Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TMCO4	255104	broad.mit.edu	37	1	20107156	20107156	+	Silent	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20107156C>T	uc001bcn.2	-	4	338	c.96G>A	c.(94-96)CGG>CGA	p.R32R	TMCO4_uc001bcm.2_Silent_p.R32R|TMCO4_uc001bco.1_Silent_p.R32R|TMCO4_uc001bcp.1_Silent_p.R32R|TMCO4_uc009vpn.1_Silent_p.R32R|TMCO4_uc001bcq.1_Silent_p.R32R	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	32						integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CAGTCAGCTCCCGGCCCGTGG	0.612													17	39	---	---	---	---	capture	Silent	SNP	20107156	20107156	TMCO4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	15883	36
ARID1A	8289	broad.mit.edu	37	1	27101098	27101098	+	Silent	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27101098C>T	uc001bmv.1	+	18	4753	c.4380C>T	c.(4378-4380)GGC>GGT	p.G1460G	ARID1A_uc001bmt.1_Silent_p.G1459G|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Silent_p.G1077G|ARID1A_uc001bmx.1_Silent_p.G306G|ARID1A_uc009vsm.1_Intron|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1460					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCCAGTTTGGCCGAGACCGTG	0.582			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								4	142	---	---	---	---	capture	Silent	SNP	27101098	27101098	ARID1A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	906	36
ISG20L2	81875	broad.mit.edu	37	1	156697400	156697400	+	Silent	SNP	G	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156697400G>C	uc001fps.1	-	1	306	c.45C>G	c.(43-45)CCC>CCG	p.P15P	ISG20L2_uc001fpt.1_Silent_p.P15P|C1orf66_uc001fpu.2_5'Flank|C1orf66_uc001fpv.2_5'Flank	NM_030980	NP_112242	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene	15					ribosome biogenesis	nucleolus	exonuclease activity|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATGCCTTTTTGGGAGGAGGTT	0.458													10	125	---	---	---	---	capture	Silent	SNP	156697400	156697400	ISG20L2	1	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	7778	36
NFASC	23114	broad.mit.edu	37	1	204943900	204943900	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204943900G>A	uc001hbj.2	+	14	1835	c.1507G>A	c.(1507-1509)GCC>ACC	p.A503T	NFASC_uc001hbh.2_Missense_Mutation_p.A503T|NFASC_uc010pqz.1_Missense_Mutation_p.A497T|NFASC_uc010pra.1_Missense_Mutation_p.A514T|NFASC_uc001hbi.2_Missense_Mutation_p.A514T|NFASC_uc010prb.1_Missense_Mutation_p.A514T|NFASC_uc010prc.1_Missense_Mutation_p.A70T|NFASC_uc001hbk.1_Missense_Mutation_p.A324T	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	503	Extracellular (Potential).|Ig-like C2-type 5.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CACCTGTGTCGCCACCAACAT	0.532													51	109	---	---	---	---	capture	Missense_Mutation	SNP	204943900	204943900	NFASC	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10266	36
OBSCN	84033	broad.mit.edu	37	1	228520994	228520994	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228520994C>T	uc009xez.1	+	58	15870	c.15826C>T	c.(15826-15828)CGC>TGC	p.R5276C	OBSCN_uc001hsn.2_Missense_Mutation_p.R5276C|OBSCN_uc001hsr.1_5'Flank	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5276	Ig-like 50.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCCTGGCACACGCCTGGCCAA	0.637													5	5	---	---	---	---	capture	Missense_Mutation	SNP	228520994	228520994	OBSCN	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10717	36
OR2W5	441932	broad.mit.edu	37	1	247654765	247654765	+	Silent	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247654765C>T	uc001icz.1	+	1	336	c.336C>T	c.(334-336)TGC>TGT	p.C112C		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCACCGAGTGCGTCCTCCTGG	0.602													50	86	---	---	---	---	capture	Silent	SNP	247654765	247654765	OR2W5	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	10938	36
ACTA2	59	broad.mit.edu	37	10	90699345	90699345	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:90699345C>T	uc001kfp.2	-	7	843	c.727G>A	c.(727-729)GAG>AAG	p.E243K	STAMBPL1_uc010qmx.1_Intron|ACTA2_uc010qmy.1_Missense_Mutation_p.E198K|ACTA2_uc001kfq.2_Missense_Mutation_p.E243K|uc001kfo.1_RNA	NM_001613	NP_001604	P62736	ACTA_HUMAN	alpha 2 actin	243					response to virus	cytosol	ATP binding				0		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		TCAGGCAACTCGTAACTCTTC	0.512													5	62	---	---	---	---	capture	Missense_Mutation	SNP	90699345	90699345	ACTA2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	192	36
OR51E2	81285	broad.mit.edu	37	11	4703067	4703067	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4703067C>G	uc001lzk.2	-	2	1119	c.875G>C	c.(874-876)GGT>GCT	p.G292A		NM_030774	NP_110401	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E,	292	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(3)|ovary(2)	5		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGTTTTGGCACCATAGATGAT	0.507													32	66	---	---	---	---	capture	Missense_Mutation	SNP	4703067	4703067	OR51E2	11	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	10999	36
OR5I1	10798	broad.mit.edu	37	11	55703533	55703533	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55703533A>T	uc010ris.1	-	1	344	c.344T>A	c.(343-345)TTC>TAC	p.F115Y		NM_006637	NP_006628	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GGCCAGGATGAAGGATTCTGT	0.433													16	39	---	---	---	---	capture	Missense_Mutation	SNP	55703533	55703533	OR5I1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	11068	36
AHNAK	79026	broad.mit.edu	37	11	62285595	62285595	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62285595C>T	uc001ntl.2	-	5	16594	c.16294G>A	c.(16294-16296)GAA>AAA	p.E5432K	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5432					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				CCCTTCAGTTCGCCAGAAACC	0.527													4	134	---	---	---	---	capture	Missense_Mutation	SNP	62285595	62285595	AHNAK	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	414	36
SLC22A9	114571	broad.mit.edu	37	11	63174115	63174115	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63174115G>A	uc001nww.2	+	7	1488	c.1220G>A	c.(1219-1221)CGA>CAA	p.R407Q	SLC22A9_uc001nwx.2_RNA	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	407	Cytoplasmic (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						ATGAACCGTCGAGCAAGCCAG	0.483													37	56	---	---	---	---	capture	Missense_Mutation	SNP	63174115	63174115	SLC22A9	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14353	36
KIAA1377	57562	broad.mit.edu	37	11	101815013	101815013	+	Missense_Mutation	SNP	G	A	A	rs145886481		TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:101815013G>A	uc001pgm.2	+	3	536	c.266G>A	c.(265-267)CGA>CAA	p.R89Q	KIAA1377_uc001pgn.2_Missense_Mutation_p.R45Q|KIAA1377_uc009yxa.1_5'UTR	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	89	Potential.						protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		GAGGAGAAACGAAAAGAACAG	0.308													18	29	---	---	---	---	capture	Missense_Mutation	SNP	101815013	101815013	KIAA1377	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8149	36
UBASH3B	84959	broad.mit.edu	37	11	122653798	122653798	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:122653798G>A	uc001pyi.3	+	5	999	c.639G>A	c.(637-639)GTG>GTA	p.V213V		NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,	213						cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		AGCTACATGTGACCCTGGCTT	0.473													150	204	---	---	---	---	capture	Silent	SNP	122653798	122653798	UBASH3B	11	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	16722	36
APLP2	334	broad.mit.edu	37	11	130005535	130005535	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130005535G>A	uc010sby.1	+	13	1919	c.1762G>A	c.(1762-1764)GTG>ATG	p.V588M	APLP2_uc001qfp.2_Missense_Mutation_p.V588M|APLP2_uc001qfq.2_Missense_Mutation_p.V532M|APLP2_uc010sbz.1_Missense_Mutation_p.V376M|APLP2_uc001qfr.2_Missense_Mutation_p.V354M|APLP2_uc001qfs.2_Missense_Mutation_p.V359M|APLP2_uc001qfv.2_Missense_Mutation_p.V479M	NM_001642	NP_001633	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	588	Extracellular (Potential).				G-protein coupled receptor protein signaling pathway	integral to membrane|nucleus|plasma membrane	DNA binding|identical protein binding|serine-type endopeptidase inhibitor activity			ovary(3)	3	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		GGACGTCCGGGTGAGCTCTGA	0.592													45	71	---	---	---	---	capture	Missense_Mutation	SNP	130005535	130005535	APLP2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	772	36
CAPRIN2	65981	broad.mit.edu	37	12	30888067	30888067	+	Missense_Mutation	SNP	C	T	T	rs139487645	byFrequency	TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:30888067C>T	uc001rji.1	-	4	1395	c.644G>A	c.(643-645)CGA>CAA	p.R215Q	CAPRIN2_uc001rjf.1_Missense_Mutation_p.R12Q|CAPRIN2_uc001rjg.1_5'UTR|CAPRIN2_uc001rjh.1_Missense_Mutation_p.R215Q|CAPRIN2_uc001rjj.1_5'UTR|CAPRIN2_uc001rjk.3_Missense_Mutation_p.R215Q|CAPRIN2_uc001rjl.3_Missense_Mutation_p.R215Q	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	215	Potential.				negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AAGTATAGTTCGAAGCTTTTT	0.413													120	211	---	---	---	---	capture	Missense_Mutation	SNP	30888067	30888067	CAPRIN2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2612	36
OR6C3	254786	broad.mit.edu	37	12	55725701	55725701	+	Missense_Mutation	SNP	G	A	A	rs139430640		TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55725701G>A	uc010spj.1	+	1	217	c.217G>A	c.(217-219)GTA>ATA	p.V73I		NM_054104	NP_473445	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C,	73	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ATTTACAACCGTATGCATCCC	0.428													4	136	---	---	---	---	capture	Missense_Mutation	SNP	55725701	55725701	OR6C3	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11096	36
PPFIA2	8499	broad.mit.edu	37	12	81747072	81747072	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:81747072C>A	uc001szo.1	-	17	1981	c.1820G>T	c.(1819-1821)GGA>GTA	p.G607V	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	533								p.G607G(1)		ovary(3)|lung(2)|pancreas(1)	6						GCTTAGTACTCCAATCTGTTG	0.368													38	61	---	---	---	---	capture	Missense_Mutation	SNP	81747072	81747072	PPFIA2	12	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	12211	36
ANO4	121601	broad.mit.edu	37	12	101520783	101520783	+	Missense_Mutation	SNP	C	T	T	rs139827573		TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101520783C>T	uc010svm.1	+	27	3375	c.2803C>T	c.(2803-2805)CGT>TGT	p.R935C	ANO4_uc001thw.2_Missense_Mutation_p.R900C|ANO4_uc001thx.2_Missense_Mutation_p.R935C|ANO4_uc001thy.2_Missense_Mutation_p.R455C	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	935	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						AGAACTGGAACGTCTCCAGAA	0.483										HNSCC(74;0.22)			32	53	---	---	---	---	capture	Missense_Mutation	SNP	101520783	101520783	ANO4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	693	36
TMEM132D	121256	broad.mit.edu	37	12	130184923	130184923	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130184923G>C	uc009zyl.1	-	2	728	c.400C>G	c.(400-402)CTG>GTG	p.L134V		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	134	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTGTCCCGCAGGATGTGGGCT	0.537													22	40	---	---	---	---	capture	Missense_Mutation	SNP	130184923	130184923	TMEM132D	12	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	15931	36
FLT1	2321	broad.mit.edu	37	13	28931760	28931760	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28931760C>A	uc001usb.3	-	15	2464	c.2179G>T	c.(2179-2181)GGT>TGT	p.G727C		NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	727	Ig-like C2-type 7.|Extracellular (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	p.G727C(1)		lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	TGATAGACACCTTCATCCTCT	0.448													66	102	---	---	---	---	capture	Missense_Mutation	SNP	28931760	28931760	FLT1	13	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	5885	36
ERCC5	2073	broad.mit.edu	37	13	103491945	103491945	+	Silent	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:103491945C>T	uc001vpu.1	+	9	1364	c.1242C>T	c.(1240-1242)ATC>ATT	p.I414I	BIVM_uc001vps.2_Silent_p.I414I|BIVM_uc010agc.2_Silent_p.I192I|BIVM_uc001vpv.2_Silent_p.I185I	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	Error:Variant_position_missing_in_P28715_after_alignment					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TGCATTGCATCATAGCATTCC	0.398			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				69	109	---	---	---	---	capture	Silent	SNP	103491945	103491945	ERCC5	13	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	5171	36
ANKRD10	55608	broad.mit.edu	37	13	111532388	111532388	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111532388G>A	uc001vrn.2	-	6	994	c.859C>T	c.(859-861)CCC>TCC	p.P287S	ANKRD10_uc001vrm.2_Missense_Mutation_p.P24S|ANKRD10_uc001vrl.2_RNA	NM_017664	NP_060134	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	287										central_nervous_system(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			GTCGTGGAGGGGAAGTCCAAA	0.473													27	61	---	---	---	---	capture	Missense_Mutation	SNP	111532388	111532388	ANKRD10	13	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	635	36
TGM5	9333	broad.mit.edu	37	15	43552685	43552685	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43552685G>A	uc001zrd.1	-	2	111	c.103C>T	c.(103-105)CGG>TGG	p.R35W	TGM5_uc001zre.1_Missense_Mutation_p.R35W	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	35					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GCCTGGCCCCGGCGAACAAGC	0.572													73	114	---	---	---	---	capture	Missense_Mutation	SNP	43552685	43552685	TGM5	15	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	15718	36
PML	5371	broad.mit.edu	37	15	74315385	74315385	+	Silent	SNP	C	T	T	rs112627818		TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74315385C>T	uc002awv.2	+	3	959	c.819C>T	c.(817-819)GCC>GCT	p.A273A	PML_uc002awm.2_Silent_p.A273A|PML_uc002awl.2_Silent_p.A273A|PML_uc002awj.1_Silent_p.A273A|PML_uc002awk.2_Silent_p.A273A|PML_uc002awn.2_Silent_p.A273A|PML_uc002awo.2_Silent_p.A273A|PML_uc002awp.2_Silent_p.A273A|PML_uc002awq.2_Silent_p.A273A|PML_uc002awr.2_Silent_p.A273A|PML_uc002aws.2_Silent_p.A273A|PML_uc002awt.2_Silent_p.A273A|PML_uc002awu.2_Silent_p.A273A|PML_uc010ule.1_Intron|PML_uc002aww.1_Silent_p.A188A|PML_uc002awx.2_Silent_p.A31A|PML_uc002awy.2_5'Flank	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	273					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding	p.A273A(1)		central_nervous_system(2)|kidney(2)|breast(1)	5						GCGCGCGTGCCGAGACCGAGG	0.716			T	RARA|PAX5	APL|ALL								10	9	---	---	---	---	capture	Silent	SNP	74315385	74315385	PML	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12038	36
ZNF597	146434	broad.mit.edu	37	16	3490932	3490932	+	Missense_Mutation	SNP	C	A	A	rs139189056	byFrequency	TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3490932C>A	uc002cvd.2	-	3	219	c.35G>T	c.(34-36)GGA>GTA	p.G12V	NAT15_uc002cvh.3_5'Flank|NAT15_uc010uxb.1_5'Flank	NM_152457	NP_689670	Q96LX8	ZN597_HUMAN	zinc finger protein 597	12					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGTATTGGTCCCTGAAACAC	0.507													37	50	---	---	---	---	capture	Missense_Mutation	SNP	3490932	3490932	ZNF597	16	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	17905	36
A2BP1	54715	broad.mit.edu	37	16	7568246	7568246	+	Missense_Mutation	SNP	C	T	T	rs146499343		TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:7568246C>T	uc002cys.2	+	5	1113	c.125C>T	c.(124-126)ACG>ATG	p.T42M	A2BP1_uc010buf.1_Missense_Mutation_p.T42M|A2BP1_uc002cyr.1_Missense_Mutation_p.T42M|A2BP1_uc002cyt.2_Missense_Mutation_p.T42M|A2BP1_uc010uxz.1_Missense_Mutation_p.T85M|A2BP1_uc010uya.1_Missense_Mutation_p.T78M|A2BP1_uc002cyv.1_Missense_Mutation_p.T42M|A2BP1_uc010uyb.1_Missense_Mutation_p.T42M|A2BP1_uc002cyw.2_Missense_Mutation_p.T62M|A2BP1_uc002cyy.2_Missense_Mutation_p.T62M|A2BP1_uc002cyx.2_Missense_Mutation_p.T62M|A2BP1_uc010uyc.1_Missense_Mutation_p.T62M	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	42					mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		GCGGAATACACGGCCCCTCAT	0.637													5	222	---	---	---	---	capture	Missense_Mutation	SNP	7568246	7568246	A2BP1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3	36
ACSM1	116285	broad.mit.edu	37	16	20702408	20702408	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20702408A>G	uc002dhm.1	-	1	171	c.103T>C	c.(103-105)TTT>CTT	p.F35L	ACSM1_uc002dhn.1_RNA|ACSM1_uc010bwg.1_Missense_Mutation_p.F35L	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	35					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						GGGGCTCCAAATTCTGATAAA	0.498													5	256	---	---	---	---	capture	Missense_Mutation	SNP	20702408	20702408	ACSM1	16	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	182	36
VWA3A	146177	broad.mit.edu	37	16	22142922	22142922	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:22142922C>T	uc010vbq.1	+	19	1840	c.1744C>T	c.(1744-1746)CGG>TGG	p.R582W	VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Missense_Mutation_p.R590W	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	582	VWFA 1.					extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		CCTGAACCTGCGGTGTCGGGG	0.577													10	17	---	---	---	---	capture	Missense_Mutation	SNP	22142922	22142922	VWA3A	16	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17122	36
CD19	930	broad.mit.edu	37	16	28948983	28948983	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28948983C>T	uc002drs.2	+	11	1473	c.1411C>T	c.(1411-1413)CCG>TCG	p.P471S	uc010vct.1_Intron|CD19_uc010byo.1_Missense_Mutation_p.P471S	NM_001770	NP_001761	P15391	CD19_HUMAN	CD19 antigen precursor	471	Cytoplasmic (Potential).				cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity			ovary(2)|central_nervous_system(1)	3						GCTGACCCAGCCGGTCGCCAG	0.577													4	105	---	---	---	---	capture	Missense_Mutation	SNP	28948983	28948983	CD19	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2944	36
MYBBP1A	10514	broad.mit.edu	37	17	4455265	4455265	+	Silent	SNP	C	T	T	rs149464957		TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4455265C>T	uc002fyb.3	-	8	995	c.933G>A	c.(931-933)GCG>GCA	p.A311A	MYBBP1A_uc002fxz.3_Silent_p.A311A	NM_014520	NP_055335	Q9BQG0	MBB1A_HUMAN	MYB binding protein 1a isoform 2	311	Interaction with MYB (By similarity).				nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2						GGGGCAGGGCCGCGCCCAGCA	0.632													73	63	---	---	---	---	capture	Silent	SNP	4455265	4455265	MYBBP1A	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9918	36
DVL2	1856	broad.mit.edu	37	17	7132476	7132476	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7132476T>C	uc002gez.1	-	8	1217	c.935A>G	c.(934-936)GAG>GGG	p.E312G	DVL2_uc010vtr.1_Missense_Mutation_p.E306G|DVL2_uc010vts.1_3'UTR	NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	312	PDZ.				canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity			lung(1)|kidney(1)	2						GTCCCCTGGCTCAATGCGCCC	0.637													4	92	---	---	---	---	capture	Missense_Mutation	SNP	7132476	7132476	DVL2	17	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	4791	36
DNAH2	146754	broad.mit.edu	37	17	7674216	7674216	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7674216A>T	uc002giu.1	+	26	4341	c.4327A>T	c.(4327-4329)ATT>TTT	p.I1443F		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1443	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TATTGAGATGATTCTCACAGT	0.493													11	180	---	---	---	---	capture	Missense_Mutation	SNP	7674216	7674216	DNAH2	17	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	4559	36
DNAH9	1770	broad.mit.edu	37	17	11523026	11523026	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11523026G>T	uc002gne.2	+	6	1346	c.1278G>T	c.(1276-1278)AAG>AAT	p.K426N		NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	426	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGGAAGTCAAGGAATGGGATT	0.502													39	133	---	---	---	---	capture	Missense_Mutation	SNP	11523026	11523026	DNAH9	17	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	4564	36
FOXN1	8456	broad.mit.edu	37	17	26861357	26861357	+	Silent	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26861357C>T	uc010crm.2	+	7	1134	c.936C>T	c.(934-936)CCC>CCT	p.P312P	FOXN1_uc002hbj.2_Silent_p.P312P	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	312	Fork-head.				defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					AGACAGCACCCGATGGCTGGA	0.552													31	105	---	---	---	---	capture	Silent	SNP	26861357	26861357	FOXN1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5963	36
SLFN13	146857	broad.mit.edu	37	17	33768202	33768202	+	Silent	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33768202C>T	uc002hjk.1	-	4	2436	c.2106G>A	c.(2104-2106)CTG>CTA	p.L702L	SLFN13_uc010wch.1_Silent_p.L702L|SLFN13_uc002hjl.2_Silent_p.L702L|SLFN13_uc010ctt.2_Silent_p.L384L|SLFN13_uc002hjm.2_Silent_p.L371L	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	702						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GAAAGTAGTCCAGAAAGATCC	0.483													178	96	---	---	---	---	capture	Silent	SNP	33768202	33768202	SLFN13	17	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	14628	36
MYOM1	8736	broad.mit.edu	37	18	3067533	3067533	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:3067533G>A	uc002klp.2	-	38	5119	c.4785C>T	c.(4783-4785)AAC>AAT	p.N1595N	MYOM1_uc002klq.2_Silent_p.N1499N	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	1595	Ig-like C2-type 5.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CTCCCCACACGTTGCAAGTGA	0.537													22	38	---	---	---	---	capture	Silent	SNP	3067533	3067533	MYOM1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10001	36
ROCK1	6093	broad.mit.edu	37	18	18533573	18533573	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:18533573G>A	uc002kte.2	-	32	4968	c.4027C>T	c.(4027-4029)CGG>TGG	p.R1343W		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1343	Auto-inhibitory.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					ACCACTTTCCGGAAAGACTGA	0.358													8	212	---	---	---	---	capture	Missense_Mutation	SNP	18533573	18533573	ROCK1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	13409	36
DSC3	1825	broad.mit.edu	37	18	28598687	28598687	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28598687C>A	uc002kwj.3	-	8	1177	c.1022G>T	c.(1021-1023)TGT>TTT	p.C341F	DSC3_uc002kwi.3_Missense_Mutation_p.C341F	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	341	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TGTTATGATACAAGTTGATGT	0.338													58	81	---	---	---	---	capture	Missense_Mutation	SNP	28598687	28598687	DSC3	18	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	4722	36
KIAA1632	57724	broad.mit.edu	37	18	43493732	43493732	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43493732C>T	uc002lbm.2	-	21	3855	c.3755G>A	c.(3754-3756)CGG>CAG	p.R1252Q	KIAA1632_uc002lbo.1_Missense_Mutation_p.R1252Q|KIAA1632_uc010xcq.1_5'UTR|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_RNA|KIAA1632_uc002lbn.2_Missense_Mutation_p.R127Q	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	1252					autophagy						0						AATAACTCTCCGGAGCTGGGA	0.488													5	120	---	---	---	---	capture	Missense_Mutation	SNP	43493732	43493732	KIAA1632	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8171	36
NETO1	81832	broad.mit.edu	37	18	70417298	70417298	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:70417298G>A	uc002lkw.2	-	9	1824	c.1540C>T	c.(1540-1542)CGG>TGG	p.R514W	NETO1_uc002lkx.1_Missense_Mutation_p.R513W|NETO1_uc002lky.1_Missense_Mutation_p.R514W	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3	514	Cytoplasmic (Potential).				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GATACTGACCGCTGGACGGCT	0.433													35	42	---	---	---	---	capture	Missense_Mutation	SNP	70417298	70417298	NETO1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	10246	36
CHAF1A	10036	broad.mit.edu	37	19	4433232	4433232	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4433232C>T	uc002mal.2	+	13	2469	c.2369C>T	c.(2368-2370)GCC>GTC	p.A790V		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	790	Binds to p60.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCGAGGATGCCGCCATCCCC	0.652								Chromatin_Structure					4	124	---	---	---	---	capture	Missense_Mutation	SNP	4433232	4433232	CHAF1A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3277	36
MUC16	94025	broad.mit.edu	37	19	9069201	9069201	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9069201C>T	uc002mkp.2	-	3	18449	c.18245G>A	c.(18244-18246)AGC>AAC	p.S6082N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6084	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGGGCGGTGCTGTCCTCTTT	0.498													26	63	---	---	---	---	capture	Missense_Mutation	SNP	9069201	9069201	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	9883	36
CALR	811	broad.mit.edu	37	19	13051173	13051173	+	Silent	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13051173G>T	uc002mvu.2	+	5	689	c.609G>T	c.(607-609)CTG>CTT	p.L203L		NM_004343	NP_004334	P27797	CALR_HUMAN	calreticulin precursor	203	P-domain.|4 X approximate repeats.				cell cycle arrest|cellular senescence|glucocorticoid receptor signaling pathway|negative regulation of neuron differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of steroid hormone receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of translation|peptide antigen assembly with MHC class I protein complex|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of phagocytosis|post-translational protein modification|protein export from nucleus|protein maturation by protein folding|protein N-linked glycosylation via asparagine|protein stabilization|regulation of apoptosis|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|extracellular space|MHC class I peptide loading complex|nucleus|perinuclear region of cytoplasm|polysome|proteinaceous extracellular matrix	androgen receptor binding|calcium ion binding|chaperone binding|complement component C1q binding|DNA binding|integrin binding|mRNA binding|protein binding involved in protein folding|sugar binding|ubiquitin protein ligase binding|unfolded protein binding|zinc ion binding			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGGACTTCCTGCCACCCAAGA	0.532													47	86	---	---	---	---	capture	Silent	SNP	13051173	13051173	CALR	19	G	T	T	T	1	0	0	0	0	0	0	0	1	587	46	4	4	2568	36
CACNA1A	773	broad.mit.edu	37	19	13340971	13340971	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13340971C>T	uc010dze.2	-	36	5692	c.5456G>A	c.(5455-5457)CGA>CAA	p.R1819Q	CACNA1A_uc010xnd.1_Missense_Mutation_p.R524Q|CACNA1A_uc002mwx.3_Missense_Mutation_p.R524Q|CACNA1A_uc010dzc.2_Missense_Mutation_p.R1344Q|CACNA1A_uc002mwy.3_Missense_Mutation_p.R1818Q|CACNA1A_uc002mwv.3_Missense_Mutation_p.R335Q	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	1819	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GGAGGAGTCTCGGGTGAGGTA	0.597													8	47	---	---	---	---	capture	Missense_Mutation	SNP	13340971	13340971	CACNA1A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2514	36
ZNF681	148213	broad.mit.edu	37	19	23927348	23927348	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:23927348T>C	uc002nrk.3	-	4	1146	c.1004A>G	c.(1003-1005)GAG>GGG	p.E335G	ZNF681_uc002nrl.3_Missense_Mutation_p.E266G|ZNF681_uc002nrj.3_Missense_Mutation_p.E266G	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	335					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GTAGGGTTTCTCTCCAGTATG	0.393													5	160	---	---	---	---	capture	Missense_Mutation	SNP	23927348	23927348	ZNF681	19	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17966	36
CAPNS1	826	broad.mit.edu	37	19	36633602	36633602	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36633602G>T	uc002odj.2	+	4	449	c.292G>T	c.(292-294)GTC>TTC	p.V98F	CAPNS1_uc002odi.1_Missense_Mutation_p.V98F|CAPNS1_uc002odk.2_Missense_Mutation_p.V98F|CAPNS1_uc002odl.2_Missense_Mutation_p.V98F	NM_001749	NP_001740	P04632	CPNS1_HUMAN	calpain, small subunit 1	98	EF-hand 1; atypical.				positive regulation of cell proliferation	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GAGTGAGGAGGTCCGGCAGTT	0.622													75	142	---	---	---	---	capture	Missense_Mutation	SNP	36633602	36633602	CAPNS1	19	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	2609	36
CEACAM4	1089	broad.mit.edu	37	19	42132051	42132051	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42132051G>A	uc002orh.1	-	2	459	c.348C>T	c.(346-348)GAC>GAT	p.D116D	CEACAM4_uc010xwd.1_Silent_p.D116D	NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion	116	Extracellular (Potential).|Ig-like V-type.					integral to plasma membrane|membrane fraction					0						AGGATCCTGCGTCCTCCAGGG	0.522													71	163	---	---	---	---	capture	Silent	SNP	42132051	42132051	CEACAM4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3163	36
ZNF229	7772	broad.mit.edu	37	19	44933285	44933285	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44933285G>A	uc002oze.1	-	6	2105	c.1671C>T	c.(1669-1671)TCC>TCT	p.S557S	ZNF229_uc010ejk.1_Silent_p.S211S|ZNF229_uc010ejl.1_Silent_p.S551S	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	557	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				TGTGGAGGTCGGAGCTCCGGC	0.542													30	59	---	---	---	---	capture	Silent	SNP	44933285	44933285	ZNF229	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17662	36
CEACAM20	125931	broad.mit.edu	37	19	45021184	45021184	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45021184C>T	uc010ejn.1	-	6	1148	c.1132G>A	c.(1132-1134)GAG>AAG	p.E378K	CEACAM20_uc010ejo.1_Missense_Mutation_p.E378K|CEACAM20_uc010ejp.1_Intron|CEACAM20_uc010ejq.1_Intron	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	378	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				GGCTTGGACTCGGCCCAACAC	0.582													11	17	---	---	---	---	capture	Missense_Mutation	SNP	45021184	45021184	CEACAM20	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3160	36
LIG1	3978	broad.mit.edu	37	19	48668866	48668866	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48668866G>A	uc002pia.1	-	2	78	c.-42C>T	c.(-44--40)GACGA>GATGA		LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Translation_Start_Site|LIG1_uc010xzg.1_Translation_Start_Site|LIG1_uc010xzh.1_RNA	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	ACTTTTCTTCGTCTGTCAGCT	0.463								NER					7	196	---	---	---	---	capture	Translation_Start_Site	SNP	48668866	48668866	LIG1	19	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	8701	36
LILRB5	10990	broad.mit.edu	37	19	54756388	54756388	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54756388G>T	uc002qex.2	-	10	1607	c.1496C>A	c.(1495-1497)GCT>GAT	p.A499D	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.A491D|LILRB5_uc002qey.2_Missense_Mutation_p.A500D|LILRB5_uc002qez.2_Missense_Mutation_p.A400D|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	499	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGCCCCGCAGCCCCTGCAGG	0.607													12	134	---	---	---	---	capture	Missense_Mutation	SNP	54756388	54756388	LILRB5	19	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	8714	36
LENG8	114823	broad.mit.edu	37	19	54967619	54967619	+	Silent	SNP	C	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54967619C>A	uc002qfv.1	+	9	1453	c.1309C>A	c.(1309-1311)CGA>AGA	p.R437R	LENG8_uc002qfw.2_Silent_p.R474R			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	437							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GGATCGGGGCCGAGGCAGGGC	0.682													15	17	---	---	---	---	capture	Silent	SNP	54967619	54967619	LENG8	19	C	A	A	A	1	0	0	0	0	0	0	0	1	295	23	4	4	8644	36
LILRB1	10859	broad.mit.edu	37	19	55146733	55146733	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55146733A>G	uc002qgj.2	+	13	1923	c.1583A>G	c.(1582-1584)CAG>CGG	p.Q528R	LILRB1_uc010erp.1_Missense_Mutation_p.Q143R|LILRB1_uc002qgl.2_Missense_Mutation_p.Q528R|LILRB1_uc002qgk.2_Missense_Mutation_p.Q529R|LILRB1_uc002qgm.2_Missense_Mutation_p.Q529R|LILRB1_uc010erq.2_Missense_Mutation_p.Q512R|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	528	Cytoplasmic (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		GCCGATGCCCAGGAAGAAAAC	0.612										HNSCC(37;0.09)			24	62	---	---	---	---	capture	Missense_Mutation	SNP	55146733	55146733	LILRB1	19	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	8710	36
GALP	85569	broad.mit.edu	37	19	56691958	56691958	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56691958C>T	uc002qmo.1	+	3	173	c.91C>T	c.(91-93)CGA>TGA	p.R31*	GALP_uc010eti.2_Intron	NM_033106	NP_149097	Q9UBC7	GALP_HUMAN	galanin-like peptide isoform 1 precursor	31					neuropeptide signaling pathway	extracellular region	hormone activity				0		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		TATCCAGGGACGAGGAGGCTG	0.602													10	82	---	---	---	---	capture	Nonsense_Mutation	SNP	56691958	56691958	GALP	19	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	6166	36
APOB	338	broad.mit.edu	37	2	21235218	21235218	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21235218C>T	uc002red.2	-	26	4650	c.4522G>A	c.(4522-4524)GAT>AAT	p.D1508N		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1508					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GTGTTAGGATCCCTCTGACAA	0.458													6	112	---	---	---	---	capture	Missense_Mutation	SNP	21235218	21235218	APOB	2	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	778	36
GPR113	165082	broad.mit.edu	37	2	26533656	26533656	+	Silent	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26533656G>T	uc002rhe.3	-	11	2940	c.2940C>A	c.(2938-2940)CCC>CCA	p.P980P	GPR113_uc010yky.1_Silent_p.P911P|GPR113_uc002rhb.1_Silent_p.P583P|GPR113_uc010eyk.1_Silent_p.P781P|GPR113_uc002rhc.1_Silent_p.P583P|GPR113_uc002rhd.1_RNA	NM_001145168	NP_001138640	Q8IZF5	GP113_HUMAN	G-protein coupled receptor 113 isoform 1	980	Helical; Name=6; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCAAAGATGGGTGTAAGAA	0.572													11	26	---	---	---	---	capture	Silent	SNP	26533656	26533656	GPR113	2	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	6564	36
NBEAL1	65065	broad.mit.edu	37	2	204002914	204002914	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:204002914T>C	uc002uzt.3	+	29	4841	c.4508T>C	c.(4507-4509)ATC>ACC	p.I1503T	NBEAL1_uc002uzs.3_Missense_Mutation_p.I213T	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	1503							binding			ovary(1)|skin(1)	2						GAATGGGCAATCTCAGAAAAC	0.373													5	79	---	---	---	---	capture	Missense_Mutation	SNP	204002914	204002914	NBEAL1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	10095	36
MARCH4	57574	broad.mit.edu	37	2	217234886	217234886	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:217234886C>T	uc002vgb.2	-	1	1865	c.98G>A	c.(97-99)CGC>CAC	p.R33H		NM_020814	NP_065865	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4	33						Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		ACCCTGGTGGCGCAACATCTG	0.632													5	11	---	---	---	---	capture	Missense_Mutation	SNP	217234886	217234886	MARCH4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9216	36
UGT1A8	54576	broad.mit.edu	37	2	234526363	234526363	+	Missense_Mutation	SNP	A	G	G	rs150485330		TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234526363A>G	uc002vup.2	+	1	73	c.10A>G	c.(10-12)ACA>GCA	p.T4A	UGT1A8_uc010zmv.1_Missense_Mutation_p.T4A	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN	UDP glycosyltransferase 1 family, polypeptide A8	4					drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)		CATGGCTCGCACAGGGTGGAC	0.562													3	41	---	---	---	---	capture	Missense_Mutation	SNP	234526363	234526363	UGT1A8	2	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	16833	36
SPP2	6694	broad.mit.edu	37	2	234959451	234959451	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234959451G>A	uc002vvk.1	+	1	106	c.21G>A	c.(19-21)AAG>AAA	p.K7K	SPP2_uc010fyl.1_5'UTR	NM_006944	NP_008875	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa precursor	7					bone remodeling|skeletal system development	extracellular region	endopeptidase inhibitor activity				0		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		GAATGGAGAAGATGACGATGA	0.423													4	219	---	---	---	---	capture	Silent	SNP	234959451	234959451	SPP2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	14979	36
PARD6B	84612	broad.mit.edu	37	20	49366649	49366649	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49366649C>T	uc002xvo.2	+	3	986	c.743C>T	c.(742-744)CCG>CTG	p.P248L		NM_032521	NP_115910	Q9BYG5	PAR6B_HUMAN	PAR-6 beta	248	PDZ.|Interaction with PARD3 and CDC42 (By similarity).				axonogenesis|cell cycle|cell division|establishment or maintenance of cell polarity|protein complex assembly|regulation of cell migration|tight junction assembly	cytosol|tight junction	protein binding			kidney(1)	1						ACAGTGAGACCGGCAAACCAG	0.443													62	181	---	---	---	---	capture	Missense_Mutation	SNP	49366649	49366649	PARD6B	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11350	36
RTEL1	51750	broad.mit.edu	37	20	62316891	62316891	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62316891G>A	uc002yfu.1	+	15	1550	c.1207G>A	c.(1207-1209)GAC>AAC	p.D403N	RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Missense_Mutation_p.D403N|RTEL1_uc011abd.1_Missense_Mutation_p.D427N|RTEL1_uc011abe.1_Missense_Mutation_p.D180N|RTEL1_uc002yfw.2_RNA	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1	403					DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GTTCAGTGTGGACCCCTCCGA	0.627													8	28	---	---	---	---	capture	Missense_Mutation	SNP	62316891	62316891	RTEL1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	13612	36
TXNRD2	10587	broad.mit.edu	37	22	19870868	19870868	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19870868C>T	uc011ahc.1	-	12	1099	c.1066G>A	c.(1066-1068)GCC>ACC	p.A356T	TXNRD2_uc002zql.1_Missense_Mutation_p.A110T|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Missense_Mutation_p.A355T|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_5'Flank	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	356					cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					TCACCAATGGCGTAGATGTGG	0.647													58	63	---	---	---	---	capture	Missense_Mutation	SNP	19870868	19870868	TXNRD2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16690	36
GUCA1C	9626	broad.mit.edu	37	3	108627021	108627021	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108627021C>A	uc003dxj.2	-	4	546	c.478G>T	c.(478-480)GCA>TCA	p.A160S	GUCA1C_uc003dxk.2_Missense_Mutation_p.G173V	NM_005459	NP_005450	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	160	EF-hand 4.				signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						TGATCTTTTGCCATGCCATTG	0.398													30	44	---	---	---	---	capture	Missense_Mutation	SNP	108627021	108627021	GUCA1C	3	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	6819	36
ABHD10	55347	broad.mit.edu	37	3	111697949	111697949	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111697949C>T	uc003dyk.3	+	1	122	c.41C>T	c.(40-42)CCT>CTT	p.P14L	ABHD10_uc011bhq.1_5'UTR	NM_018394	NP_060864	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10 precursor	14						mitochondrion	serine-type peptidase activity				0						GCCTGGGTACCTTGTCGGAGC	0.682													18	23	---	---	---	---	capture	Missense_Mutation	SNP	111697949	111697949	ABHD10	3	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	74	36
AFAP1	60312	broad.mit.edu	37	4	7802222	7802222	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:7802222G>A	uc003gkg.1	-	10	1486	c.1213C>T	c.(1213-1215)CAT>TAT	p.H405Y	AFAP1_uc011bwk.1_Missense_Mutation_p.H405Y	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1	405	PH 2.					actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						GTCAGAGGATGTTTAGAATCC	0.547													4	72	---	---	---	---	capture	Missense_Mutation	SNP	7802222	7802222	AFAP1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	353	36
LRAT	9227	broad.mit.edu	37	4	155670163	155670163	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155670163C>T	uc003iom.1	+	2	895	c.568C>T	c.(568-570)CGT>TGT	p.R190C	LRAT_uc003ion.1_Missense_Mutation_p.R190C	NM_004744	NP_004735	O95237	LRAT_HUMAN	lecithin retinol acyltransferase	190	Cytoplasmic (By similarity).				response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity			central_nervous_system(1)	1	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	GATAATTATTCGTGATCAGAG	0.373													69	97	---	---	---	---	capture	Missense_Mutation	SNP	155670163	155670163	LRAT	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8846	36
ANP32C	23520	broad.mit.edu	37	4	165118645	165118645	+	Silent	SNP	T	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:165118645T>A	uc011cjk.1	-	1	219	c.219A>T	c.(217-219)TCA>TCT	p.S73S	MARCH1_uc003iqs.1_Intron	NM_012403	NP_036535	O43423	AN32C_HUMAN	acidic nuclear phosphoprotein 32C	73	LRR 2.										0	all_hematologic(180;0.203)	Prostate(90;0.0138)|Melanoma(52;0.18)|all_neural(102;0.223)		KIRC - Kidney renal clear cell carcinoma(143;0.242)		CCAGGCCCCCTGAGACTCTTA	0.403													95	152	---	---	---	---	capture	Silent	SNP	165118645	165118645	ANP32C	4	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	701	36
TRIML1	339976	broad.mit.edu	37	4	189068289	189068289	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189068289G>T	uc003izm.1	+	6	1285	c.1170G>T	c.(1168-1170)TGG>TGT	p.W390C	TRIML1_uc003izn.1_Missense_Mutation_p.W114C	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	390	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		ACAGCCTCTGGGTCTCGTCAC	0.488													85	114	---	---	---	---	capture	Missense_Mutation	SNP	189068289	189068289	TRIML1	4	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	16433	36
CDH9	1007	broad.mit.edu	37	5	26902711	26902711	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26902711T>A	uc003jgs.1	-	7	1296	c.1127A>T	c.(1126-1128)GAT>GTT	p.D376V		NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	376	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CTCATCTATATCTTCCACAGA	0.408													22	153	---	---	---	---	capture	Missense_Mutation	SNP	26902711	26902711	CDH9	5	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	3088	36
LHFPL2	10184	broad.mit.edu	37	5	77805969	77805969	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:77805969G>A	uc003kfo.2	-	4	744	c.68C>T	c.(67-69)GCC>GTC	p.A23V		NM_005779	NP_005770	Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	23	Helical; (Potential).					integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		AATGAGCTCGGCAAAAGCCAC	0.438													3	42	---	---	---	---	capture	Missense_Mutation	SNP	77805969	77805969	LHFPL2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8685	36
SRP19	6728	broad.mit.edu	37	5	112227939	112227939	+	Silent	SNP	T	C	C	rs712666	by1000genomes	TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:112227939T>C	uc011cvv.1	+	4	933	c.678T>C	c.(676-678)TCT>TCC	p.S226S	SRP19_uc011cvu.1_Silent_p.S211S|REEP5_uc011cvw.1_Intron|REEP5_uc003kqe.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron			P09132	SRP19_HUMAN	SubName: Full=Zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2;	Error:Variant_position_missing_in_P09132_after_alignment					response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|mitochondrion|nucleolus|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding				0		all_cancers(142;0.00328)|all_epithelial(76;6.39e-05)|Prostate(80;0.00174)|Colorectal(10;0.00372)|Ovarian(225;0.156)		Epithelial(69;1.7e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.17e-08)|all cancers(49;3.96e-07)|Colorectal(14;0.0056)|COAD - Colon adenocarcinoma(37;0.0104)		TCCCAACATCTAGTCCTACCC	0.453													3	182	---	---	---	---	capture	Silent	SNP	112227939	112227939	SRP19	5	T	C	C	C	1	0	0	0	0	0	0	0	1	677	53	3	3	15046	36
CCDC112	153733	broad.mit.edu	37	5	114607281	114607281	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:114607281C>T	uc003kqy.2	-	7	1225	c.712G>A	c.(712-714)GAA>AAA	p.E238K	CCDC112_uc003kqz.2_Missense_Mutation_p.E321K|CCDC112_uc003kra.2_Missense_Mutation_p.E321K	NM_152549	NP_689762	Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112 isoform 2	238	Potential.										0		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		TTGAAAATTTCCTCCCTTTTT	0.219													32	114	---	---	---	---	capture	Missense_Mutation	SNP	114607281	114607281	CCDC112	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2723	36
ODZ2	57451	broad.mit.edu	37	5	167674863	167674863	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167674863C>T	uc010jjd.2	+	27	6892	c.6892C>T	c.(6892-6894)CGG>TGG	p.R2298W	ODZ2_uc003lzr.3_Missense_Mutation_p.R2068W|ODZ2_uc003lzt.3_Missense_Mutation_p.R1671W|ODZ2_uc010jje.2_Missense_Mutation_p.R1562W	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TGGCGTAGGACGGCGGGCTTC	0.552													52	109	---	---	---	---	capture	Missense_Mutation	SNP	167674863	167674863	ODZ2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	10740	36
OR10C1	442194	broad.mit.edu	37	6	29408233	29408233	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29408233G>A	uc011dlp.1	+	1	441	c.441G>A	c.(439-441)GCG>GCA	p.A147A	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTGGGTCGGCGTGGGCCTGTG	0.622													64	93	---	---	---	---	capture	Silent	SNP	29408233	29408233	OR10C1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10802	36
GRM4	2914	broad.mit.edu	37	6	34101001	34101001	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34101001G>A	uc003oir.3	-	1	443	c.273C>T	c.(271-273)AAC>AAT	p.N91N	GRM4_uc011dsn.1_Silent_p.N91N|GRM4_uc010jvh.2_Silent_p.N91N|GRM4_uc010jvi.2_Translation_Start_Site|GRM4_uc010jvk.1_Silent_p.N10N	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	91	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	GGTCCGGGTCGTTGTTGATGC	0.622													22	40	---	---	---	---	capture	Silent	SNP	34101001	34101001	GRM4	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6732	36
DNAH8	1769	broad.mit.edu	37	6	38704936	38704936	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38704936A>G	uc003ooe.1	+	4	805	c.205A>G	c.(205-207)ACA>GCA	p.T69A		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TGTTCTTGCAACAAACAACTG	0.383													76	105	---	---	---	---	capture	Missense_Mutation	SNP	38704936	38704936	DNAH8	6	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	4563	36
AIM1	202	broad.mit.edu	37	6	106967934	106967934	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:106967934T>C	uc003prh.2	+	2	2114	c.1627T>C	c.(1627-1629)TCC>CCC	p.S543P		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	543							sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TGAGTGTCCATCCAGAGTCCT	0.527													40	50	---	---	---	---	capture	Missense_Mutation	SNP	106967934	106967934	AIM1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	430	36
C6orf170	221322	broad.mit.edu	37	6	121642861	121642861	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:121642861T>C	uc003pyo.1	-	2	303	c.235A>G	c.(235-237)ACA>GCA	p.T79A	C6orf170_uc003pyq.1_RNA	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	79					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		CGATCAGATGTGCATTTTTCC	0.368													99	171	---	---	---	---	capture	Missense_Mutation	SNP	121642861	121642861	C6orf170	6	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	2321	36
FNDC1	84624	broad.mit.edu	37	6	159653416	159653416	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159653416G>A	uc010kjv.2	+	11	2072	c.1872G>A	c.(1870-1872)GCG>GCA	p.A624A	FNDC1_uc010kjw.1_Silent_p.A509A	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	624						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CCCACCACGCGTCCACCCAGG	0.667													20	24	---	---	---	---	capture	Silent	SNP	159653416	159653416	FNDC1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5912	36
SLC22A2	6582	broad.mit.edu	37	6	160679423	160679423	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160679423G>A	uc003qtf.2	-	1	537	c.367C>T	c.(367-369)CGG>TGG	p.R123W	SLC22A2_uc003qte.1_Missense_Mutation_p.R123W|SLC22A2_uc003qth.1_Missense_Mutation_p.R123W	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	123	Extracellular (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		CAGCCGTCCCGGCAGGGGCCC	0.627													54	62	---	---	---	---	capture	Missense_Mutation	SNP	160679423	160679423	SLC22A2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	14343	36
HECW1	23072	broad.mit.edu	37	7	43519279	43519279	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43519279G>A	uc003tid.1	+	17	3775	c.3170G>A	c.(3169-3171)CGT>CAT	p.R1057H	HECW1_uc011kbi.1_Missense_Mutation_p.R1023H	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1057					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CAGAACGGTCGTCTTCCCAAT	0.542													117	248	---	---	---	---	capture	Missense_Mutation	SNP	43519279	43519279	HECW1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6968	36
BAZ1B	9031	broad.mit.edu	37	7	72892641	72892641	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72892641T>A	uc003tyc.2	-	7	1495	c.1150A>T	c.(1150-1152)ATT>TTT	p.I384F		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	384	Lys-rich.				ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTTTTAGGAATGTGAAAGTTA	0.433													50	114	---	---	---	---	capture	Missense_Mutation	SNP	72892641	72892641	BAZ1B	7	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	1319	36
PIK3CG	5294	broad.mit.edu	37	7	106524646	106524646	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106524646G>C	uc003vdv.3	+	9	2892	c.2807G>C	c.(2806-2808)TGT>TCT	p.C936S	PIK3CG_uc003vdu.2_Missense_Mutation_p.C936S|PIK3CG_uc003vdw.2_Missense_Mutation_p.C936S	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	936	PI3K/PI4K.				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding	p.C936S(1)		lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						GCAGGCTACTGTGTGGCAACC	0.358													78	282	---	---	---	---	capture	Missense_Mutation	SNP	106524646	106524646	PIK3CG	7	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	11819	36
IMPDH1	3614	broad.mit.edu	37	7	128038490	128038490	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128038490G>A	uc011kol.1	-	7	903	c.797C>T	c.(796-798)GCG>GTG	p.A266V	IMPDH1_uc011kom.1_Missense_Mutation_p.A261V|IMPDH1_uc003vmt.2_Missense_Mutation_p.A241V|IMPDH1_uc003vmu.2_Missense_Mutation_p.A351V|IMPDH1_uc003vmw.2_Missense_Mutation_p.A341V|IMPDH1_uc011kon.1_Missense_Mutation_p.A318V|IMPDH1_uc003vmv.2_Missense_Mutation_p.A315V|IMPDH1_uc003vmx.2_Missense_Mutation_p.A274V|IMPDH1_uc003vmy.2_Missense_Mutation_p.A282V	NM_001142573	NP_001136045	P20839	IMDH1_HUMAN	inosine monophosphate dehydrogenase 1 isoform e	266	NAD (By similarity).				GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding			skin(2)|lung(1)|central_nervous_system(1)	4					Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)	GTCGACGCCCGCCTGGGTGAG	0.602											OREG0018292	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	59	98	---	---	---	---	capture	Missense_Mutation	SNP	128038490	128038490	IMPDH1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7649	36
CLCN1	1180	broad.mit.edu	37	7	143029823	143029823	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143029823C>T	uc003wcr.1	+	12	1345	c.1258C>T	c.(1258-1260)CCC>TCC	p.P420S	CLCN1_uc011ktc.1_Intron	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	420					muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					CCAGTTGATGCCCCGCGAAGC	0.522													5	437	---	---	---	---	capture	Missense_Mutation	SNP	143029823	143029823	CLCN1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3427	36
OR2F2	135948	broad.mit.edu	37	7	143632969	143632969	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143632969T>A	uc011ktv.1	+	1	644	c.644T>A	c.(643-645)CTG>CAG	p.L215Q		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					TGCCTGGTTCTGTTGTCCTAC	0.517													33	116	---	---	---	---	capture	Missense_Mutation	SNP	143632969	143632969	OR2F2	7	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	10901	36
CNTNAP2	26047	broad.mit.edu	37	7	147914464	147914464	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147914464G>T	uc003weu.1	+	19	3611	c.3095G>T	c.(3094-3096)AGA>ATA	p.R1032I		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	1032	Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCCAGCAGCAGAGTAGACAAC	0.532										HNSCC(39;0.1)			16	251	---	---	---	---	capture	Missense_Mutation	SNP	147914464	147914464	CNTNAP2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	3612	36
UBE3C	9690	broad.mit.edu	37	7	156976584	156976584	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156976584A>T	uc010lqs.2	+	9	1316	c.1004A>T	c.(1003-1005)GAG>GTG	p.E335V	UBE3C_uc003wnf.2_Missense_Mutation_p.E292V|UBE3C_uc003wng.2_Missense_Mutation_p.E335V	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	335					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GCCCTCTCTGAGGAAGGGCTG	0.473													50	325	---	---	---	---	capture	Missense_Mutation	SNP	156976584	156976584	UBE3C	7	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	16763	36
SCARA5	286133	broad.mit.edu	37	8	27737142	27737142	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27737142C>T	uc003xgj.2	-	8	1735	c.1295G>A	c.(1294-1296)CGC>CAC	p.R432H	SCARA5_uc010luz.2_Missense_Mutation_p.R207H	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	432	SRCR.|Extracellular (Potential).				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GCCGAGCATGCGGCACACCAC	0.642													4	164	---	---	---	---	capture	Missense_Mutation	SNP	27737142	27737142	SCARA5	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13772	36
NRG1	3084	broad.mit.edu	37	8	31497984	31497984	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:31497984G>C	uc003xip.2	+	1	717	c.484G>C	c.(484-486)GTG>CTG	p.V162L		NM_013962	NP_039256	Q02297	NRG1_HUMAN	neuregulin 1 isoform GGF2	Error:Variant_position_missing_in_Q02297_after_alignment					activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GCCCTATCTGGTGAAGGTGCA	0.741													3	7	---	---	---	---	capture	Missense_Mutation	SNP	31497984	31497984	NRG1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	10554	36
SULF1	23213	broad.mit.edu	37	8	70515453	70515453	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70515453A>T	uc010lza.1	+	11	1805	c.1088A>T	c.(1087-1089)GAC>GTC	p.D363V	SULF1_uc003xyd.2_Missense_Mutation_p.D363V|SULF1_uc003xye.2_Missense_Mutation_p.D363V|SULF1_uc003xyf.2_Missense_Mutation_p.D363V|SULF1_uc003xyg.2_Missense_Mutation_p.D363V|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	363					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CTCAACATTGACTTGGCCCCC	0.537													107	148	---	---	---	---	capture	Missense_Mutation	SNP	70515453	70515453	SULF1	8	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	15260	36
RIMS2	9699	broad.mit.edu	37	8	105001535	105001535	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105001535G>A	uc003yls.2	+	15	2505	c.2264G>A	c.(2263-2265)CGG>CAG	p.R755Q	RIMS2_uc003ylp.2_Missense_Mutation_p.R977Q|RIMS2_uc003ylw.2_Missense_Mutation_p.R769Q|RIMS2_uc003ylq.2_Missense_Mutation_p.R769Q|RIMS2_uc003ylr.2_Missense_Mutation_p.R816Q	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1039					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TGTTTTAGTCGGAATGTGGAA	0.383										HNSCC(12;0.0054)			48	110	---	---	---	---	capture	Missense_Mutation	SNP	105001535	105001535	RIMS2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13260	36
EPPK1	83481	broad.mit.edu	37	8	144947336	144947336	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144947336G>A	uc003zaa.1	-	1	99	c.86C>T	c.(85-87)ACG>ATG	p.T29M		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	29						cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCTCCCAGCGTGGCTGCCAT	0.672													13	17	---	---	---	---	capture	Missense_Mutation	SNP	144947336	144947336	EPPK1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5145	36
C9orf66	157983	broad.mit.edu	37	9	214916	214916	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:214916G>A	uc003zge.3	-	1	978	c.481C>T	c.(481-483)CGC>TGC	p.R161C	DOCK8_uc011lls.1_5'UTR|DOCK8_uc003zgf.2_5'UTR	NM_152569	NP_689782	Q5T8R8	CI066_HUMAN	hypothetical protein LOC157983	161								p.R161C(1)		central_nervous_system(1)	1	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		ACTCTGCGGCGCGCCAGGCCC	0.687													14	7	---	---	---	---	capture	Missense_Mutation	SNP	214916	214916	C9orf66	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2466	36
SUSD1	64420	broad.mit.edu	37	9	114874102	114874102	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114874102G>A	uc004bfu.2	-	8	1044	c.1003C>T	c.(1003-1005)CGG>TGG	p.R335W	SUSD1_uc010mui.2_Missense_Mutation_p.R335W|SUSD1_uc010muj.2_Missense_Mutation_p.R335W	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor	335	Extracellular (Potential).					integral to membrane	calcium ion binding				0						GGGTCCAACCGTTGTCCTTTT	0.498													6	60	---	---	---	---	capture	Missense_Mutation	SNP	114874102	114874102	SUSD1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	15295	36
LAMC3	10319	broad.mit.edu	37	9	133927946	133927946	+	Missense_Mutation	SNP	G	A	A	rs142796007	byFrequency	TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133927946G>A	uc004caa.1	+	10	1797	c.1699G>A	c.(1699-1701)GGG>AGG	p.G567R		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	567	Laminin IV type A.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GGTGCCCCCCGGGGACTCCCC	0.622											OREG0019556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	47	74	---	---	---	---	capture	Missense_Mutation	SNP	133927946	133927946	LAMC3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8536	36
NDUFB11	54539	broad.mit.edu	37	X	47001797	47001797	+	Silent	SNP	T	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47001797T>C	uc004dhd.2	-	3	912	c.381A>G	c.(379-381)AAA>AAG	p.K127K	NDUFB11_uc004dhc.2_Silent_p.K137K|RBM10_uc004dhe.1_5'Flank|RBM10_uc004dhf.2_5'Flank|RBM10_uc004dhg.2_5'Flank|RBM10_uc004dhh.2_5'Flank|RBM10_uc010nhq.2_5'Flank|RBM10_uc004dhi.2_5'Flank	NM_001135998	NP_001129470	Q9NX14	NDUBB_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	127					respiratory electron transport chain|transport	integral to membrane|mitochondrial respiratory chain complex I					0						CCTCTCGGTATTTCACAAGCC	0.552													35	33	---	---	---	---	capture	Silent	SNP	47001797	47001797	NDUFB11	23	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	10187	36
GATA1	2623	broad.mit.edu	37	X	48652346	48652346	+	Silent	SNP	G	A	A			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48652346G>A	uc004dkq.3	+	6	1108	c.1017G>A	c.(1015-1017)GGG>GGA	p.G339G		NM_002049	NP_002040	P15976	GATA1_HUMAN	GATA binding protein 1	339					basophil differentiation|eosinophil differentiation|erythrocyte development|megakaryocyte differentiation|platelet aggregation|platelet formation|positive regulation of anti-apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|regulation of glycoprotein biosynthetic process|transcription from RNA polymerase II promoter	nuclear membrane|nucleolus|nucleoplasm	C2H2 zinc finger domain binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(246)|lung(2)	248						TGGTGGCTGGGGGCAGCGGTA	0.627			Mis|F		megakaryoblastic leukemia of Downs Syndrome								4	9	---	---	---	---	capture	Silent	SNP	48652346	48652346	GATA1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	6193	36
YIPF6	286451	broad.mit.edu	37	X	67742719	67742719	+	Silent	SNP	G	T	T			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:67742719G>T	uc004dwy.2	+	6	575	c.552G>T	c.(550-552)CGG>CGT	p.R184R	YIPF6_uc011mph.1_Silent_p.R141R	NM_173834	NP_776195	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	184						endoplasmic reticulum|integral to membrane					0						TCATGGTTCGGCTTTTTGTGG	0.408													67	110	---	---	---	---	capture	Silent	SNP	67742719	67742719	YIPF6	23	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	17363	36
CDX4	1046	broad.mit.edu	37	X	72667262	72667262	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:72667262A>G	uc011mqk.1	+	1	173	c.173A>G	c.(172-174)CAT>CGT	p.H58R		NM_005193	NP_005184	O14627	CDX4_HUMAN	caudal type homeobox 4	58						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(35;0.156)					GGGTATCCTCATATGCCCAGC	0.632													19	45	---	---	---	---	capture	Missense_Mutation	SNP	72667262	72667262	CDX4	23	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	3153	36
CPXCR1	53336	broad.mit.edu	37	X	88009244	88009244	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:88009244T>C	uc004efd.3	+	3	1088	c.829T>C	c.(829-831)TTT>CTT	p.F277L	CPXCR1_uc004efc.3_Missense_Mutation_p.F277L	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	277						intracellular	zinc ion binding			ovary(3)	3						TTGGAAATACTTTTGTCCCAT	0.299													29	58	---	---	---	---	capture	Missense_Mutation	SNP	88009244	88009244	CPXCR1	23	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	3801	36
GNL2	29889	broad.mit.edu	37	1	38049466	38049466	+	Splice_Site	DEL	A	-	-			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38049466delA	uc001cbk.2	-	6	799	c.636_splice	c.e6+1	p.K212_splice	GNL2_uc010oif.1_Splice_Site_p.K53_splice|GNL2_uc009vve.2_3'UTR	NM_013285	NP_037417	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2						ribosome biogenesis	nucleolus	GTP binding|GTPase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)				TAGGAGTCTTACCTTGTAGAG	0.383													19	163	---	---	---	---	capture_indel	Splice_Site	DEL	38049466	38049466	GNL2	1	A	-	-	-	1	0	1	0	1	0	0	1	0	182	14	5	5	6472	36
SDC4	6385	broad.mit.edu	37	20	43977015	43977016	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43977015_43977016insG	uc002xnu.2	-	1	49_50	c.9_10insC	c.(7-12)CCCGCCfs	p.P3fs	SDC4_uc010zws.1_5'UTR	NM_002999	NP_002990	P31431	SDC4_HUMAN	syndecan 4 precursor	3_4						extracellular region|integral to plasma membrane	cytoskeletal protein binding|thrombospondin receptor activity				0		Myeloproliferative disorder(115;0.0122)				AACAGACGGGCGGGGGCCATGG	0.708													10	18	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	43977015	43977016	SDC4	20	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	13847	36
TTLL3	26140	broad.mit.edu	37	3	9839460	9839463	+	Splice_Site	DEL	AGGT	-	-			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9839460_9839463delAGGT	uc003btd.3	+	1	119	c.-160_splice	c.e1+1		ARPC4_uc003bsz.1_Splice_Site_p.R41_splice|ARPC4_uc003bta.1_Splice_Site|ARPC4_uc003btb.1_Splice_Site|ARPC4_uc003btc.1_Splice_Site			Q9Y4R7	TTLL3_HUMAN	RecName: Full=Tubulin--tyrosine ligase-like protein 3; AltName: Full=HOTTL;						axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)					AGTGGAAGTCAGGTAGGGAAGGAC	0.564													24	45	---	---	---	---	capture_indel	Splice_Site	DEL	9839460	9839463	TTLL3	3	AGGT	-	-	-	1	0	1	0	1	0	0	1	0	88	7	5	5	16610	36
C4orf21	55345	broad.mit.edu	37	4	113510967	113510968	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-06-0173-01	TCGA-06-0173-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113510967_113510968delTT	uc003iau.2	-	11	3250_3251	c.3039_3040delAA	c.(3037-3042)TCAAGAfs	p.S1013fs	C4orf21_uc003iav.2_5'Flank|C4orf21_uc003iaw.2_Frame_Shift_Del_p.S1013fs	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TCTTCATCTCTTGAGTTCAAAG	0.391													61	116	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	113510967	113510968	C4orf21	4	TT	-	-	-	1	0	1	0	1	0	0	0	0	726	56	5	5	2232	36
