Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TNFRSF4	7293	broad.mit.edu	37	1	1149465	1149465	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1149465C>T	uc001ade.2	-	1	48	c.43G>A	c.(43-45)GCT>ACT	p.A15T	TNFRSF4_uc001adf.2_5'UTR	NM_003327	NP_003318	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily,	15					immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGGAGCAGAGCCGCACACGGC	0.692													10	6	---	---	---	---	capture	Missense_Mutation	SNP	1149465	1149465	TNFRSF4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16180	37
C1orf201	90529	broad.mit.edu	37	1	24710467	24710467	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24710467G>T	uc001bjc.2	-	4	351	c.216C>A	c.(214-216)TAC>TAA	p.Y72*	C1orf201_uc001bja.2_Nonsense_Mutation_p.Y25*|C1orf201_uc001bjb.2_5'UTR|C1orf201_uc001bjd.2_Nonsense_Mutation_p.Y72*|C1orf201_uc001bje.1_Nonsense_Mutation_p.Y25*|C1orf201_uc001bjf.2_5'UTR			Q5TH74	CA201_HUMAN	RecName: Full=UPF0490 protein C1orf201;	72										ovary(1)|breast(1)	2		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.0191)|all_lung(284;0.0251)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.056)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.48e-25)|Colorectal(126;7.29e-08)|COAD - Colon adenocarcinoma(152;3.85e-06)|GBM - Glioblastoma multiforme(114;0.000399)|BRCA - Breast invasive adenocarcinoma(304;0.00107)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00393)|READ - Rectum adenocarcinoma(331;0.0672)|Lung(427;0.145)		GAATAACATTGTAGAACCCAG	0.413													10	224	---	---	---	---	capture	Nonsense_Mutation	SNP	24710467	24710467	C1orf201	1	G	T	T	T	1	0	0	0	0	0	1	0	0	620	48	5	4	2009	37
LEPRE1	64175	broad.mit.edu	37	1	43213879	43213879	+	Silent	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43213879G>A	uc001chv.2	-	12	1943	c.1830C>T	c.(1828-1830)CGC>CGT	p.R610R	LEPRE1_uc001chw.2_Silent_p.R610R|LEPRE1_uc001chx.3_Silent_p.R610R	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	610	Fe2OG dioxygenase.				negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	ACCTGTAGTCGCGGAAGGTGT	0.602													25	33	---	---	---	---	capture	Silent	SNP	43213879	43213879	LEPRE1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8649	37
GIPC2	54810	broad.mit.edu	37	1	78560730	78560730	+	Missense_Mutation	SNP	G	A	A	rs143579527		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78560730G>A	uc001dik.2	+	3	711	c.521G>A	c.(520-522)CGT>CAT	p.R174H		NM_017655	NP_060125	Q8TF65	GIPC2_HUMAN	PDZ domain protein GIPC2	174	PDZ.					cytoplasm				ovary(1)	1						GTTGGGTGGCGTCACTATGAT	0.348													96	111	---	---	---	---	capture	Missense_Mutation	SNP	78560730	78560730	GIPC2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6332	37
POLR3C	10623	broad.mit.edu	37	1	145594170	145594170	+	Silent	SNP	A	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145594170A>T	uc001eoh.2	-	14	1553	c.1392T>A	c.(1390-1392)TCT>TCA	p.S464S	NBPF10_uc001emp.3_Intron|POLR3C_uc001eog.2_Silent_p.S477S|POLR3C_uc001eoi.2_RNA|POLR3C_uc009wix.2_Intron	NM_006468	NP_006459	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	464					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			CTACCCTCTGAGATTTTTCTA	0.478													74	92	---	---	---	---	capture	Silent	SNP	145594170	145594170	POLR3C	1	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	12132	37
VPS72	6944	broad.mit.edu	37	1	151162515	151162515	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151162515T>C	uc001exe.1	-	1	126	c.83A>G	c.(82-84)GAG>GGG	p.E28G	VPS72_uc001exf.1_Missense_Mutation_p.E28G	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1	28	Asp/Glu-rich (acidic).				chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGGTAGAACTCATCTTCCTC	0.612													4	214	---	---	---	---	capture	Missense_Mutation	SNP	151162515	151162515	VPS72	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17099	37
LRRC52	440699	broad.mit.edu	37	1	165532851	165532851	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:165532851C>A	uc001gde.2	+	2	788	c.732C>A	c.(730-732)GAC>GAA	p.D244E	LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	NM_001005214	NP_001005214	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52 precursor	244	Extracellular (Potential).					integral to membrane				ovary(1)	1	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					ACCACAAAGACTACATCTTCC	0.602													32	38	---	---	---	---	capture	Missense_Mutation	SNP	165532851	165532851	LRRC52	1	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	8925	37
SELE	6401	broad.mit.edu	37	1	169698757	169698757	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169698757T>C	uc001ggm.3	-	6	930	c.773A>G	c.(772-774)AAC>AGC	p.N258S	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	258	Sushi 2.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					GCTTCCAGGGTTTTGGAAACA	0.438													118	140	---	---	---	---	capture	Missense_Mutation	SNP	169698757	169698757	SELE	1	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	13906	37
KIAA1217	56243	broad.mit.edu	37	10	24790356	24790356	+	Missense_Mutation	SNP	C	T	T	rs141937477		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24790356C>T	uc001iru.3	+	9	2286	c.1883C>T	c.(1882-1884)ACG>ATG	p.T628M	KIAA1217_uc001irs.2_Missense_Mutation_p.T548M|KIAA1217_uc001irt.3_Missense_Mutation_p.T593M|KIAA1217_uc010qcy.1_Missense_Mutation_p.T593M|KIAA1217_uc010qcz.1_Missense_Mutation_p.T593M|KIAA1217_uc001irv.1_Missense_Mutation_p.T443M|KIAA1217_uc010qda.1_RNA|KIAA1217_uc001irw.2_Missense_Mutation_p.T311M|KIAA1217_uc001irz.2_Missense_Mutation_p.T311M|KIAA1217_uc001irx.2_Missense_Mutation_p.T311M|KIAA1217_uc001iry.2_Missense_Mutation_p.T311M	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	628					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						CTGGAGTCCACGGTGCCTCCC	0.582													5	45	---	---	---	---	capture	Missense_Mutation	SNP	24790356	24790356	KIAA1217	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8138	37
ARMC4	55130	broad.mit.edu	37	10	28229528	28229528	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:28229528A>C	uc009xky.2	-	13	2048	c.1950T>G	c.(1948-1950)ATT>ATG	p.I650M	ARMC4_uc010qds.1_Missense_Mutation_p.I175M|ARMC4_uc010qdt.1_Missense_Mutation_p.I342M|ARMC4_uc001itz.2_Missense_Mutation_p.I650M|ARMC4_uc010qdu.1_Missense_Mutation_p.I342M	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	650	ARM 3.						binding			ovary(4)|skin(2)	6						CCACCACTGGAATTAGCATGT	0.473													47	38	---	---	---	---	capture	Missense_Mutation	SNP	28229528	28229528	ARMC4	10	A	C	C	C	1	0	0	0	0	1	0	0	0	112	9	4	4	946	37
OR13A1	79290	broad.mit.edu	37	10	45799324	45799324	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:45799324G>A	uc001jcc.1	-	4	856	c.547C>T	c.(547-549)CGC>TGC	p.R183C	OR13A1_uc001jcd.1_Missense_Mutation_p.R179C	NM_001004297	NP_001004297	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A,	183	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AAATCCAAGCGCAGCATCAGC	0.587													47	12	---	---	---	---	capture	Missense_Mutation	SNP	45799324	45799324	OR13A1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10837	37
DNTT	1791	broad.mit.edu	37	10	98079146	98079146	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98079146C>T	uc001kmf.2	+	3	676	c.506C>T	c.(505-507)ACG>ATG	p.T169M	DNTT_uc001kmg.2_Missense_Mutation_p.T169M	NM_004088	NP_004079	P04053	TDT_HUMAN	terminal deoxynucleotidyltransferase isoform 1	169	Mediates interaction with DNTTIP2.				DNA modification	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(1)	1		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		CAGATATTCACGGTAACGGGA	0.448													125	18	---	---	---	---	capture	Missense_Mutation	SNP	98079146	98079146	DNTT	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4636	37
PAX2	5076	broad.mit.edu	37	10	102510548	102510548	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102510548C>T	uc001krk.3	+	3	860	c.310C>T	c.(310-312)CGA>TGA	p.R104*	PAX2_uc001krl.3_Nonsense_Mutation_p.R104*|PAX2_uc001krm.3_Nonsense_Mutation_p.R104*|PAX2_uc001kro.3_Nonsense_Mutation_p.R104*|PAX2_uc001krn.3_Nonsense_Mutation_p.R104*|PAX2_uc010qps.1_Nonsense_Mutation_p.R103*|PAX2_uc001krp.1_Nonsense_Mutation_p.R108*	NM_003990	NP_003981	Q02962	PAX2_HUMAN	paired box protein 2 isoform e	104	Paired.				anti-apoptosis|axonogenesis|brain morphogenesis|branching involved in ureteric bud morphogenesis|cell fate determination|cellular response to glucose stimulus|cellular response to hydrogen peroxide|cellular response to retinoic acid|cochlea development|glial cell differentiation|inner ear morphogenesis|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesodermal cell fate specification|mesonephros development|metanephric collecting duct development|metanephric distal convoluted tubule development|metanephric mesenchymal cell differentiation|metanephric nephron tubule formation|negative regulation of caspase activity|negative regulation of cytolysis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|negative regulation of reactive oxygen species metabolic process|negative regulation of transcription, DNA-dependent|nephric duct formation|neural tube closure|optic chiasma development|optic cup morphogenesis involved in camera-type eye development|optic nerve structural organization|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of metanephric glomerulus development|positive regulation of optic nerve formation|positive regulation of transcription from RNA polymerase II promoter|pronephric field specification|protein kinase B signaling cascade|reactive oxygen species metabolic process|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of metanephros size|retinal pigment epithelium development|stem cell differentiation|transcription from RNA polymerase II promoter|ureter maturation|vestibulocochlear nerve formation|visual perception	centriolar satellite|nucleus|protein complex|protein-DNA complex	core promoter proximal region sequence-specific DNA binding|superoxide-generating NADPH oxidase activity				0		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		TGAATACAAACGACAGAACCC	0.572													96	10	---	---	---	---	capture	Nonsense_Mutation	SNP	102510548	102510548	PAX2	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	11382	37
OR4C6	219432	broad.mit.edu	37	11	55433358	55433358	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55433358G>T	uc001nht.3	+	3	981	c.716G>T	c.(715-717)AGC>ATC	p.S239I	OR4C6_uc010rik.1_Missense_Mutation_p.S239I	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TCTACCTGCAGCTCCCACCTC	0.502													7	221	---	---	---	---	capture	Missense_Mutation	SNP	55433358	55433358	OR4C6	11	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	10956	37
ASAM	79827	broad.mit.edu	37	11	122944226	122944226	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:122944226G>T	uc001pyt.2	-	7	1437	c.1078C>A	c.(1078-1080)CCC>ACC	p.P360T		NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor	360	Cytoplasmic (Potential).					integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		ATCATGCTGGGTGTGGTTTCT	0.537													143	199	---	---	---	---	capture	Missense_Mutation	SNP	122944226	122944226	ASAM	11	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	1000	37
CD4	920	broad.mit.edu	37	12	6923329	6923329	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6923329G>A	uc001qqv.1	+	4	481	c.236G>A	c.(235-237)CGC>CAC	p.R79H	CD4_uc009zez.1_Missense_Mutation_p.R24H|CD4_uc009zfa.1_RNA|CD4_uc009zfb.1_RNA|CD4_uc010sfj.1_5'UTR|CD4_uc009zfc.1_5'UTR|CD4_uc010sfk.1_5'UTR|CD4_uc010sfl.1_5'UTR|CD4_uc010sfm.1_5'UTR	NM_000616	NP_000607	P01730	CD4_HUMAN	CD4 antigen precursor	79	Extracellular (Potential).|Ig-like V-type.				cell adhesion|entry into host cell|immune response|induction by virus of host cell-cell fusion|initiation of viral infection|maintenance of protein location in cell|positive regulation of interleukin-2 biosynthetic process|positive regulation of protein kinase activity|protein palmitoleylation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|T cell selection|transmembrane receptor protein tyrosine kinase signaling pathway	early endosome|endoplasmic reticulum membrane|integral to membrane|T cell receptor complex	coreceptor activity|extracellular matrix structural constituent|glycoprotein binding|MHC class II protein binding|protein homodimerization activity|protein kinase binding|transmembrane receptor activity|zinc ion binding				0		Myeloproliferative disorder(1001;0.0122)				CTGAATGATCGCGCTGACTCA	0.522													12	299	---	---	---	---	capture	Missense_Mutation	SNP	6923329	6923329	CD4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2985	37
PHC1	1911	broad.mit.edu	37	12	9087006	9087006	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9087006G>A	uc001qvd.2	+	10	2341	c.2185G>A	c.(2185-2187)GTG>ATG	p.V729M	PHC1_uc001qve.2_Missense_Mutation_p.V729M	NM_004426	NP_004417	P78364	PHC1_HUMAN	polyhomeotic 1-like	729					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						ACAGGCCATCGTGAAGCCCCA	0.542													5	140	---	---	---	---	capture	Missense_Mutation	SNP	9087006	9087006	PHC1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11719	37
BICD1	636	broad.mit.edu	37	12	32491868	32491868	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32491868G>C	uc001rku.2	+	8	2800	c.2719G>C	c.(2719-2721)GGG>CGG	p.G907R	BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_RNA	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1	907					anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ATTCATCCAAGGGCACCGGCT	0.463													83	109	---	---	---	---	capture	Missense_Mutation	SNP	32491868	32491868	BICD1	12	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	1416	37
BCDIN3D	144233	broad.mit.edu	37	12	50232500	50232500	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50232500C>T	uc001rvh.2	-	2	575	c.533G>A	c.(532-534)GGC>GAC	p.G178D	LOC100286844_uc010smm.1_Intron|LOC100286844_uc001rvg.2_RNA|LOC100286844_uc010smn.1_RNA	NM_181708	NP_859059	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	178	Bin3-type SAM.						methyltransferase activity			ovary(1)	1						CTCCCATAGGCCATGGTCTCC	0.512											OREG0021805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	66	58	---	---	---	---	capture	Missense_Mutation	SNP	50232500	50232500	BCDIN3D	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1346	37
ATF7	11016	broad.mit.edu	37	12	53928392	53928392	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53928392G>A	uc001sdy.2	-	5	508	c.487C>T	c.(487-489)CGT>TGT	p.R163C	ATF7_uc010sok.1_RNA|ATF7_uc001sdz.2_Missense_Mutation_p.R152C|ATF7_uc010sol.1_Missense_Mutation_p.R131C	NM_001130059	NP_001123531	P17544	ATF7_HUMAN	activating transcription factor 7 isoform 1	163	Transactivation domain.				interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						GAGCCAGGACGTACAATGGTG	0.512													4	149	---	---	---	---	capture	Missense_Mutation	SNP	53928392	53928392	ATF7	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1077	37
SDR9C7	121214	broad.mit.edu	37	12	57328041	57328041	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57328041G>A	uc010sqw.1	-	1	5	c.5C>T	c.(4-6)GCG>GTG	p.A2V		NM_148897	NP_683695	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C,	2						cytoplasm	binding|oxidoreductase activity			central_nervous_system(1)	1						TGTGAGGGCCGCCATAGGGCA	0.542													3	51	---	---	---	---	capture	Missense_Mutation	SNP	57328041	57328041	SDR9C7	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13867	37
AVIL	10677	broad.mit.edu	37	12	58207190	58207190	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58207190C>T	uc001sqj.1	-	3	187	c.158G>A	c.(157-159)AGT>AAT	p.S53N	AVIL_uc009zqe.1_Missense_Mutation_p.S46N|AVIL_uc001sql.3_Missense_Mutation_p.S30N	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin	53	Gelsolin-like 1.|Core (By similarity).				actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GGATAGGAGACTGGCCACTCT	0.582													16	382	---	---	---	---	capture	Missense_Mutation	SNP	58207190	58207190	AVIL	12	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	1217	37
CPSF6	11052	broad.mit.edu	37	12	69653833	69653833	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69653833G>T	uc001sut.3	+	8	1435	c.1325G>T	c.(1324-1326)GGG>GTG	p.G442V	CPSF6_uc001suu.3_Missense_Mutation_p.G479V|CPSF6_uc010stk.1_Missense_Mutation_p.G73V	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	442					mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			GGTGATTATGGGAGTGCTATT	0.328													154	98	---	---	---	---	capture	Missense_Mutation	SNP	69653833	69653833	CPSF6	12	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	3794	37
NOS1	4842	broad.mit.edu	37	12	117718572	117718572	+	Silent	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117718572G>A	uc001twm.1	-	8	2168	c.1482C>T	c.(1480-1482)GAC>GAT	p.D494D		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	494					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GGGTGGAGCCGTCAGGCTGCT	0.617													41	31	---	---	---	---	capture	Silent	SNP	117718572	117718572	NOS1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10448	37
TMEM132B	114795	broad.mit.edu	37	12	126004117	126004117	+	Silent	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:126004117C>T	uc001uhe.1	+	4	1232	c.1224C>T	c.(1222-1224)GTC>GTT	p.V408V		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	408	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AGCTGGTCGTCTCCGAGATCT	0.532													78	83	---	---	---	---	capture	Silent	SNP	126004117	126004117	TMEM132B	12	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	15930	37
GLT1D1	144423	broad.mit.edu	37	12	129360558	129360558	+	Silent	SNP	C	T	T	rs144231014		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129360558C>T	uc010tbh.1	+	2	144	c.135C>T	c.(133-135)TGC>TGT	p.C45C	GLT1D1_uc001uhx.1_Silent_p.C56C|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	56					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		CTGAGAACTGCGAGGCTGCCC	0.483													138	189	---	---	---	---	capture	Silent	SNP	129360558	129360558	GLT1D1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	6401	37
ZMYM5	9205	broad.mit.edu	37	13	20409775	20409775	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20409775A>G	uc010tcn.1	-	7	1358	c.1093T>C	c.(1093-1095)TGC>CGC	p.C365R	ZMYM5_uc001umm.1_Missense_Mutation_p.C189R	NM_001142684	NP_001136156	Q9UJ78	ZMYM5_HUMAN	zinc finger protein 237 isoform 3	365	MYM-type 3.					nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		TTATTAAAGCAATGGTTACTG	0.363													57	76	---	---	---	---	capture	Missense_Mutation	SNP	20409775	20409775	ZMYM5	13	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	17583	37
NBEA	26960	broad.mit.edu	37	13	35730325	35730325	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:35730325A>C	uc001uvb.2	+	21	2839	c.2633A>C	c.(2632-2634)AAC>ACC	p.N878T		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	878						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTTTTCAGTAACAGCCGTGAA	0.313													6	8	---	---	---	---	capture	Missense_Mutation	SNP	35730325	35730325	NBEA	13	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	10094	37
SCEL	8796	broad.mit.edu	37	13	78176839	78176839	+	Missense_Mutation	SNP	C	T	T	rs144213801		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:78176839C>T	uc001vki.2	+	17	1198	c.1028C>T	c.(1027-1029)ACG>ATG	p.T343M	SCEL_uc001vkj.2_Missense_Mutation_p.T323M|SCEL_uc010thx.1_Missense_Mutation_p.T321M	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1	343	16 X approximate tandem repeats.|5.				embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		ATGAATAAAACGAGCAGAAGG	0.348													4	176	---	---	---	---	capture	Missense_Mutation	SNP	78176839	78176839	SCEL	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13780	37
RPL10L	140801	broad.mit.edu	37	14	47120929	47120929	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:47120929C>T	uc001wwg.2	-	1	100	c.11G>A	c.(10-12)CGT>CAT	p.R4H		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	4					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						GCGAGCTGGACGGCGCCCCAT	0.557													56	77	---	---	---	---	capture	Missense_Mutation	SNP	47120929	47120929	RPL10L	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13448	37
ACYP1	97	broad.mit.edu	37	14	75520272	75520272	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75520272C>T	uc001xrg.2	-	3	263	c.175G>A	c.(175-177)GTG>ATG	p.V59M	MLH3_uc001xrd.1_5'Flank|MLH3_uc001xre.1_5'Flank|ACYP1_uc001xrf.2_3'UTR	NM_001107	NP_001098	P07311	ACYP1_HUMAN	acylphosphatase 1 isoform a	59	Acylphosphatase-like.				phosphate metabolic process		acylphosphatase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00646)		ATATGACGCACCTTGGAGATG	0.478													127	203	---	---	---	---	capture	Missense_Mutation	SNP	75520272	75520272	ACYP1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	228	37
AHNAK2	113146	broad.mit.edu	37	14	105412495	105412495	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105412495G>A	uc010axc.1	-	7	9413	c.9293C>T	c.(9292-9294)ACG>ATG	p.T3098M	AHNAK2_uc001ypx.2_Missense_Mutation_p.T2998M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3098						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCGGGGGCCGTCACGTCCGT	0.627													5	163	---	---	---	---	capture	Missense_Mutation	SNP	105412495	105412495	AHNAK2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	415	37
MAPKBP1	23005	broad.mit.edu	37	15	42111153	42111153	+	Silent	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42111153C>T	uc001zok.3	+	21	2593	c.2307C>T	c.(2305-2307)AAC>AAT	p.N769N	MAPKBP1_uc001zoj.3_Silent_p.N763N|MAPKBP1_uc010bcj.2_Silent_p.N270N|MAPKBP1_uc010bci.2_Silent_p.N763N|MAPKBP1_uc010udb.1_Silent_p.N602N|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_Silent_p.N270N	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein	769								p.N763N(1)		central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CTGGACCCAACCGGTGAGAAC	0.607													37	45	---	---	---	---	capture	Silent	SNP	42111153	42111153	MAPKBP1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	9205	37
ZSCAN29	146050	broad.mit.edu	37	15	43653907	43653907	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43653907T>G	uc001zrk.1	-	5	2070	c.1923A>C	c.(1921-1923)CAA>CAC	p.Q641H	ZSCAN29_uc001zrj.1_Missense_Mutation_p.Q521H|ZSCAN29_uc010bdf.1_3'UTR|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Missense_Mutation_p.Q251H	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690	641					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		AAGGTCTCTGTTGACTTAGGA	0.473													5	318	---	---	---	---	capture	Missense_Mutation	SNP	43653907	43653907	ZSCAN29	15	T	G	G	G	1	0	0	0	0	1	0	0	0	777	60	4	4	18112	37
SSTR5	6755	broad.mit.edu	37	16	1129417	1129417	+	Silent	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1129417C>T	uc002ckq.2	+	1	637	c.549C>T	c.(547-549)GGC>GGT	p.G183G	LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	NM_001053	NP_001044	P35346	SSR5_HUMAN	somatostatin receptor 5	183	Extracellular (Potential).				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			lung(1)	1		Hepatocellular(780;0.00369)			Octreotide(DB00104)	TGCAGGAGGGCGGTACCTGCA	0.716													10	8	---	---	---	---	capture	Silent	SNP	1129417	1129417	SSTR5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15093	37
TMC5	79838	broad.mit.edu	37	16	19451842	19451842	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:19451842C>T	uc002dgc.3	+	3	1231	c.482C>T	c.(481-483)CCG>CTG	p.P161L	TMC5_uc010vaq.1_Missense_Mutation_p.P161L|TMC5_uc002dgb.3_Missense_Mutation_p.P161L|TMC5_uc010var.1_Missense_Mutation_p.P161L	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	161	Extracellular (Potential).					integral to membrane				skin(1)	1						TCCTTAGAACCGGACTACCCT	0.478													144	217	---	---	---	---	capture	Missense_Mutation	SNP	19451842	19451842	TMC5	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15873	37
OTOA	146183	broad.mit.edu	37	16	21689852	21689852	+	Missense_Mutation	SNP	C	T	T	rs144912852		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21689852C>T	uc002djh.2	+	1	18	c.17C>T	c.(16-18)ACG>ATG	p.T6M	uc002diq.3_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	6					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		CAGGAACCTACGACATACTCC	0.333													66	64	---	---	---	---	capture	Missense_Mutation	SNP	21689852	21689852	OTOA	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11206	37
GTF3C1	2975	broad.mit.edu	37	16	27518426	27518426	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27518426C>T	uc002dov.1	-	9	1334	c.1294G>A	c.(1294-1296)GTG>ATG	p.V432M	GTF3C1_uc002dou.2_Missense_Mutation_p.V432M	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	432						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						TCTGCAAACACGCAGGAAATG	0.552													63	83	---	---	---	---	capture	Missense_Mutation	SNP	27518426	27518426	GTF3C1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6801	37
MFSD6L	162387	broad.mit.edu	37	17	8701786	8701786	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8701786C>A	uc002glp.1	-	1	801	c.653G>T	c.(652-654)GGG>GTG	p.G218V		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	218						integral to membrane				central_nervous_system(1)	1						ATTCCCGGGCCCTTTCCCCCC	0.577													80	128	---	---	---	---	capture	Missense_Mutation	SNP	8701786	8701786	MFSD6L	17	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	9448	37
UNC45B	146862	broad.mit.edu	37	17	33504108	33504108	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33504108G>A	uc002hja.2	+	16	2201	c.2104G>A	c.(2104-2106)GCT>ACT	p.A702T	UNC45B_uc002hjb.2_Missense_Mutation_p.A700T|UNC45B_uc002hjc.2_Missense_Mutation_p.A700T|UNC45B_uc010cto.2_Missense_Mutation_p.A621T	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	702					cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				AGCAAAGATCGCTGCTGTCTC	0.572													139	107	---	---	---	---	capture	Missense_Mutation	SNP	33504108	33504108	UNC45B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16871	37
SCN4A	6329	broad.mit.edu	37	17	62025418	62025418	+	Silent	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62025418G>A	uc002jds.1	-	17	3227	c.3150C>T	c.(3148-3150)TTC>TTT	p.F1050F		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1050	III.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	AGATGTCCTCGAAGGCCTGGG	0.602													22	22	---	---	---	---	capture	Silent	SNP	62025418	62025418	SCN4A	17	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	13813	37
AZI1	22994	broad.mit.edu	37	17	79170626	79170626	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79170626C>T	uc002jzp.1	-	15	1983	c.1783G>A	c.(1783-1785)GCG>ACG	p.A595T	AZI1_uc002jzm.1_Missense_Mutation_p.A22T|AZI1_uc002jzn.1_Missense_Mutation_p.A592T|AZI1_uc002jzo.1_Missense_Mutation_p.A592T|AZI1_uc010wum.1_Missense_Mutation_p.A595T|AZI1_uc002jzq.2_5'Flank	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	595					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CGCTGCTGCGCCTGCAGGGTG	0.687													12	6	---	---	---	---	capture	Missense_Mutation	SNP	79170626	79170626	AZI1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1230	37
FBN3	84467	broad.mit.edu	37	19	8162272	8162272	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8162272C>T	uc002mjf.2	-	41	5209	c.5188G>A	c.(5188-5190)GCC>ACC	p.A1730T		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1730	EGF-like 26; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GCACAGATGGCGGGGATCTCC	0.597													7	56	---	---	---	---	capture	Missense_Mutation	SNP	8162272	8162272	FBN3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5650	37
UNC13A	23025	broad.mit.edu	37	19	17769035	17769035	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17769035G>T	uc002nhd.2	-	10	867	c.867C>A	c.(865-867)TAC>TAA	p.Y289*		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	201					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TTTCACTGCGGTAGTCACTGT	0.562													6	43	---	---	---	---	capture	Nonsense_Mutation	SNP	17769035	17769035	UNC13A	19	G	T	T	T	1	0	0	0	0	0	1	0	0	568	44	5	4	16866	37
LRP3	4037	broad.mit.edu	37	19	33695616	33695616	+	Silent	SNP	A	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33695616A>C	uc010edh.2	+	4	426	c.333A>C	c.(331-333)CCA>CCC	p.P111P	LRP3_uc010xrp.1_5'UTR|LRP3_uc002nuk.3_5'UTR	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	111	Extracellular (Potential).|CUB 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CAGCAGCCCCACCCCGCCAGG	0.662													11	111	---	---	---	---	capture	Silent	SNP	33695616	33695616	LRP3	19	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	8874	37
MAG	4099	broad.mit.edu	37	19	35793483	35793483	+	Missense_Mutation	SNP	C	T	T	rs144554089		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35793483C>T	uc002nyy.1	+	7	1252	c.1103C>T	c.(1102-1104)ACG>ATG	p.T368M	MAG_uc002nyx.1_Missense_Mutation_p.T368M|MAG_uc010eds.1_Missense_Mutation_p.T343M|MAG_uc002nyz.1_Missense_Mutation_p.T368M	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	368	Ig-like C2-type 3.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding	p.T368M(1)		breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ATCCTGTCCACGGTCATCTAC	0.582													38	121	---	---	---	---	capture	Missense_Mutation	SNP	35793483	35793483	MAG	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9076	37
RYR1	6261	broad.mit.edu	37	19	38958338	38958338	+	Silent	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38958338C>T	uc002oit.2	+	25	3397	c.3267C>T	c.(3265-3267)TTC>TTT	p.F1089F	RYR1_uc002oiu.2_Silent_p.F1089F	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1089	6 X approximate repeats.|Cytoplasmic.|B30.2/SPRY 2.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GCTGGTACTTCGAGTTTGAAG	0.592													59	166	---	---	---	---	capture	Silent	SNP	38958338	38958338	RYR1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	13660	37
CYP2S1	29785	broad.mit.edu	37	19	41700569	41700569	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41700569G>A	uc002opw.2	+	2	353	c.298G>A	c.(298-300)GGC>AGC	p.G100S	CYP2F1_uc010xvw.1_Intron|CYP2S1_uc010xvx.1_5'UTR	NM_030622	NP_085125	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S,	100					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity			skin(1)	1						GGAGTTCAGCGGCCGGGGAAC	0.592													53	101	---	---	---	---	capture	Missense_Mutation	SNP	41700569	41700569	CYP2S1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4134	37
SCAF1	58506	broad.mit.edu	37	19	50157645	50157645	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50157645C>T	uc002poq.2	+	8	3480	c.3356C>T	c.(3355-3357)GCG>GTG	p.A1119V		NM_021228	NP_067051	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1119					mRNA processing|RNA splicing	nucleus	RNA binding				0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		GCCAACCTGGCGAGCCGAGCG	0.607													3	73	---	---	---	---	capture	Missense_Mutation	SNP	50157645	50157645	SCAF1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13760	37
NLRP13	126204	broad.mit.edu	37	19	56424553	56424553	+	Silent	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56424553G>A	uc010ygg.1	-	5	655	c.630C>T	c.(628-630)GAC>GAT	p.D210D		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	210							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CCTCATGTTCGTCCTTTGATG	0.498													144	339	---	---	---	---	capture	Silent	SNP	56424553	56424553	NLRP13	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10382	37
XDH	7498	broad.mit.edu	37	2	31595165	31595165	+	Silent	SNP	G	A	A	rs140066757		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31595165G>A	uc002rnv.1	-	17	1864	c.1785C>T	c.(1783-1785)GAC>GAT	p.D595D		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	595					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	GAGGAATGTCGTCACAGTACA	0.647													178	220	---	---	---	---	capture	Silent	SNP	31595165	31595165	XDH	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	17307	37
SLC9A4	389015	broad.mit.edu	37	2	103149061	103149061	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103149061G>T	uc002tbz.3	+	12	2768	c.2311G>T	c.(2311-2313)GTT>TTT	p.V771F		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	771	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GGCCTCTTTGGTTGAGGTTCG	0.537													11	24	---	---	---	---	capture	Missense_Mutation	SNP	103149061	103149061	SLC9A4	2	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	14608	37
PKP4	8502	broad.mit.edu	37	2	159519424	159519424	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:159519424G>A	uc002tzv.2	+	14	2487	c.2227G>A	c.(2227-2229)GTG>ATG	p.V743M	PKP4_uc002tzt.1_Missense_Mutation_p.V595M|PKP4_uc002tzu.2_Missense_Mutation_p.V743M|PKP4_uc002tzw.2_Missense_Mutation_p.V743M|PKP4_uc002tzx.2_Missense_Mutation_p.V400M|PKP4_uc002tzy.1_Missense_Mutation_p.V401M|PKP4_uc002uaa.2_Missense_Mutation_p.V595M|uc002uab.1_Intron|PKP4_uc002uac.2_Translation_Start_Site	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	743	ARM 6.				cell adhesion	desmosome	protein binding	p.V743M(1)		ovary(5)|skin(2)	7						GGAGAACTGCGTGTGCACCCT	0.498										HNSCC(62;0.18)			32	53	---	---	---	---	capture	Missense_Mutation	SNP	159519424	159519424	PKP4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11890	37
ASNSD1	54529	broad.mit.edu	37	2	190531945	190531945	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:190531945A>G	uc002uqt.2	+	4	1521	c.1087A>G	c.(1087-1089)ATG>GTG	p.M363V		NM_019048	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	363	Asparagine synthetase.				asparagine biosynthetic process|glutamine metabolic process		asparagine synthase (glutamine-hydrolyzing) activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			AGAAAAGACCATGCCAACTAC	0.378													78	64	---	---	---	---	capture	Missense_Mutation	SNP	190531945	190531945	ASNSD1	2	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	1040	37
ZSWIM3	140831	broad.mit.edu	37	20	44506102	44506102	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44506102G>A	uc002xqd.2	+	2	1108	c.905G>A	c.(904-906)CGC>CAC	p.R302H	ZSWIM3_uc010zxg.1_Missense_Mutation_p.R296H	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	302							zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)				CCTGCTGCCCGCATCCTCCTT	0.502													95	98	---	---	---	---	capture	Missense_Mutation	SNP	44506102	44506102	ZSWIM3	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	18118	37
KRTAP15-1	254950	broad.mit.edu	37	21	31812738	31812738	+	Silent	SNP	C	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31812738C>A	uc002yod.2	+	1	93	c.93C>A	c.(91-93)CCC>CCA	p.P31P		NM_181623	NP_853654	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	31						intermediate filament					0						TGTTCTACCCCAGCAATGCCA	0.478													4	124	---	---	---	---	capture	Silent	SNP	31812738	31812738	KRTAP15-1	21	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	8446	37
DERL3	91319	broad.mit.edu	37	22	24179323	24179323	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24179323A>G	uc002zyh.2	-	6	567	c.542T>C	c.(541-543)ATC>ACC	p.I181T	DERL3_uc002zyk.3_Missense_Mutation_p.I181T|DERL3_uc002zyi.2_Missense_Mutation_p.I181T|DERL3_uc002zyj.2_Silent_p.Y137Y	NM_001002862	NP_001002862	Q96Q80	DERL3_HUMAN	derlin 3 isoform 2	181	Cytoplasmic (Potential).				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process	integral to endoplasmic reticulum membrane	protein binding			ovary(1)	1						GAAGTAGTAGATATGGCCCAC	0.632													35	51	---	---	---	---	capture	Missense_Mutation	SNP	24179323	24179323	DERL3	22	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	4406	37
SYN3	8224	broad.mit.edu	37	22	32909719	32909719	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32909719C>T	uc003amx.2	-	13	1862	c.1703G>A	c.(1702-1704)CGC>CAC	p.R568H	SYN3_uc003amy.2_3'UTR|SYN3_uc003amz.2_Missense_Mutation_p.R567H	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	568	E.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						CCTCAGGTTGCGGATGGTTTC	0.572													44	86	---	---	---	---	capture	Missense_Mutation	SNP	32909719	32909719	SYN3	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15330	37
NAGA	4668	broad.mit.edu	37	22	42458918	42458918	+	Silent	SNP	G	A	A	rs144984228		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42458918G>A	uc003bbx.2	-	8	1007	c.870C>T	c.(868-870)TCC>TCT	p.S290S	NAGA_uc003bby.2_Silent_p.S290S|NAGA_uc003bbw.3_Silent_p.S290S	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor	290					glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						TGTTCTGGGCGGAGATGGTAC	0.557													60	114	---	---	---	---	capture	Silent	SNP	42458918	42458918	NAGA	22	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10051	37
CNTN4	152330	broad.mit.edu	37	3	2861249	2861249	+	Silent	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:2861249G>A	uc003bpc.2	+	6	659	c.438G>A	c.(436-438)CCG>CCA	p.P146P	CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Silent_p.P146P	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	146	Ig-like C2-type 2.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TGTGTGGCCCGCCACCCCATT	0.453													29	54	---	---	---	---	capture	Silent	SNP	2861249	2861249	CNTN4	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3608	37
TRIM71	131405	broad.mit.edu	37	3	32933041	32933041	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32933041G>A	uc003cff.2	+	4	2408	c.2345G>A	c.(2344-2346)CGC>CAC	p.R782H		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	782	NHL 5.				multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						CAGTCGGCACGCTTTCTGGGC	0.617													38	51	---	---	---	---	capture	Missense_Mutation	SNP	32933041	32933041	TRIM71	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16427	37
ZNF721	170960	broad.mit.edu	37	4	436548	436548	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:436548C>T	uc003gag.2	-	3	2399	c.1708G>A	c.(1708-1710)GCA>ACA	p.A570T	ABCA11P_uc003gac.2_Intron|ABCA11P_uc003gad.2_Intron|ABCA11P_uc011buv.1_Intron|ABCA11P_uc003gae.2_Intron|ABCA11P_uc010ibd.1_Intron|ZNF721_uc003gaf.3_Missense_Mutation_p.A602T|ZNF721_uc010ibe.2_Missense_Mutation_p.A558T	NM_133474	NP_597731	D9N162	D9N162_HUMAN	zinc finger protein 721	570						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						TAAAGGTTTGCGGACTGTCTA	0.418													6	273	---	---	---	---	capture	Missense_Mutation	SNP	436548	436548	ZNF721	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17998	37
CNGA1	1259	broad.mit.edu	37	4	47939480	47939480	+	Missense_Mutation	SNP	C	T	T	rs150374036	by1000genomes	TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47939480C>T	uc003gxt.3	-	11	1297	c.1031G>A	c.(1030-1032)CGT>CAT	p.R344H	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.R413H	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	344	Cytoplasmic (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						TCTAGCCAAACGGCCAAATTC	0.413													118	140	---	---	---	---	capture	Missense_Mutation	SNP	47939480	47939480	CNGA1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3561	37
PDGFRA	5156	broad.mit.edu	37	4	55133834	55133834	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55133834G>C	uc003han.3	+	7	1378	c.1047G>C	c.(1045-1047)TGG>TGC	p.W349C	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.W243C|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	349	Ig-like C2-type 4.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	p.W349C(1)		soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GGATATCCTGGCTGAAAAACA	0.443			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			662	276	---	---	---	---	capture	Missense_Mutation	SNP	55133834	55133834	PDGFRA	4	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	11564	37
UFSP2	55325	broad.mit.edu	37	4	186334930	186334930	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186334930T>C	uc003ixo.2	-	7	898	c.781A>G	c.(781-783)ATT>GTT	p.I261V	UFSP2_uc003ixn.2_Missense_Mutation_p.I151V|UFSP2_uc003ixq.2_Missense_Mutation_p.I151V|UFSP2_uc003ixp.2_RNA	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	261						endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		GGATTTCTAATGTAACCATCT	0.363													115	121	---	---	---	---	capture	Missense_Mutation	SNP	186334930	186334930	UFSP2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	16820	37
CCT5	22948	broad.mit.edu	37	5	10262653	10262653	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:10262653C>A	uc003jeq.2	+	9	1411	c.1240C>A	c.(1240-1242)CGC>AGC	p.R414S	CCT5_uc003jer.2_Missense_Mutation_p.R414S|CCT5_uc010its.2_Missense_Mutation_p.R414S|CCT5_uc011cmr.1_Missense_Mutation_p.R359S|CCT5_uc011cms.1_Missense_Mutation_p.R376S|CCT5_uc011cmt.1_Missense_Mutation_p.R321S	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	414					'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2						GAACCTCATCCGCGATAATCG	0.493													51	96	---	---	---	---	capture	Missense_Mutation	SNP	10262653	10262653	CCT5	5	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	2927	37
SNX18	112574	broad.mit.edu	37	5	53815264	53815264	+	Silent	SNP	C	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:53815264C>G	uc003jpj.3	+	1	1672	c.1482C>G	c.(1480-1482)GCC>GCG	p.A494A	SNX18_uc011cqg.1_Silent_p.A494A|SNX18_uc003jpi.3_Silent_p.A494A	NM_052870	NP_443102	Q96RF0	SNX18_HUMAN	sorting nexin 18 isoform b	494	BAR.				cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding				0		Lung NSC(810;3.46e-05)|Breast(144;0.102)				AGGCTATCGCCTTCACCGGAG	0.617													53	62	---	---	---	---	capture	Silent	SNP	53815264	53815264	SNX18	5	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	14781	37
PCDHA11	56138	broad.mit.edu	37	5	140250296	140250296	+	Silent	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140250296G>A	uc003lia.2	+	1	2466	c.1608G>A	c.(1606-1608)GCG>GCA	p.A536A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Silent_p.A536A	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	536	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGAGCGCGCGCGATGCGG	0.667													26	104	---	---	---	---	capture	Silent	SNP	140250296	140250296	PCDHA11	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11424	37
PCDHGB5	56101	broad.mit.edu	37	5	140779096	140779096	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140779096G>A	uc003lkf.1	+	1	1402	c.1402G>A	c.(1402-1404)GCG>ACG	p.A468T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.A468T	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	468	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCTCCATCGCGCAAGTCTG	0.567													39	48	---	---	---	---	capture	Missense_Mutation	SNP	140779096	140779096	PCDHGB5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11469	37
RANBP17	64901	broad.mit.edu	37	5	170351426	170351426	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:170351426C>T	uc003mba.2	+	12	1356	c.1340C>T	c.(1339-1341)ACG>ATG	p.T447M	RANBP17_uc003max.1_RNA|RANBP17_uc003may.1_RNA|RANBP17_uc003maz.1_RNA|RANBP17_uc010jjr.1_RNA	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	447					mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAGTTGTGCACGGTCAGCAGA	0.413			T	TRD@	ALL								50	73	---	---	---	---	capture	Missense_Mutation	SNP	170351426	170351426	RANBP17	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12922	37
PKHD1	5314	broad.mit.edu	37	6	51890717	51890717	+	Silent	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51890717C>T	uc003pah.1	-	32	4167	c.3891G>A	c.(3889-3891)GCG>GCA	p.A1297A	PKHD1_uc003pai.2_Silent_p.A1297A	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1297	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GTGTTGCTGCCGCTTCATACA	0.547													48	66	---	---	---	---	capture	Silent	SNP	51890717	51890717	PKHD1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11874	37
ENPP1	5167	broad.mit.edu	37	6	132203516	132203516	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:132203516G>C	uc011ecf.1	+	21	2152	c.2132G>C	c.(2131-2133)TGT>TCT	p.C711S		NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	711	Nuclease.|Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TTCTCCAACTGTCTGTACCAG	0.383													6	168	---	---	---	---	capture	Missense_Mutation	SNP	132203516	132203516	ENPP1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	5084	37
BBS9	27241	broad.mit.edu	37	7	33397475	33397475	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:33397475C>T	uc003tdn.1	+	16	2074	c.1561C>T	c.(1561-1563)CGA>TGA	p.R521*	BBS9_uc003tdo.1_Nonsense_Mutation_p.R486*|BBS9_uc003tdp.1_Nonsense_Mutation_p.R516*|BBS9_uc003tdq.1_Nonsense_Mutation_p.R481*|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Nonsense_Mutation_p.R45*|BBS9_uc003tds.1_5'UTR|BBS9_uc011kao.1_Nonsense_Mutation_p.R399*	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	521					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			AGGCATTCCGCGAGTTATCCA	0.323									Bardet-Biedl_syndrome				83	253	---	---	---	---	capture	Nonsense_Mutation	SNP	33397475	33397475	BBS9	7	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	1331	37
AOAH	313	broad.mit.edu	37	7	36571797	36571797	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:36571797C>T	uc003tfh.3	-	18	1782	c.1381G>A	c.(1381-1383)GGC>AGC	p.G461S	AOAH_uc010kxf.2_Missense_Mutation_p.G461S|AOAH_uc011kba.1_Missense_Mutation_p.G429S	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	461					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						GACATCCAGCCGTGGCAGGGG	0.512													70	169	---	---	---	---	capture	Missense_Mutation	SNP	36571797	36571797	AOAH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	719	37
GPR141	353345	broad.mit.edu	37	7	37780909	37780909	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37780909G>T	uc003tfm.1	+	1	914	c.914G>T	c.(913-915)CGT>CTT	p.R305L	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	305	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity	p.R305H(1)		ovary(3)	3						GTTTTGTGCCGTTAGCCACAA	0.363													8	71	---	---	---	---	capture	Missense_Mutation	SNP	37780909	37780909	GPR141	7	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	6583	37
EPDR1	54749	broad.mit.edu	37	7	37989842	37989842	+	Silent	SNP	T	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37989842T>C	uc003tfp.2	+	3	898	c.879T>C	c.(877-879)TAT>TAC	p.Y293Y	EPDR1_uc003tfq.2_3'UTR|EPDR1_uc010kxh.2_Silent_p.Y112Y	NM_017549	NP_060019	Q9UM22	EPDR1_HUMAN	ependymin related protein 1 precursor	173					cell-matrix adhesion	extracellular region	calcium ion binding			upper_aerodigestive_tract(1)	1						AGGATTGCTATCCTGTCCAGG	0.388													23	123	---	---	---	---	capture	Silent	SNP	37989842	37989842	EPDR1	7	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	5118	37
VSTM2A	222008	broad.mit.edu	37	7	54612435	54612435	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:54612435G>A	uc010kzf.2	+	2	605	c.200G>A	c.(199-201)CGG>CAG	p.R67Q	VSTM2A_uc010kze.2_Missense_Mutation_p.R67Q|VSTM2A_uc003tqc.3_Missense_Mutation_p.R67Q	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	67	Ig-like V-type.					extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			TGGTTCCTGCGGGGGCCGGAG	0.716													18	46	---	---	---	---	capture	Missense_Mutation	SNP	54612435	54612435	VSTM2A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17111	37
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			30	484	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	37
EGFR	1956	broad.mit.edu	37	7	55233091	55233091	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233091G>A	uc003tqk.2	+	15	2087	c.1841G>A	c.(1840-1842)GGC>GAC	p.G614D	EGFR_uc003tqi.2_Missense_Mutation_p.G614D|EGFR_uc003tqj.2_Missense_Mutation_p.G614D|EGFR_uc010kzg.1_Missense_Mutation_p.G569D|EGFR_uc011kco.1_Missense_Mutation_p.G561D|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	614	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GCAGACGCCGGCCATGTGTGC	0.537		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			25	291	---	---	---	---	capture	Missense_Mutation	SNP	55233091	55233091	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4922	37
KIAA1324L	222223	broad.mit.edu	37	7	86548556	86548556	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86548556G>T	uc011kha.1	-	11	1655	c.1470C>A	c.(1468-1470)AAC>AAA	p.N490K	KIAA1324L_uc003uif.1_Missense_Mutation_p.N250K|KIAA1324L_uc011kgz.1_Missense_Mutation_p.N376K|KIAA1324L_uc003uie.2_Missense_Mutation_p.N323K	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1	490	Extracellular (Potential).					integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					GGATATGCAAGTTTAAGATCA	0.373													41	100	---	---	---	---	capture	Missense_Mutation	SNP	86548556	86548556	KIAA1324L	7	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	8146	37
FBXO24	26261	broad.mit.edu	37	7	100197689	100197689	+	Silent	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100197689C>T	uc003uvm.1	+	9	1535	c.1242C>T	c.(1240-1242)TGC>TGT	p.C414C	FBXO24_uc003uvn.1_Intron|uc011kjy.1_RNA|FBXO24_uc011kjz.1_Silent_p.C452C|FBXO24_uc011kka.1_Silent_p.C402C|PCOLCE_uc011kkb.1_5'Flank|PCOLCE_uc003uvo.2_5'Flank|PCOLCE_uc010lhb.1_5'Flank	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	414	RCC1.					ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCCTGTGGTGCGGCCTCAACC	0.692													6	19	---	---	---	---	capture	Silent	SNP	100197689	100197689	FBXO24	7	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	5681	37
SVOPL	136306	broad.mit.edu	37	7	138314843	138314843	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138314843G>T	uc011kqh.1	-	9	814	c.814C>A	c.(814-816)CTA>ATA	p.L272I	SVOPL_uc003vue.2_Missense_Mutation_p.L120I	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1	272						integral to membrane	transmembrane transporter activity				0						GCATCCAATAGGTCTGCAAAT	0.393													49	170	---	---	---	---	capture	Missense_Mutation	SNP	138314843	138314843	SVOPL	7	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	15312	37
NOS3	4846	broad.mit.edu	37	7	150699051	150699051	+	Missense_Mutation	SNP	C	T	T	rs142781987		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150699051C>T	uc003wif.2	+	13	1941	c.1645C>T	c.(1645-1647)CGG>TGG	p.R549W	NOS3_uc011kuy.1_Missense_Mutation_p.R343W|NOS3_uc011kuz.1_Missense_Mutation_p.R549W|NOS3_uc011kva.1_Missense_Mutation_p.R549W|NOS3_uc011kvb.1_Missense_Mutation_p.R549W	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	549	Flavodoxin-like.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	TTTTGATCCCCGGGTAGGGCT	0.612													77	144	---	---	---	---	capture	Missense_Mutation	SNP	150699051	150699051	NOS3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	10451	37
NEIL2	252969	broad.mit.edu	37	8	11643604	11643604	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11643604G>A	uc003wug.2	+	5	1496	c.821G>A	c.(820-822)GGC>GAC	p.G274D	NEIL2_uc003wue.2_Missense_Mutation_p.G274D|NEIL2_uc003wuf.2_Missense_Mutation_p.G213D|NEIL2_uc011kxd.1_Missense_Mutation_p.G158D	NM_145043	NP_659480	Q969S2	NEIL2_HUMAN	nei like 2 isoform a	274					base-excision repair|nucleotide-excision repair	nucleus	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|hydrolase activity, hydrolyzing N-glycosyl compounds|zinc ion binding				0	all_epithelial(15;0.103)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.166)		TGGCTGCAGGGCAAGTTCCAA	0.607								BER_DNA_glycosylases					4	179	---	---	---	---	capture	Missense_Mutation	SNP	11643604	11643604	NEIL2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10226	37
DOCK5	80005	broad.mit.edu	37	8	25191663	25191663	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25191663G>A	uc003xeg.2	+	21	2280	c.2143G>A	c.(2143-2145)GTA>ATA	p.V715I	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.V429I|DOCK5_uc003xei.2_Missense_Mutation_p.V285I|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	715						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TTTTAATCCTGTACTTGAAAC	0.368													109	136	---	---	---	---	capture	Missense_Mutation	SNP	25191663	25191663	DOCK5	8	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4646	37
TEX15	56154	broad.mit.edu	37	8	30700748	30700748	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30700748T>C	uc003xil.2	-	1	5786	c.5786A>G	c.(5785-5787)CAG>CGG	p.Q1929R		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1929										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATATATCTTCTGCAACTTAGA	0.358													65	104	---	---	---	---	capture	Missense_Mutation	SNP	30700748	30700748	TEX15	8	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	15664	37
ST18	9705	broad.mit.edu	37	8	53025895	53025895	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53025895G>A	uc003xqz.2	-	21	3163	c.3007C>T	c.(3007-3009)CCT>TCT	p.P1003S	ST18_uc011ldq.1_Missense_Mutation_p.P650S|ST18_uc011ldr.1_Missense_Mutation_p.P968S|ST18_uc011lds.1_Missense_Mutation_p.P908S|ST18_uc003xra.2_Missense_Mutation_p.P1003S	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	1003						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TCACTGATAGGTCCCTAAATG	0.463													57	68	---	---	---	---	capture	Missense_Mutation	SNP	53025895	53025895	ST18	8	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	15102	37
CPA6	57094	broad.mit.edu	37	8	68334862	68334862	+	Silent	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:68334862G>A	uc003xxq.3	-	11	1447	c.1191C>T	c.(1189-1191)TTC>TTT	p.F397F	CPA6_uc003xxr.3_Silent_p.F153F	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor	397					proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			CACGTAGTTCGAAAGCAAATG	0.383													72	91	---	---	---	---	capture	Silent	SNP	68334862	68334862	CPA6	8	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	3759	37
JPH1	56704	broad.mit.edu	37	8	75171694	75171694	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:75171694G>A	uc003yae.2	-	3	1224	c.1184C>T	c.(1183-1185)GCG>GTG	p.A395V	JPH1_uc003yaf.2_Missense_Mutation_p.A395V|JPH1_uc003yag.1_Missense_Mutation_p.A259V	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	395	Ala-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			AGCGGCCAGCGCGGCCTGGTC	0.597													25	21	---	---	---	---	capture	Missense_Mutation	SNP	75171694	75171694	JPH1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7883	37
RAD54B	25788	broad.mit.edu	37	8	95412584	95412584	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95412584C>T	uc003ygk.2	-	7	1150	c.1052G>A	c.(1051-1053)GGC>GAC	p.G351D	RAD54B_uc010may.1_Missense_Mutation_p.G158D|RAD54B_uc003ygl.1_RNA	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:Variant_position_missing_in_O95073_after_alignment					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TACTGGCTTGCCTCCATAGGG	0.433								Direct_reversal_of_damage|Homologous_recombination					4	91	---	---	---	---	capture	Missense_Mutation	SNP	95412584	95412584	RAD54B	8	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12887	37
TRPS1	7227	broad.mit.edu	37	8	116616647	116616647	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:116616647C>G	uc003ynz.2	-	3	1969	c.1510G>C	c.(1510-1512)GGG>CGG	p.G504R	TRPS1_uc011lhy.1_Missense_Mutation_p.G508R|TRPS1_uc003yny.2_Missense_Mutation_p.G517R|TRPS1_uc010mcy.2_Missense_Mutation_p.G504R	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	504					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TTTTTAGCCCCACTCGAGCTC	0.438									Langer-Giedion_syndrome				46	174	---	---	---	---	capture	Missense_Mutation	SNP	116616647	116616647	TRPS1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	16476	37
VAV2	7410	broad.mit.edu	37	9	136653541	136653541	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136653541C>T	uc004ces.2	-	15	1388	c.1342G>A	c.(1342-1344)GAG>AAG	p.E448K	VAV2_uc004cer.2_Missense_Mutation_p.E443K|VAV2_uc004cet.1_5'UTR	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	448	PH.				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TCGATGATCTCCTTGAGCTCG	0.592													68	74	---	---	---	---	capture	Missense_Mutation	SNP	136653541	136653541	VAV2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	17014	37
AMELX	265	broad.mit.edu	37	X	11316747	11316747	+	Missense_Mutation	SNP	C	T	T	rs148259441		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11316747C>T	uc004cut.2	+	5	292	c.224C>T	c.(223-225)CCG>CTG	p.P75L	ARHGAP6_uc004cup.1_Intron|ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_Missense_Mutation_p.P89L|AMELX_uc004cuu.2_Missense_Mutation_p.P59L	NM_001142	NP_001133	Q99217	AMELX_HUMAN	amelogenin (X chromosome) isoform 1 precursor	75					cell adhesion|cell proliferation|chondrocyte differentiation|enamel mineralization|epithelial to mesenchymal transition|ion homeostasis|odontogenesis of dentine-containing tooth|osteoblast differentiation|positive regulation of collagen biosynthetic process|positive regulation of tooth mineralization|signal transduction	proteinaceous extracellular matrix	cell surface binding|growth factor activity|hydroxyapatite binding|identical protein binding|structural constituent of tooth enamel				0						CAGCACCCCCCGACTCACACC	0.602													9	117	---	---	---	---	capture	Missense_Mutation	SNP	11316747	11316747	AMELX	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	569	37
ZCCHC16	340595	broad.mit.edu	37	X	111698312	111698312	+	Missense_Mutation	SNP	G	C	C	rs149089921		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:111698312G>C	uc004epo.1	+	3	797	c.356G>C	c.(355-357)AGT>ACT	p.S119T		NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	119							nucleic acid binding|zinc ion binding			ovary(1)	1						CCTGACAAGAGTACCTTACTG	0.383													101	6	---	---	---	---	capture	Missense_Mutation	SNP	111698312	111698312	ZCCHC16	23	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	17464	37
DCAF12L2	340578	broad.mit.edu	37	X	125299765	125299765	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125299765C>T	uc004euk.1	-	1	170	c.143G>A	c.(142-144)CGT>CAT	p.R48H		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	48										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						CAGCCTGCGACGCGTCGCCGG	0.731													9	1	---	---	---	---	capture	Missense_Mutation	SNP	125299765	125299765	DCAF12L2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4224	37
AFF2	2334	broad.mit.edu	37	X	147967460	147967460	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:147967460A>G	uc004fcp.2	+	8	1783	c.1304A>G	c.(1303-1305)GAC>GGC	p.D435G	AFF2_uc004fco.2_Missense_Mutation_p.D396G|AFF2_uc004fcq.2_Missense_Mutation_p.D425G|AFF2_uc004fcr.2_Missense_Mutation_p.D396G|AFF2_uc011mxb.1_Missense_Mutation_p.D400G|AFF2_uc004fcs.2_Missense_Mutation_p.D402G|AFF2_uc011mxc.1_Missense_Mutation_p.D76G	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	435					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					GATGAAGATGACCTTGAGCCT	0.483													236	31	---	---	---	---	capture	Missense_Mutation	SNP	147967460	147967460	AFF2	23	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	357	37
TGIF2LY	90655	broad.mit.edu	37	Y	3447632	3447632	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:3447632G>A	uc004fqk.2	+	2	411	c.347G>A	c.(346-348)CGT>CAT	p.R116H		NM_139214	NP_631960	Q8IUE0	TF2LY_HUMAN	TGFB-induced factor homeobox 2-like, Y-linked	116						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTTCAACAGCGTAGAAACGAC	0.527													103	8	---	---	---	---	capture	Missense_Mutation	SNP	3447632	3447632	TGIF2LY	24	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15713	37
TAS1R1	80835	broad.mit.edu	37	1	6638981	6638982	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6638981_6638982insT	uc001ant.2	+	6	1863_1864	c.1863_1864insT	c.(1861-1866)GGCTTCfs	p.G621fs	TAS1R1_uc001anu.2_Frame_Shift_Ins_p.G367fs|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_3'UTR|ZBTB48_uc009vmc.1_5'Flank|ZBTB48_uc001anx.2_5'Flank|ZBTB48_uc009vmd.1_5'Flank	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	621_622	Helical; Name=2; (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GCCTCTATGGCTTCTTTGGGGA	0.599													9	113	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	6638981	6638982	TAS1R1	1	-	T	T	T	1	0	1	1	0	0	0	0	0	353	28	5	5	15450	37
SLC25A34	284723	broad.mit.edu	37	1	16065774	16065775	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16065774_16065775insC	uc001axb.1	+	5	960_961	c.788_789insC	c.(787-789)GGCfs	p.G263fs	SLC25A34_uc009vok.1_RNA	NM_207348	NP_997231	Q6PIV7	S2534_HUMAN	solute carrier family 25, member 34	263	Solcar 3.				transport	integral to membrane|mitochondrial inner membrane					0		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CGGCAGGAGGGCCCCCTGGCAC	0.649													7	176	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	16065774	16065775	SLC25A34	1	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	14390	37
MACF1	23499	broad.mit.edu	37	1	39799059	39799060	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39799059_39799060insG	uc010oiu.1	+	1	2250_2251	c.2119_2120insG	c.(2119-2121)AGGfs	p.R707fs	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2272					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGATAGTGGCAGGGAAATTTTT	0.391													12	180	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	39799059	39799060	MACF1	1	-	G	G	G	1	0	1	1	0	0	0	0	0	88	7	5	5	9059	37
TOE1	114034	broad.mit.edu	37	1	45808763	45808764	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45808763_45808764insG	uc009vxq.2	+	8	1505_1506	c.922_923insG	c.(922-924)TGGfs	p.W308fs	MUTYH_uc001cnj.2_5'Flank|MUTYH_uc001cni.2_5'Flank|MUTYH_uc001cnh.2_5'Flank|MUTYH_uc001cno.2_5'Flank|MUTYH_uc001cnk.2_5'Flank|MUTYH_uc010oll.1_5'Flank|MUTYH_uc001cnm.2_5'Flank|MUTYH_uc001cnl.2_5'Flank|MUTYH_uc009vxp.2_5'Flank|MUTYH_uc001cnn.2_5'Flank|TOE1_uc001cnq.3_RNA|TOE1_uc010olm.1_Frame_Shift_Ins_p.W228fs|TOE1_uc001cnr.3_RNA	NM_025077	NP_079353	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	308	C3H1-type.					nuclear speck|nucleolus	nucleic acid binding|zinc ion binding			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)					GGCTTATGGCTGGTGCCCCCTG	0.569													7	287	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	45808763	45808764	TOE1	1	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	16232	37
SYCP1	6847	broad.mit.edu	37	1	115537600	115537601	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115537600_115537601insA	uc001efr.2	+	32	3100_3101	c.2891_2892insA	c.(2890-2892)AGAfs	p.R964fs	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Frame_Shift_Ins_p.R964fs|SYCP1_uc009wgw.2_Frame_Shift_Ins_p.R939fs	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	964	Arg/Lys-rich (basic).				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATGGATAGAAAAAAAAAAC	0.356													7	139	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	115537600	115537601	SYCP1	1	-	A	A	A	1	0	1	1	0	0	0	0	0	429	33	5	5	15319	37
CD248	57124	broad.mit.edu	37	11	66084227	66084228	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66084227_66084228insC	uc001ohm.1	-	1	288_289	c.271_272insG	c.(271-273)GCCfs	p.A91fs		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	91	C-type lectin.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)	GCATTGCCGGGCCTGCCGCTGC	0.723													8	43	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	66084227	66084228	CD248	11	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	2960	37
HECTD1	25831	broad.mit.edu	37	14	31582555	31582555	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31582555delC	uc001wrc.1	-	33	6481	c.5992delG	c.(5992-5994)GAAfs	p.E1998fs	HECTD1_uc001wra.1_Frame_Shift_Del_p.E124fs|HECTD1_uc001wrb.1_Frame_Shift_Del_p.E124fs|HECTD1_uc001wrd.1_Frame_Shift_Del_p.E1466fs	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	1998					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AGGACATCTTCTACTCCACAA	0.403													215	249	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	31582555	31582555	HECTD1	14	C	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	6965	37
ADPGK	83440	broad.mit.edu	37	15	73044826	73044827	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:73044826_73044827insT	uc002avg.3	-	7	1443_1444	c.1349_1350insA	c.(1348-1350)AAGfs	p.K450fs	ADPGK_uc002ave.3_Frame_Shift_Ins_p.K175fs|ADPGK_uc010ukw.1_Frame_Shift_Ins_p.K392fs|ADPGK_uc002avf.3_Frame_Shift_Ins_p.K449fs|ADPGK_uc002avi.3_Frame_Shift_Ins_p.K327fs|ADPGK_uc002avh.3_Frame_Shift_Ins_p.K211fs	NM_031284	NP_112574	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	450	ADPK.				glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding				0						CTACTACTGGCTTGTTTGGGTT	0.490													10	255	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	73044826	73044827	ADPGK	15	-	T	T	T	1	0	1	1	0	0	0	0	0	363	28	5	5	330	37
LAMA3	3909	broad.mit.edu	37	18	21511088	21511089	+	Frame_Shift_Ins	INS	-	G	G	rs1154233	by1000genomes	TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21511088_21511089insG	uc002kuq.2	+	65	8585_8586	c.8499_8500insG	c.(8497-8502)GGCAGCfs	p.G2833fs	LAMA3_uc002kur.2_Frame_Shift_Ins_p.G2777fs|LAMA3_uc002kus.3_Frame_Shift_Ins_p.G1224fs|LAMA3_uc002kut.3_Frame_Shift_Ins_p.G1168fs	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	2833_2834	Laminin G-like 3.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCGATAGCGGCAGCCCAATTTT	0.411													8	246	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	21511088	21511089	LAMA3	18	-	G	G	G	1	0	1	1	0	0	0	0	0	314	25	5	5	8527	37
CNN2	1265	broad.mit.edu	37	19	1037646	1037646	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1037646delC	uc002lqu.2	+	7	1040	c.677delC	c.(676-678)ACCfs	p.T226fs	ABCA7_uc002lqw.3_5'Flank|CNN2_uc002lqv.2_Frame_Shift_Del_p.T187fs|CNN2_uc010xgb.1_Frame_Shift_Del_p.T215fs|CNN2_uc010xgc.1_Frame_Shift_Del_p.T247fs|ABCA7_uc010dsa.2_5'Flank	NM_004368	NP_004359	Q99439	CNN2_HUMAN	calponin 2 isoform a	226	Calponin-like 2.				actomyosin structure organization|cellular response to mechanical stimulus|regulation of actin filament-based process	cell-cell junction|stress fiber	actin binding|calmodulin binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCCGGGACCCGGCGGCAC	0.552													8	516	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	1037646	1037646	CNN2	19	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	3575	37
STRN	6801	broad.mit.edu	37	2	37121134	37121153	+	Frame_Shift_Del	DEL	CTCGATCTTCACCGCTGTCA	-	-			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37121134_37121153delCTCGATCTTCACCGCTGTCA	uc002rpn.2	-	7	828_847	c.819_838delTGACAGCGGTGAAGATCGAG	c.(817-840)CCTGACAGCGGTGAAGATCGAGATfs	p.P273fs	STRN_uc010ezx.2_Frame_Shift_Del_p.P273fs	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	273_280					dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				TCTTTTGTATCTCGATCTTCACCGCTGTCAGGCAATGCTT	0.368													57	166	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	37121134	37121153	STRN	2	CTCGATCTTCACCGCTGTCA	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	15219	37
SLC5A3	6526	broad.mit.edu	37	21	35468403	35468404	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35468403_35468404insG	uc002yto.2	+	2	1418_1419	c.906_907insG	c.(904-909)GCTGGCfs	p.A302fs	MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864	P53794	SC5A3_HUMAN	solute carrier family 5 (inositol transporters),	302_303	Cytoplasmic (Potential).					integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2						CTCTTATGGCTGGCTTCTTAAA	0.470													7	353	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	35468403	35468404	SLC5A3	21	-	G	G	G	1	0	1	1	0	0	0	0	0	704	55	5	5	14558	37
MICAL3	57553	broad.mit.edu	37	22	18301237	18301238	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:18301237_18301238insC	uc002zng.3	-	26	4542_4543	c.4189_4190insG	c.(4189-4191)GAGfs	p.E1397fs	MICAL3_uc011agl.1_Frame_Shift_Ins_p.E1313fs|MICAL3_uc010gre.1_5'Flank	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	1397	Pro-rich.					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		GGACAACGGCTCGCCTTCCGGC	0.644													7	342	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	18301237	18301238	MICAL3	22	-	C	C	C	1	0	1	1	0	0	0	0	0	702	54	5	5	9483	37
TUBB4Q	56604	broad.mit.edu	37	4	190904151	190904152	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:190904151_190904152insG	uc011clg.1	-	4	831_832	c.828_829insC	c.(826-831)GGCAGCfs	p.G276fs		NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q	277_278					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)		TACTGCTGGCTGCCCCGGCTGG	0.614													11	24	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	190904151	190904152	TUBB4Q	4	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	16641	37
FAM53C	51307	broad.mit.edu	37	5	137680780	137680781	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137680780_137680781insG	uc003lcv.2	+	4	873_874	c.403_404insG	c.(403-405)CGGfs	p.R135fs	FAM53C_uc003lcw.2_Frame_Shift_Ins_p.R135fs|FAM53C_uc011cyq.1_Intron|FAM53C_uc011cyr.1_Intron	NM_001135647	NP_001129119	Q9NYF3	FA53C_HUMAN	hypothetical protein LOC51307	135										ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCCGGTGTGGCGGCCCGCCCCC	0.683													8	210	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	137680780	137680781	FAM53C	5	-	G	G	G	1	0	1	1	0	0	0	0	0	347	27	5	5	5529	37
DMRTA1	63951	broad.mit.edu	37	9	22447335	22447336	+	Frame_Shift_Ins	INS	-	A	A	rs111465355		TCGA-06-0174-01	TCGA-06-0174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:22447335_22447336insA	uc003zpp.1	+	1	496_497	c.271_272insA	c.(271-273)TACfs	p.Y91fs		NM_022160	NP_071443	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	91					cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|skin(1)	2		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		GGGCTGCGGCTACCCGCGGACG	0.624													2	4	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	22447335	22447336	DMRTA1	9	-	A	A	A	1	0	1	1	0	0	0	0	0	689	53	5	5	4546	37
