CCG	p.R646P	NFATC2_uc002xwc.2_Missense_Mutation_p.R646P|NFATC2_uc010zyv.1_Missense_Mutation_p.R427P|NFATC2_uc010zyw.1_Missense_Mutation_p.R427P|NFATC2_uc010zyx.1_Missense_Mutation_p.R626P|NFATC2_uc010zyy.1_Missense_Mutation_p.R427P|NFATC2_uc010zyz.1_Missense_Mutation_p.R427P|NFATC2_uc002xwe.2_Missense_Mutation_p.R626P	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	646					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					ATGCTTGTTCCGATATTCAGG	0.443													13	429	---	---	---	---	capture	Missense_Mutation	SNP	50051820	50051820	NFATC2	20	C	G	G	G	1	0	0	0	0	1	0	0	0	299	23	4	4	10269	35
KRTAP13-1	140258	broad.mit.edu	37	21	31768833	31768833	+	Silent	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31768833C>T	uc002yoa.2	+	1	442	c.429C>T	c.(427-429)GGC>GGT	p.G143G		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	143						intermediate filament				ovary(1)	1						TGGGCTATGGCGTTGGATTCT	0.542													23	43	---	---	---	---	capture	Silent	SNP	31768833	31768833	KRTAP13-1	21	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8442	35
SLC4A7	9497	broad.mit.edu	37	3	27418278	27418278	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:27418278C>T	uc003cdv.2	-	25	3693	c.3622G>A	c.(3622-3624)GTG>ATG	p.V1208M	SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_RNA|SLC4A7_uc003cdu.3_Missense_Mutation_p.V1125M|SLC4A7_uc011aww.1_Missense_Mutation_p.V1253M|SLC4A7_uc011awx.1_Missense_Mutation_p.V1240M|SLC4A7_uc011awy.1_Missense_Mutation_p.V1200M|SLC4A7_uc011awz.1_RNA|SLC4A7_uc011axa.1_Missense_Mutation_p.V1089M|SLC4A7_uc011axb.1_Missense_Mutation_p.V1204M|SLC4A7_uc010hfl.2_Missense_Mutation_p.V794M|SLC4A7_uc003cdw.2_Missense_Mutation_p.V1084M	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	1208	Cytoplasmic (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						TCAGCATCCACGTATTTCTTT	0.259													20	58	---	---	---	---	capture	Missense_Mutation	SNP	27418278	27418278	SLC4A7	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14550	35
PXK	54899	broad.mit.edu	37	3	58385105	58385105	+	Splice_Site	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58385105G>A	uc003djz.1	+	12	1280	c.1181_splice	c.e12+1	p.P394_splice	PXK_uc003djx.1_Splice_Site_p.P394_splice|PXK_uc003djy.1_Splice_Site_p.P377_splice|PXK_uc003dka.1_Splice_Site_p.P394_splice|PXK_uc003dkb.1_Splice_Site_p.P311_splice|PXK_uc003dkc.1_Splice_Site_p.P377_splice|PXK_uc011bfe.1_Splice_Site_p.P361_splice|PXK_uc010hnj.1_Splice_Site_p.P361_splice|PXK_uc003dkd.1_Splice_Site_p.P257_splice|PXK_uc010hnk.1_Splice_Site_p.P168_splice	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN	PX domain containing serine/threonine kinase						cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		TACAGATGCCGTAAGTCAATC	0.458													21	36	---	---	---	---	capture	Splice_Site	SNP	58385105	58385105	PXK	3	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	12744	35
GPR15	2838	broad.mit.edu	37	3	98251271	98251271	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98251271T>A	uc011bgy.1	+	1	394	c.394T>A	c.(394-396)TAC>AAC	p.Y132N		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	132	Helical; Name=3; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		TGTTGACCGCTACCTGGCCAT	0.537													8	93	---	---	---	---	capture	Missense_Mutation	SNP	98251271	98251271	GPR15	3	T	A	A	A	1	0	0	0	0	1	0	0	0	689	53	4	4	6589	35
COL6A6	131873	broad.mit.edu	37	3	130287203	130287203	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:130287203G>A	uc010htl.2	+	5	2187	c.2156G>A	c.(2155-2157)CGG>CAG	p.R719Q		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	719	Nonhelical region.|VWFA 4.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						AAGGGCGCCCGGCCCAACATC	0.502													61	110	---	---	---	---	capture	Missense_Mutation	SNP	130287203	130287203	COL6A6	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3668	35
HLTF	6596	broad.mit.edu	37	3	148802611	148802611	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148802611G>C	uc003ewq.1	-	2	304	c.86C>G	c.(85-87)TCA>TGA	p.S29*	HLTF_uc003ewr.1_Nonsense_Mutation_p.S29*|HLTF_uc003ews.1_Nonsense_Mutation_p.S29*|HLTF_uc010hve.1_Nonsense_Mutation_p.S29*	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	29					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AGTTGGATATGAGAGGCGTGG	0.358													32	74	---	---	---	---	capture	Nonsense_Mutation	SNP	148802611	148802611	HLTF	3	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	7140	35
PIK3CA	5290	broad.mit.edu	37	3	178952072	178952072	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178952072A>G	uc003fjk.2	+	21	3284	c.3127A>G	c.(3127-3129)ATG>GTG	p.M1043V		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1043	PI3K/PI4K.		M -> I (in cancer; shows an increase in lipid kinase activity).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.M1043I(31)|p.M1043V(15)|p.M1043T(3)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CATGAAACAAATGAATGATGC	0.368		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			40	73	---	---	---	---	capture	Missense_Mutation	SNP	178952072	178952072	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11816	35
RNF168	165918	broad.mit.edu	37	3	196199643	196199643	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196199643C>T	uc003fwq.2	-	6	1301	c.763G>A	c.(763-765)GAC>AAC	p.D255N	RNF168_uc010iah.2_Missense_Mutation_p.D88N|uc010iag.1_5'Flank	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	ring finger protein 168	255					double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		CTGTCAATGTCCTGTAGAAAA	0.403													26	52	---	---	---	---	capture	Missense_Mutation	SNP	196199643	196199643	RNF168	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	13351	35
RBM47	54502	broad.mit.edu	37	4	40440631	40440631	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440631C>T	uc003gvc.2	-	4	990	c.280G>A	c.(280-282)GTG>ATG	p.V94M	RBM47_uc003gvd.2_Missense_Mutation_p.V94M|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.V56M|RBM47_uc003gvg.1_Missense_Mutation_p.V94M	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	94	RRM 1.					nucleus	nucleotide binding|RNA binding			breast(3)	3						ATGCGGCCCACGGCCTCGAAC	0.672													39	71	---	---	---	---	capture	Missense_Mutation	SNP	40440631	40440631	RBM47	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13036	35
TRIML2	205860	broad.mit.edu	37	4	189012897	189012897	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189012897C>A	uc003izl.2	-	7	830	c.794G>T	c.(793-795)AGG>ATG	p.R265M	TRIML2_uc003izj.1_Missense_Mutation_p.R93M|TRIML2_uc003izk.1_Missense_Mutation_p.R73M|TRIML2_uc011cle.1_Missense_Mutation_p.R340M	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	265	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		CACTTGCCACCTGGTTGCCTT	0.602													118	249	---	---	---	---	capture	Missense_Mutation	SNP	189012897	189012897	TRIML2	4	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	16434	35
DNAH5	1767	broad.mit.edu	37	5	13727679	13727679	+	Silent	SNP	A	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13727679A>G	uc003jfd.2	-	70	12012	c.11970T>C	c.(11968-11970)TCT>TCC	p.S3990S	DNAH5_uc003jfc.2_Silent_p.S158S	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3990					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGCAGTCAAGAGATTTATCAT	0.388									Kartagener_syndrome				31	85	---	---	---	---	capture	Silent	SNP	13727679	13727679	DNAH5	5	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	4561	35
DNAH5	1767	broad.mit.edu	37	5	13769686	13769686	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13769686T>A	uc003jfd.2	-	57	9686	c.9644A>T	c.(9643-9645)GAG>GTG	p.E3215V	DNAH5_uc003jfc.2_5'Flank	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3215	Stalk (By similarity).|Potential.				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TGCAACAGACTCTGAAGCTTC	0.433									Kartagener_syndrome				28	276	---	---	---	---	capture	Missense_Mutation	SNP	13769686	13769686	DNAH5	5	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	4561	35
FST	10468	broad.mit.edu	37	5	52780105	52780105	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:52780105T>C	uc003jpd.2	+	4	730	c.703T>C	c.(703-705)TAT>CAT	p.Y235H	FST_uc003jpc.2_Missense_Mutation_p.Y235H	NM_013409	NP_037541	P19883	FST_HUMAN	follistatin isoform FST344 precursor	235	Kazal-like 2.				hemopoietic progenitor cell differentiation|negative regulation of activin receptor signaling pathway|negative regulation of follicle-stimulating hormone secretion|negative regulation of transcription from RNA polymerase II promoter|positive regulation of hair follicle development	extracellular region	activin binding|protein binding|signal transducer activity				0		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				TGGATTAGCCTATGAGGGAAA	0.438													6	86	---	---	---	---	capture	Missense_Mutation	SNP	52780105	52780105	FST	5	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	6018	35
CAMK2A	815	broad.mit.edu	37	5	149607807	149607807	+	Silent	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149607807G>A	uc003lru.2	-	16	1367	c.1152C>T	c.(1150-1152)GCC>GCT	p.A384A	CAMK2A_uc003lrs.2_Silent_p.A95A|CAMK2A_uc003lrt.2_Silent_p.A395A	NM_171825	NP_741960	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II	384					interferon-gamma-mediated signaling pathway|positive regulation of NF-kappaB transcription factor activity|synaptic transmission	cell junction|cytosol|endocytic vesicle membrane|nucleoplasm|presynaptic membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGTTCCCCAGGGCCTCAGGTT	0.562													36	53	---	---	---	---	capture	Silent	SNP	149607807	149607807	CAMK2A	5	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	2575	35
GALNT10	55568	broad.mit.edu	37	5	153760181	153760181	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:153760181G>T	uc003lvh.2	+	6	1060	c.928G>T	c.(928-930)GAC>TAC	p.D310Y	GALNT10_uc003lvg.1_Missense_Mutation_p.D310Y|GALNT10_uc010jic.2_RNA|GALNT10_uc010jid.2_Missense_Mutation_p.D151Y	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a	310	Lumenal (Potential).					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TGACCCCAGCGACCCATTTGA	0.562													17	60	---	---	---	---	capture	Missense_Mutation	SNP	153760181	153760181	GALNT10	5	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	6148	35
GPX5	2880	broad.mit.edu	37	6	28497370	28497370	+	Missense_Mutation	SNP	C	T	T	rs145161873	byFrequency	TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28497370C>T	uc003nll.2	+	2	232	c.230C>T	c.(229-231)GCG>GTG	p.A77V	GPX5_uc003nlm.2_Missense_Mutation_p.A77V|GPX5_uc003nln.2_RNA	NM_001509	NP_001500	O75715	GPX5_HUMAN	glutathione peroxidase 5 isoform 1 precursor	77					lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity			skin(1)	1					Glutathione(DB00143)	GGTCTGACAGCGCAATATCCT	0.378													38	95	---	---	---	---	capture	Missense_Mutation	SNP	28497370	28497370	GPX5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6676	35
MDC1	9656	broad.mit.edu	37	6	30675721	30675721	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30675721C>G	uc003nrg.3	-	8	3075	c.2635G>C	c.(2635-2637)GAA>CAA	p.E879Q	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Intron	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	879				Missing (in Ref. 2; CAH18685).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						CTTGCACTTTCCCCATTTTTG	0.423								Other_conserved_DNA_damage_response_genes					171	403	---	---	---	---	capture	Missense_Mutation	SNP	30675721	30675721	MDC1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9316	35
PKHD1	5314	broad.mit.edu	37	6	51799064	51799064	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51799064G>A	uc003pah.1	-	37	6241	c.5965C>T	c.(5965-5967)CTT>TTT	p.L1989F	PKHD1_uc010jzn.1_Missense_Mutation_p.L14F|PKHD1_uc003pai.2_Missense_Mutation_p.L1989F	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1989	Extracellular (Potential).|G8 1.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCAGAAACAAGGATGGCGTGT	0.542											OREG0017491	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	49	126	---	---	---	---	capture	Missense_Mutation	SNP	51799064	51799064	PKHD1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11874	35
SAMD3	154075	broad.mit.edu	37	6	130505305	130505305	+	Silent	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:130505305G>A	uc003qbv.2	-	8	923	c.597C>T	c.(595-597)GAC>GAT	p.D199D	SAMD3_uc003qbx.2_Silent_p.D199D|SAMD3_uc003qbw.2_Silent_p.D199D|SAMD3_uc010kfg.1_Silent_p.D199D|SAMD3_uc003qby.2_Silent_p.D199D|SAMD3_uc003qbz.1_Silent_p.D158D	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform	199										ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		CATTAACCACGTCATTGTACT	0.473													28	38	---	---	---	---	capture	Silent	SNP	130505305	130505305	SAMD3	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13712	35
TCF21	6943	broad.mit.edu	37	6	134210609	134210609	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:134210609T>C	uc003qei.3	+	1	350	c.74T>C	c.(73-75)ATG>ACG	p.M25T	uc003qeg.1_5'Flank|TCF21_uc003qej.2_Missense_Mutation_p.M25T	NM_003206	NP_003197	O43680	TCF21_HUMAN	transcription factor 21	25					branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity				0	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		GGGTTGAAAATGGATTCGAAC	0.542													49	61	---	---	---	---	capture	Missense_Mutation	SNP	134210609	134210609	TCF21	6	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	15576	35
TMEM184A	202915	broad.mit.edu	37	7	1588261	1588261	+	Silent	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1588261G>A	uc003skv.3	-	7	1025	c.708C>T	c.(706-708)TAC>TAT	p.Y236Y	TMEM184A_uc003skt.3_Silent_p.Y215Y|TMEM184A_uc003skw.3_Silent_p.Y41Y	NM_001097620	NP_001091089	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	236	Helical; (Potential).					integral to membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		GGAACAGGGCGTAGAGGGCGA	0.607													46	137	---	---	---	---	capture	Silent	SNP	1588261	1588261	TMEM184A	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15987	35
CCDC129	223075	broad.mit.edu	37	7	31692423	31692423	+	Missense_Mutation	SNP	G	T	T	rs140998733	byFrequency	TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31692423G>T	uc003tcj.1	+	14	4108	c.3115G>T	c.(3115-3117)GAT>TAT	p.D1039Y	CCDC129_uc011kad.1_Missense_Mutation_p.D1049Y|CCDC129_uc003tci.1_Missense_Mutation_p.D890Y|CCDC129_uc011kae.1_Intron|CCDC129_uc003tck.1_Missense_Mutation_p.D947Y	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	1039											0						TGGAGAAAAGGATGCAGATGT	0.438													41	178	---	---	---	---	capture	Missense_Mutation	SNP	31692423	31692423	CCDC129	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	2738	35
TRIM24	8805	broad.mit.edu	37	7	138235836	138235836	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138235836G>A	uc003vuc.2	+	8	1387	c.1172G>A	c.(1171-1173)CGT>CAT	p.R391H	TRIM24_uc003vub.2_Missense_Mutation_p.R391H	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	391					cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding	p.R391H(1)		central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						CACCTCCTTCGTGCAAGGTGT	0.398													59	151	---	---	---	---	capture	Missense_Mutation	SNP	138235836	138235836	TRIM24	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16381	35
TRPV6	55503	broad.mit.edu	37	7	142573221	142573221	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142573221C>A	uc003wbx.1	-	8	1338	c.1122G>T	c.(1120-1122)CAG>CAT	p.Q374H	TRPV6_uc003wbw.1_Missense_Mutation_p.Q160H|TRPV6_uc010lou.1_Missense_Mutation_p.Q245H	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	374	Extracellular (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					AGGGTGTCACCTGAAGTAGCT	0.577													35	95	---	---	---	---	capture	Missense_Mutation	SNP	142573221	142573221	TRPV6	7	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	16483	35
NOS3	4846	broad.mit.edu	37	7	150703990	150703990	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150703990C>T	uc003wif.2	+	16	2130	c.1834C>T	c.(1834-1836)CGC>TGC	p.R612C	NOS3_uc011kuy.1_Missense_Mutation_p.R406C	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	612	Flavodoxin-like.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	TTATAAGATCCGCTTCAACAG	0.607													19	147	---	---	---	---	capture	Missense_Mutation	SNP	150703990	150703990	NOS3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10451	35
MTMR9	66036	broad.mit.edu	37	8	11163732	11163732	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11163732A>C	uc003wtm.2	+	5	1023	c.625A>C	c.(625-627)ACA>CCA	p.T209P	MTMR9_uc010lrx.2_Missense_Mutation_p.T102P|MTMR9_uc011kxa.1_Missense_Mutation_p.T124P	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	209	Myotubularin phosphatase.					cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		ACTCACTGGTACAAACGGGAG	0.458													7	58	---	---	---	---	capture	Missense_Mutation	SNP	11163732	11163732	MTMR9	8	A	C	C	C	1	0	0	0	0	1	0	0	0	182	14	4	4	9860	35
MTMR9	66036	broad.mit.edu	37	8	11163737	11163737	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11163737C>G	uc003wtm.2	+	5	1028	c.630C>G	c.(628-630)AAC>AAG	p.N210K	MTMR9_uc010lrx.2_Missense_Mutation_p.N103K|MTMR9_uc011kxa.1_Missense_Mutation_p.N125K	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	210	Myotubularin phosphatase.					cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CTGGTACAAACGGGAGGAGGT	0.468													7	62	---	---	---	---	capture	Missense_Mutation	SNP	11163737	11163737	MTMR9	8	C	G	G	G	1	0	0	0	0	1	0	0	0	246	19	4	4	9860	35
PCMTD1	115294	broad.mit.edu	37	8	52773608	52773608	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52773608G>A	uc003xqx.3	-	2	445	c.104C>T	c.(103-105)GCG>GTG	p.A35V	PCMTD1_uc003xqw.3_Missense_Mutation_p.A35V|PCMTD1_uc011ldn.1_Intron|PCMTD1_uc010lya.2_Intron|PCMTD1_uc011ldo.1_Missense_Mutation_p.A35V	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	35						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				ACGATCAATCGCTCTGAAGGC	0.423													13	104	---	---	---	---	capture	Missense_Mutation	SNP	52773608	52773608	PCMTD1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11489	35
RIMS2	9699	broad.mit.edu	37	8	105001613	105001613	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105001613G>A	uc003yls.2	+	15	2583	c.2342G>A	c.(2341-2343)CGT>CAT	p.R781H	RIMS2_uc003ylp.2_Missense_Mutation_p.R1003H|RIMS2_uc003ylw.2_Missense_Mutation_p.R795H|RIMS2_uc003ylq.2_Missense_Mutation_p.R795H|RIMS2_uc003ylr.2_Missense_Mutation_p.R842H	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1065					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACAGACATCGTGTCATGGAT	0.388										HNSCC(12;0.0054)			31	128	---	---	---	---	capture	Missense_Mutation	SNP	105001613	105001613	RIMS2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13260	35
BAG1	573	broad.mit.edu	37	9	33258950	33258950	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33258950C>G	uc003zsj.2	-	4	834	c.745G>C	c.(745-747)GAG>CAG	p.E249Q	SUGT1P1_uc010mjq.1_Intron|BAG1_uc003zsi.2_Missense_Mutation_p.E111Q|BAG1_uc003zsk.2_Missense_Mutation_p.E75Q	NM_004323	NP_004314	Q99933	BAG1_HUMAN	BCL2-associated athanogene isoform 1L	249	Interaction with PPP1R15A.|BAG.				anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway|chaperone cofactor-dependent protein refolding	cytoplasm|intermediate filament cytoskeleton|nucleus	protein binding|receptor signaling protein activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			TTATTCAACTCTTCCAGCTGG	0.378													38	117	---	---	---	---	capture	Missense_Mutation	SNP	33258950	33258950	BAG1	9	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	1275	35
BAG1	573	broad.mit.edu	37	9	33258984	33258984	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33258984C>G	uc003zsj.2	-	4	800	c.711G>C	c.(709-711)GAG>GAC	p.E237D	SUGT1P1_uc010mjq.1_Intron|BAG1_uc003zsi.2_Missense_Mutation_p.E99D|BAG1_uc003zsk.2_Missense_Mutation_p.E63D	NM_004323	NP_004314	Q99933	BAG1_HUMAN	BCL2-associated athanogene isoform 1L	237	Interaction with PPP1R15A.				anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway|chaperone cofactor-dependent protein refolding	cytoplasm|intermediate filament cytoskeleton|nucleus	protein binding|receptor signaling protein activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			CCACAGACTTCTCCAAATGTT	0.368													37	122	---	---	---	---	capture	Missense_Mutation	SNP	33258984	33258984	BAG1	9	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	1275	35
BAG1	573	broad.mit.edu	37	9	33259020	33259020	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33259020C>A	uc003zsj.2	-	4	764	c.675G>T	c.(673-675)CAG>CAT	p.Q225H	SUGT1P1_uc010mjq.1_Intron|BAG1_uc003zsi.2_Missense_Mutation_p.Q87H|BAG1_uc003zsk.2_Missense_Mutation_p.Q51H	NM_004323	NP_004314	Q99933	BAG1_HUMAN	BCL2-associated athanogene isoform 1L	225	Interaction with PPP1R15A.				anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway|chaperone cofactor-dependent protein refolding	cytoplasm|intermediate filament cytoskeleton|nucleus	protein binding|receptor signaling protein activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			CAACCTCTTCCTGTGGACTGT	0.294													30	94	---	---	---	---	capture	Missense_Mutation	SNP	33259020	33259020	BAG1	9	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	1275	35
WNK2	65268	broad.mit.edu	37	9	96080326	96080326	+	Silent	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96080326C>T	uc011lud.1	+	29	6645	c.6645C>T	c.(6643-6645)CGC>CGT	p.R2215R	WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_3'UTR	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	Error:Variant_position_missing_in_Q9Y3S1_after_alignment					intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity	p.T2215fs*31(1)		lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						GTGGTCCACGCGCCGTCTCCA	0.582													33	75	---	---	---	---	capture	Silent	SNP	96080326	96080326	WNK2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	339	27	1	1	17259	35
PPP3R2	5535	broad.mit.edu	37	9	104356906	104356906	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:104356906C>T	uc004bbr.2	-	1	378	c.307G>A	c.(307-309)GAC>AAC	p.D103N	GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta	100	EF-hand 3.|3.						calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	TTATCCATGTCGTAAATGCTG	0.532													62	121	---	---	---	---	capture	Missense_Mutation	SNP	104356906	104356906	PPP3R2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12302	35
SOHLH1	402381	broad.mit.edu	37	9	138588634	138588634	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138588634G>A	uc004cgl.2	-	5	546	c.485C>T	c.(484-486)GCG>GTG	p.A162V	SOHLH1_uc010nbe.2_Missense_Mutation_p.A162V	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic	162					cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			breast(1)|central_nervous_system(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		TTCCAGAAACGCCTTCACATC	0.637													18	59	---	---	---	---	capture	Missense_Mutation	SNP	138588634	138588634	SOHLH1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14815	35
MAMDC4	158056	broad.mit.edu	37	9	139752001	139752001	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139752001G>A	uc004cjs.2	+	18	2339	c.2289G>A	c.(2287-2289)TGG>TGA	p.W763*	MAMDC4_uc011mej.1_Nonsense_Mutation_p.W100*	NM_206920	NP_996803	Q6UXC1	AEGP_HUMAN	apical early endosomal glycoprotein precursor	842	MAM 5.|Extracellular (Potential).				protein transport	integral to membrane				breast(4)|upper_aerodigestive_tract(2)|central_nervous_system(1)	7	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ATGCTGCCTGGGGCCCCCCAA	0.657													39	56	---	---	---	---	capture	Nonsense_Mutation	SNP	139752001	139752001	MAMDC4	9	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	9118	35
MTHFR	4524	broad.mit.edu	37	1	11850780	11850780	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11850780delA	uc001atc.1	-	12	2112	c.1928delT	c.(1927-1929)CTCfs	p.L643fs	MTHFR_uc001atb.1_Frame_Shift_Del_p.L666fs	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	643					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	GGGCCTGTTGAGAAGCTCCAA	0.582													36	38	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	11850780	11850780	MTHFR	1	A	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	9841	35
TTN	7273	broad.mit.edu	37	2	179542567	179542567	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179542567delC	uc010zfg.1	-	143	30564	c.30340delG	c.(30340-30342)GTTfs	p.V10114fs	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.V6775fs|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11041							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCAGGAACAATTTCTTCT	0.413													83	190	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	179542567	179542567	TTN	2	C	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	16617	35
CCDC108	255101	broad.mit.edu	37	2	219870881	219870883	+	In_Frame_Del	DEL	GGG	-	-			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219870881_219870883delGGG	uc002vjl.1	-	31	4866_4868	c.4782_4784delCCC	c.(4780-4785)ACCCCA>ACA	p.P1595del		NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	1595						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCCTCCTTTGGGGTCTGCAGTT	0.626													42	132	---	---	---	---	capture_indel	In_Frame_Del	DEL	219870881	219870883	CCDC108	2	GGG	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	2717	35
TNIP1	10318	broad.mit.edu	37	5	150422129	150422131	+	In_Frame_Del	DEL	AGG	-	-			TCGA-06-0171-01	TCGA-06-0171-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150422129_150422131delAGG	uc003ltf.2	-	11	1693_1695	c.1104_1106delCCT	c.(1102-1107)CTCCTG>CTG	p.368_369LL>L	TNIP1_uc010jhl.2_RNA|TNIP1_uc010jhm.2_In_Frame_Del_p.368_369LL>L|TNIP1_uc010jhn.2_In_Frame_Del_p.368_369LL>L|TNIP1_uc011dco.1_In_Frame_Del_p.368_369LL>L|TNIP1_uc003lth.2_RNA|TNIP1_uc003lti.2_In_Frame_Del_p.368_369LL>L|TNIP1_uc003ltg.2_In_Frame_Del_p.315_316LL>L|TNIP1_uc003ltj.2_In_Frame_Del_p.368_369LL>L|TNIP1_uc010jho.1_RNA|TNIP1_uc010jhq.1_In_Frame_Del_p.315_316LL>L|TNIP1_uc010jhp.1_In_Frame_Del_p.315_316LL>L|TNIP1_uc010jhr.1_In_Frame_Del_p.368_369LL>L|TNIP1_uc003ltk.2_In_Frame_Del_p.368_369LL>L	NM_006058	NP_006049	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	368_369	Potential.|Interacts with Nef.				defense response|glycoprotein biosynthetic process|negative regulation of viral genome replication|translation	cytoplasm|nucleus	protein binding			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGACTTGGCCAGGAGGAGCTTGC	0.542													32	119	---	---	---	---	capture_indel	In_Frame_Del	DEL	150422129	150422131	TNIP1	5	AGG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	16197	35
