Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SLC45A1	50651	broad.mit.edu	37	1	8390537	8390537	+	Silent	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8390537G>A	uc001apb.2	+	4	984	c.984G>A	c.(982-984)TCG>TCA	p.S328S	SLC45A1_uc001apc.2_Silent_p.S26S	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	328					carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTCCCGTCGCACACGGCCA	0.697													23	25	---	---	---	---	capture	Silent	SNP	8390537	8390537	SLC45A1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14532	41
KLHDC7A	127707	broad.mit.edu	37	1	18809465	18809465	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:18809465G>A	uc001bax.2	+	1	2042	c.1990G>A	c.(1990-1992)GGC>AGC	p.G664S	KLHDC7A_uc009vpg.2_Missense_Mutation_p.G446S	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	664	Kelch 5.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCACCGGGGGCAGCAAGGA	0.682													11	42	---	---	---	---	capture	Missense_Mutation	SNP	18809465	18809465	KLHDC7A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	8280	41
FAM54B	56181	broad.mit.edu	37	1	26156090	26156090	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26156090C>T	uc001bkq.3	+	6	752	c.542C>T	c.(541-543)ACA>ATA	p.T181I	FAM54B_uc001bkr.3_Intron|FAM54B_uc010oet.1_Missense_Mutation_p.T214I|FAM54B_uc009vrz.2_Missense_Mutation_p.T166I|FAM54B_uc001bks.3_Missense_Mutation_p.T181I|FAM54B_uc001bkt.3_Missense_Mutation_p.T181I|FAM54B_uc001bku.3_Intron|FAM54B_uc001bkv.3_Missense_Mutation_p.T84I	NM_001099625	NP_001093095	Q9H019	FA54B_HUMAN	hypothetical protein LOC56181 isoform a	181										pancreas(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.96e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.00095)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0649)		TTCCACTCTACAACTTCCTTT	0.478													117	221	---	---	---	---	capture	Missense_Mutation	SNP	26156090	26156090	FAM54B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	5531	41
CYB5RL	606495	broad.mit.edu	37	1	54653374	54653374	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:54653374G>A	uc009vzo.2	-	5	706	c.386C>T	c.(385-387)ACG>ATG	p.T129M	CYB5RL_uc001cww.2_Translation_Start_Site|CYB5RL_uc001cwx.3_RNA|CYB5RL_uc001cwy.3_Translation_Start_Site	NM_001031672	NP_001026842	Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	129	FAD-binding FR-type.						cytochrome-b5 reductase activity				0						GCTGATGGGCGTATAGGCTCT	0.448													4	138	---	---	---	---	capture	Missense_Mutation	SNP	54653374	54653374	CYB5RL	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4090	41
TCHH	7062	broad.mit.edu	37	1	152081632	152081632	+	Missense_Mutation	SNP	C	T	T	rs2496251		TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152081632C>T	uc001ezp.2	-	2	4061	c.4061G>A	c.(4060-4062)CGC>CAC	p.R1354H	TCHH_uc009wne.1_Missense_Mutation_p.R1354H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1354	23 X 26 AA approximate tandem repeats.			R -> L (in Ref. 1; AAA65582).	keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTTGGCGGCGCAGCGGCTG	0.567													131	167	---	---	---	---	capture	Missense_Mutation	SNP	152081632	152081632	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15585	41
RYR2	6262	broad.mit.edu	37	1	237608770	237608770	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237608770C>T	uc001hyl.1	+	14	1360	c.1240C>T	c.(1240-1242)CGC>TGC	p.R414C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	414	Cytoplasmic (By similarity).		R -> L (in CPVT1).		cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGAAGAATCACGCACAGCCCG	0.393													65	99	---	---	---	---	capture	Missense_Mutation	SNP	237608770	237608770	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13661	41
MMP26	56547	broad.mit.edu	37	11	5013297	5013297	+	Silent	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5013297C>T	uc001lzv.2	+	5	717	c.699C>T	c.(697-699)CAC>CAT	p.H233H		NM_021801	NP_068573	Q9NRE1	MMP26_HUMAN	matrix metalloproteinase 26 preproprotein	233					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)		ACTGGTATCACGACCCTAGAA	0.488													54	49	---	---	---	---	capture	Silent	SNP	5013297	5013297	MMP26	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9575	41
OR52L1	338751	broad.mit.edu	37	11	6007615	6007615	+	Silent	SNP	T	C	C			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6007615T>C	uc001mcd.2	-	1	601	c.546A>G	c.(544-546)GGA>GGG	p.G182G		NM_001005173	NP_001005173	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGATAAGTTTTCCCAACAAAA	0.488													8	155	---	---	---	---	capture	Silent	SNP	6007615	6007615	OR52L1	11	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	11029	41
MAP4K2	5871	broad.mit.edu	37	11	64568434	64568434	+	Silent	SNP	C	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64568434C>G	uc001obh.2	-	9	692	c.600G>C	c.(598-600)CTG>CTC	p.L200L	MAP4K2_uc001obi.2_Silent_p.L200L	NM_004579	NP_004570	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase	200	Protein kinase.				activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(1)|pancreas(1)	2						CAGTGATGCCCAGGGCCCAGA	0.622													33	104	---	---	---	---	capture	Silent	SNP	64568434	64568434	MAP4K2	11	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	9174	41
PTPRB	5787	broad.mit.edu	37	12	70986066	70986066	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70986066T>G	uc001swb.3	-	5	1152	c.1122A>C	c.(1120-1122)AGA>AGC	p.R374S	PTPRB_uc010sto.1_Missense_Mutation_p.R374S|PTPRB_uc010stp.1_Missense_Mutation_p.R374S|PTPRB_uc001swc.3_Missense_Mutation_p.R592S|PTPRB_uc001swa.3_Missense_Mutation_p.R592S|PTPRB_uc001swd.3_Missense_Mutation_p.R591S|PTPRB_uc009zrr.1_Missense_Mutation_p.R471S|PTPRB_uc001swe.2_Missense_Mutation_p.R592S	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	374	Fibronectin type-III 4.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACTCACATGTTCTGCCCACTG	0.448													60	91	---	---	---	---	capture	Missense_Mutation	SNP	70986066	70986066	PTPRB	12	T	G	G	G	1	0	0	0	0	1	0	0	0	803	62	4	4	12691	41
ACADS	35	broad.mit.edu	37	12	121176678	121176678	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121176678G>A	uc001tza.3	+	8	1107	c.989G>A	c.(988-990)CGC>CAC	p.R330H	ACADS_uc010szl.1_Missense_Mutation_p.R326H|ACADS_uc001tzb.3_Missense_Mutation_p.R211H	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	330						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	CTGACCTGGCGCGCTGCCATG	0.642													33	80	---	---	---	---	capture	Missense_Mutation	SNP	121176678	121176678	ACADS	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	114	41
RB1	5925	broad.mit.edu	37	13	48953730	48953730	+	Nonsense_Mutation	SNP	C	T	T	rs3092891		TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48953730C>T	uc001vcb.2	+	14	1499	c.1333C>T	c.(1333-1335)CGA>TGA	p.R445*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	445	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.R445*(2)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTGTTTGTAGCGATACAAACT	0.204		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			5	40	---	---	---	---	capture	Nonsense_Mutation	SNP	48953730	48953730	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	12993	41
GOLGA6D	653643	broad.mit.edu	37	15	75580661	75580661	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75580661C>T	uc010uma.1	+	7	555	c.520C>T	c.(520-522)CGG>TGG	p.R174W	uc010umb.1_5'Flank	NM_001145224	NP_001138696	P0CG33	GOG6D_HUMAN	golgi autoantigen, golgin subfamily a, 6D	174	Potential.										0						AGAATTGGAGCGGGCTCTCTG	0.552													47	70	---	---	---	---	capture	Missense_Mutation	SNP	75580661	75580661	GOLGA6D	15	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	6496	41
DECR2	26063	broad.mit.edu	37	16	455001	455001	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:455001C>G	uc002chb.2	+	2	232	c.126C>G	c.(124-126)TTC>TTG	p.F42L	DECR2_uc002chc.2_5'UTR|DECR2_uc010bqv.2_5'UTR|DECR2_uc002chd.2_5'UTR|DECR2_uc002che.1_5'Flank	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2	42	NADP (By similarity).					peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				GGATTGGGTTCCGGATTGCTG	0.517													70	133	---	---	---	---	capture	Missense_Mutation	SNP	455001	455001	DECR2	16	C	G	G	G	1	0	0	0	0	1	0	0	0	389	30	4	4	4341	41
ITGAM	3684	broad.mit.edu	37	16	31284722	31284722	+	Silent	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31284722G>A	uc002ebq.2	+	8	839	c.741G>A	c.(739-741)AAG>AAA	p.K247K	ITGAM_uc002ebr.2_Silent_p.K247K|ITGAM_uc010cam.1_5'Flank	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	247	VWFA.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						GAGCCCGAAAGAATGCCTTTA	0.453													58	96	---	---	---	---	capture	Silent	SNP	31284722	31284722	ITGAM	16	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	7810	41
ITGAM	3684	broad.mit.edu	37	16	31286937	31286937	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31286937G>A	uc002ebq.2	+	9	1024	c.926G>A	c.(925-927)CGT>CAT	p.R309H	ITGAM_uc002ebr.2_Missense_Mutation_p.R309H|ITGAM_uc010cam.1_Translation_Start_Site	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	309	VWFA.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						AAGCCGCCTCGTGATCACGTG	0.512													38	46	---	---	---	---	capture	Missense_Mutation	SNP	31286937	31286937	ITGAM	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7810	41
ATP2A3	489	broad.mit.edu	37	17	3850757	3850757	+	Silent	SNP	G	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3850757G>T	uc002fxb.1	-	8	1174	c.1023C>A	c.(1021-1023)ACC>ACA	p.T341T	ATP2A3_uc002fwx.1_Silent_p.T341T|ATP2A3_uc002fwy.1_Silent_p.T341T|ATP2A3_uc002fwz.1_Silent_p.T341T|ATP2A3_uc002fxa.1_Silent_p.T341T|ATP2A3_uc002fxc.1_Silent_p.T341T|ATP2A3_uc002fxd.1_Silent_p.T341T	NM_174955	NP_777615	Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous isoform b	341	Cytoplasmic (By similarity).				ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		TGCAGCCCAGGGTCTCCACGG	0.647													34	45	---	---	---	---	capture	Silent	SNP	3850757	3850757	ATP2A3	17	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	1129	41
TP53	7157	broad.mit.edu	37	17	7576926	7576927	+	Splice_Site	DNP	GC	AT	AT			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7576926_7576927GC>AT	uc002gim.2	-	9	1114	c.920_splice	c.e9-1	p.A307_splice	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Splice_Site_p.A307_splice|TP53_uc010cne.1_5'UTR|TP53_uc010cnf.1_Splice_Site_p.A175_splice|TP53_uc010cng.1_Splice_Site_p.A175_splice|TP53_uc002gii.1_Splice_Site_p.A175_splice|TP53_uc010cnh.1_Splice_Site_p.A307_splice|TP53_uc010cni.1_Splice_Site_p.A307_splice|TP53_uc002gij.2_Splice_Site_p.A307_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(16)|p.0?(7)|p.A307fs*34(1)|p.L308fs*31(1)|p.A307V(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTTGGGCAGTGCTAGGAAAGAG	0.490		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			40	68	---	---	---	---	capture	Splice_Site	DNP	7576926	7576927	TP53	17	GC	AT	AT	AT	1	0	0	0	0	0	0	1	0	598	46	5	2	16264	41
MYH8	4626	broad.mit.edu	37	17	10315706	10315706	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10315706G>A	uc002gmm.2	-	14	1492	c.1397C>T	c.(1396-1398)GCT>GTT	p.A466V	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	466	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TTCAAAGCCAGCAATGTCCAA	0.438									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				152	95	---	---	---	---	capture	Missense_Mutation	SNP	10315706	10315706	MYH8	17	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	9951	41
ACSF2	80221	broad.mit.edu	37	17	48540562	48540562	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48540562A>G	uc002iqu.2	+	7	942	c.838A>G	c.(838-840)ATT>GTT	p.I280V	ACSF2_uc010wml.1_Missense_Mutation_p.I237V|ACSF2_uc010wmm.1_Missense_Mutation_p.I305V|ACSF2_uc010wmn.1_Missense_Mutation_p.I267V|ACSF2_uc010wmo.1_Missense_Mutation_p.I120V	NM_025149	NP_079425	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2 precursor	280					fatty acid metabolic process	mitochondrion	ATP binding|ligase activity				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CCACTACAACATTGTCAACAA	0.597													110	189	---	---	---	---	capture	Missense_Mutation	SNP	48540562	48540562	ACSF2	17	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	175	41
RAVER1	125950	broad.mit.edu	37	19	10434237	10434237	+	Silent	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10434237C>T	uc002moa.2	-	4	893	c.813G>A	c.(811-813)GCG>GCA	p.A271A		NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	254	RRM 3.					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			CCTGGCCGCACGCCAGCTGCC	0.652													14	20	---	---	---	---	capture	Silent	SNP	10434237	10434237	RAVER1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	12989	41
SLC5A7	60482	broad.mit.edu	37	2	108626770	108626770	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108626770C>T	uc002tdv.2	+	9	1472	c.1196C>T	c.(1195-1197)ACG>ATG	p.T399M	SLC5A7_uc010ywm.1_Missense_Mutation_p.T152M|SLC5A7_uc010fjj.2_Missense_Mutation_p.T399M|SLC5A7_uc010ywn.1_Missense_Mutation_p.T286M	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	399	Cytoplasmic (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	GCCTTGCTGACGAAAACTGTG	0.463													29	93	---	---	---	---	capture	Missense_Mutation	SNP	108626770	108626770	SLC5A7	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14562	41
LRP2	4036	broad.mit.edu	37	2	170007505	170007505	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170007505G>A	uc002ues.2	-	68	12706	c.12493C>T	c.(12493-12495)CGC>TGC	p.R4165C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4165	Extracellular (Potential).|LDL-receptor class B 35.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACCTCAATGCGTTTATTCTTG	0.428													71	124	---	---	---	---	capture	Missense_Mutation	SNP	170007505	170007505	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8872	41
TTN	7273	broad.mit.edu	37	2	179498764	179498764	+	Silent	SNP	T	C	C			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179498764T>C	uc010zfg.1	-	180	34982	c.34758A>G	c.(34756-34758)AAA>AAG	p.K11586K	TTN_uc010zfh.1_Silent_p.K5281K|TTN_uc010zfi.1_Silent_p.K5214K|TTN_uc010zfj.1_Silent_p.K5089K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12513							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCACCTTCTTTTACTGTTT	0.358													90	111	---	---	---	---	capture	Silent	SNP	179498764	179498764	TTN	2	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	16617	41
DNAJC10	54431	broad.mit.edu	37	2	183584858	183584858	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:183584858G>A	uc002uow.1	+	4	744	c.329G>A	c.(328-330)GGC>GAC	p.G110D	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Missense_Mutation_p.G110D|DNAJC10_uc010fro.1_RNA	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	110					apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AATCAAGGTGGCCAGTATGAA	0.308													45	100	---	---	---	---	capture	Missense_Mutation	SNP	183584858	183584858	DNAJC10	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4585	41
TNS1	7145	broad.mit.edu	37	2	218712554	218712554	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:218712554G>A	uc002vgt.2	-	17	2709	c.2311C>T	c.(2311-2313)CAT>TAT	p.H771Y	TNS1_uc002vgr.2_Missense_Mutation_p.H771Y|TNS1_uc002vgs.2_Missense_Mutation_p.H771Y|TNS1_uc010zjv.1_Missense_Mutation_p.H771Y|TNS1_uc010fvj.1_Missense_Mutation_p.H839Y|TNS1_uc010fvk.1_Missense_Mutation_p.H896Y|TNS1_uc010fvi.1_Missense_Mutation_p.H458Y	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	771						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CCCAACGAATGCCCACTGGGG	0.607													29	42	---	---	---	---	capture	Missense_Mutation	SNP	218712554	218712554	TNS1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	16226	41
ABCB6	10058	broad.mit.edu	37	2	220080773	220080773	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220080773C>T	uc002vkc.1	-	5	1377	c.1100G>A	c.(1099-1101)GGG>GAG	p.G367E	ABCB6_uc010fwe.1_Missense_Mutation_p.G321E|ABCB6_uc010zku.1_Intron	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	367	ABC transmembrane type-1.				cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGCACCTCCCCTGTGCGGCG	0.672													10	7	---	---	---	---	capture	Missense_Mutation	SNP	220080773	220080773	ABCB6	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	45	41
ITSN1	6453	broad.mit.edu	37	21	35230998	35230998	+	Silent	SNP	A	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35230998A>G	uc002yta.1	+	31	4060	c.3792A>G	c.(3790-3792)CAA>CAG	p.Q1264Q	DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Silent_p.Q1259Q|ITSN1_uc002ytj.2_Silent_p.Q1259Q|ITSN1_uc010gmm.1_RNA	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	1264	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						AGATTTTTCAAAAACCCCTGA	0.428													10	117	---	---	---	---	capture	Silent	SNP	35230998	35230998	ITSN1	21	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	7849	41
UMODL1	89766	broad.mit.edu	37	21	43524017	43524017	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43524017C>T	uc002zaf.1	+	9	1339	c.1339C>T	c.(1339-1341)CGA>TGA	p.R447*	UMODL1_uc002zad.1_Nonsense_Mutation_p.R375*|UMODL1_uc002zae.1_Nonsense_Mutation_p.R375*|UMODL1_uc002zag.1_Nonsense_Mutation_p.R447*|UMODL1_uc010gow.1_Nonsense_Mutation_p.R239*|UMODL1_uc002zai.1_Nonsense_Mutation_p.R98*|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_Nonsense_Mutation_p.R98*|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Nonsense_Mutation_p.R192*|C21orf128_uc002zak.2_Silent_p.S72S	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	447	Extracellular (Potential).|SEA 1.		R -> Q.			cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						TGACTTGTACCGAAGTGGGAA	0.562													48	110	---	---	---	---	capture	Nonsense_Mutation	SNP	43524017	43524017	UMODL1	21	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	16862	41
KRTAP10-3	386682	broad.mit.edu	37	21	45978434	45978434	+	Silent	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45978434G>A	uc002zfj.1	-	1	210	c.165C>T	c.(163-165)AGC>AGT	p.S55S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	55	18 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						GGCAGCAGGGGCTGGACACAC	0.652													7	70	---	---	---	---	capture	Silent	SNP	45978434	45978434	KRTAP10-3	21	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	8430	41
LZTR1	8216	broad.mit.edu	37	22	21351542	21351542	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21351542C>T	uc002zto.2	+	21	2531	c.2428C>T	c.(2428-2430)CGG>TGG	p.R810W	LZTR1_uc002ztn.2_Missense_Mutation_p.R769W|LZTR1_uc011ahy.1_Missense_Mutation_p.R791W|LZTR1_uc002ztp.2_3'UTR	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	810					anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GCCCACCCTGCGGTCGCTGAG	0.642													27	15	---	---	---	---	capture	Missense_Mutation	SNP	21351542	21351542	LZTR1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	9052	41
KDR	3791	broad.mit.edu	37	4	55976857	55976857	+	Missense_Mutation	SNP	G	A	A	rs151317075	byFrequency	TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55976857G>A	uc003has.2	-	8	1357	c.1055C>T	c.(1054-1056)GCG>GTG	p.A352V	KDR_uc003hat.1_Missense_Mutation_p.A352V|KDR_uc011bzx.1_Missense_Mutation_p.A352V	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	352	Ig-like C2-type 4.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	p.A352V(1)		lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	AAGGTACTTCGCAGGGATTCT	0.413			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			55	137	---	---	---	---	capture	Missense_Mutation	SNP	55976857	55976857	KDR	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8061	41
UGT2B11	10720	broad.mit.edu	37	4	70079996	70079996	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70079996A>G	uc003heh.2	-	1	454	c.445T>C	c.(445-447)TTT>CTT	p.F149L	uc003hei.1_Intron	NM_001073	NP_001064	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family,	149					estrogen metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						GCATCTGCAAAAACGATGTCA	0.383													74	93	---	---	---	---	capture	Missense_Mutation	SNP	70079996	70079996	UGT2B11	4	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	16839	41
UGT2B28	54490	broad.mit.edu	37	4	70156481	70156481	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70156481C>T	uc003hej.2	+	5	1264	c.1262C>T	c.(1261-1263)TCG>TTG	p.S421L	UGT2B28_uc010ihr.2_Intron	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	421					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	CACACAATGTCGAGTACAGAC	0.423													82	140	---	---	---	---	capture	Missense_Mutation	SNP	70156481	70156481	UGT2B28	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16842	41
TACR3	6870	broad.mit.edu	37	4	104511030	104511030	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104511030C>T	uc003hxe.1	-	5	1350	c.1207G>A	c.(1207-1209)GTG>ATG	p.V403M		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	403	Cytoplasmic (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		ATTCTGGTCACGGTGTACATA	0.498													136	219	---	---	---	---	capture	Missense_Mutation	SNP	104511030	104511030	TACR3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15395	41
C5orf33	133686	broad.mit.edu	37	5	36197710	36197710	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36197710A>T	uc003jkf.3	-	11	1123	c.1123T>A	c.(1123-1125)TTC>ATC	p.F375I	C5orf33_uc003jke.3_RNA|C5orf33_uc010iux.2_Missense_Mutation_p.F180I|C5orf33_uc003jkg.3_Missense_Mutation_p.F212I|C5orf33_uc011cov.1_Missense_Mutation_p.F234I	NM_001085411	NP_001078880	Q4G0N4	NAKD1_HUMAN	hypothetical protein LOC133686 isoform 1	375							NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CGAATACTGAAAAGTATTTTT	0.353													50	68	---	---	---	---	capture	Missense_Mutation	SNP	36197710	36197710	C5orf33	5	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	2270	41
ADAMTS19	171019	broad.mit.edu	37	5	129037232	129037232	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:129037232C>T	uc003kvb.1	+	20	3088	c.3088C>T	c.(3088-3090)CGC>TGC	p.R1030C	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1030	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTCTGCCCAGCGCTGTGAGGG	0.592													19	62	---	---	---	---	capture	Missense_Mutation	SNP	129037232	129037232	ADAMTS19	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	264	41
SLC22A5	6584	broad.mit.edu	37	5	131728210	131728210	+	Silent	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131728210C>T	uc003kww.3	+	8	1617	c.1353C>T	c.(1351-1353)GCC>GCT	p.A451A	SLC22A5_uc003kwx.3_Silent_p.A475A|SLC22A5_uc010jdr.1_Silent_p.A71A	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5	451	Helical; Name=10; (Potential).				positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	TGTACACAGCCGAGCTGTATC	0.532													23	146	---	---	---	---	capture	Silent	SNP	131728210	131728210	SLC22A5	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14349	41
ZNF76	7629	broad.mit.edu	37	6	35255444	35255444	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35255444T>C	uc003oki.1	+	5	459	c.254T>C	c.(253-255)CTG>CCG	p.L85P	ZNF76_uc011dsy.1_Missense_Mutation_p.L85P|ZNF76_uc011dsz.1_Missense_Mutation_p.L85P|ZNF76_uc003okj.1_Missense_Mutation_p.L85P|ZNF76_uc011dsx.1_Missense_Mutation_p.L85P	NM_003427	NP_003418	P36508	ZNF76_HUMAN	zinc finger protein 76 (expressed in testis)	85	3 X 12 AA approximate repeats.				regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCCAGCACCCTGGAAGCCGTC	0.577													3	110	---	---	---	---	capture	Missense_Mutation	SNP	35255444	35255444	ZNF76	6	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	18012	41
DAAM2	23500	broad.mit.edu	37	6	39864627	39864627	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39864627G>A	uc003oow.2	+	20	2537	c.2381G>A	c.(2380-2382)CGT>CAT	p.R794H	DAAM2_uc003oox.2_Missense_Mutation_p.R794H	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	794	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CGCAGCAAGCGTCTTAGACAG	0.612													17	22	---	---	---	---	capture	Missense_Mutation	SNP	39864627	39864627	DAAM2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4176	41
PRPH2	5961	broad.mit.edu	37	6	42672106	42672106	+	Silent	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:42672106G>A	uc003osk.2	-	2	1111	c.825C>T	c.(823-825)TTC>TTT	p.F275F		NM_000322	NP_000313	P23942	PRPH2_HUMAN	peripherin 2	275	Helical; (Potential).				cell adhesion|visual perception	integral to membrane				ovary(4)|central_nervous_system(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			GGCCTACCTCGAAGAGCCAAA	0.627													4	18	---	---	---	---	capture	Silent	SNP	42672106	42672106	PRPH2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	12473	41
KHDRBS2	202559	broad.mit.edu	37	6	62995779	62995779	+	Silent	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:62995779C>T	uc003peg.2	-	1	322	c.75G>A	c.(73-75)TCG>TCA	p.S25S		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	25					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		CCAAAAGGCGCGACGCATGCA	0.567													15	31	---	---	---	---	capture	Silent	SNP	62995779	62995779	KHDRBS2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8069	41
SASH1	23328	broad.mit.edu	37	6	148840740	148840740	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:148840740A>G	uc003qme.1	+	10	1395	c.920A>G	c.(919-921)TAC>TGC	p.Y307C	SASH1_uc011eeb.1_Missense_Mutation_p.Y68C	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	307							protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TCCGCCCTCTACTCTGGCGTG	0.552													61	95	---	---	---	---	capture	Missense_Mutation	SNP	148840740	148840740	SASH1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	13740	41
PKD1L1	168507	broad.mit.edu	37	7	47835588	47835588	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47835588T>C	uc003tny.1	-	55	8354	c.8354A>G	c.(8353-8355)CAC>CGC	p.H2785R	C7orf69_uc003tnz.3_Intron|C7orf69_uc003toa.1_Intron	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2785	Cytoplasmic (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						ACAGCTTACGTGATTCTCAAC	0.413													4	306	---	---	---	---	capture	Missense_Mutation	SNP	47835588	47835588	PKD1L1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	11867	41
MLL3	58508	broad.mit.edu	37	7	151960173	151960173	+	Silent	SNP	A	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151960173A>G	uc003wla.2	-	9	1446	c.1227T>C	c.(1225-1227)TGT>TGC	p.C409C		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	409	PHD-type 2.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ACCCTTTGTCACACGTATCAC	0.308			N		medulloblastoma								44	229	---	---	---	---	capture	Silent	SNP	151960173	151960173	MLL3	7	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	9534	41
RIMS2	9699	broad.mit.edu	37	8	105026843	105026843	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105026843A>G	uc003yls.2	+	17	2795	c.2554A>G	c.(2554-2556)AAC>GAC	p.N852D	RIMS2_uc003ylp.2_Missense_Mutation_p.K1112E|RIMS2_uc003ylw.2_Missense_Mutation_p.N926D|RIMS2_uc003ylq.2_Missense_Mutation_p.K926E|RIMS2_uc003ylr.2_Missense_Mutation_p.K951E	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTTGGATAGAAGTAAGTTTTA	0.418										HNSCC(12;0.0054)			6	78	---	---	---	---	capture	Missense_Mutation	SNP	105026843	105026843	RIMS2	8	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	13260	41
DPYS	1807	broad.mit.edu	37	8	105456494	105456494	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105456494C>A	uc003yly.3	-	4	904	c.775G>T	c.(775-777)GCG>TCG	p.A259S		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	259					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGCATCCGCTATCACCTTA	0.493													27	87	---	---	---	---	capture	Missense_Mutation	SNP	105456494	105456494	DPYS	8	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	4701	41
COL14A1	7373	broad.mit.edu	37	8	121259908	121259908	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121259908C>T	uc003yox.2	+	21	2801	c.2536C>T	c.(2536-2538)CGC>TGC	p.R846C	COL14A1_uc003yoy.2_Missense_Mutation_p.R524C	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	846	Fibronectin type-III 7.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TAACCGGTTGCGCATTACGTG	0.458													77	87	---	---	---	---	capture	Missense_Mutation	SNP	121259908	121259908	COL14A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3636	41
TG	7038	broad.mit.edu	37	8	133879299	133879299	+	Silent	SNP	G	A	A	rs145163419	byFrequency	TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133879299G>A	uc003ytw.2	+	1	95	c.54G>A	c.(52-54)TCG>TCA	p.S18S		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	18					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCTGGGTGTCGGCCAATATCT	0.483													11	14	---	---	---	---	capture	Silent	SNP	133879299	133879299	TG	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15698	41
PRUNE2	158471	broad.mit.edu	37	9	79469120	79469120	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79469120C>T	uc010mpk.2	-	2	165	c.41G>A	c.(40-42)CGA>CAA	p.R14Q	PRUNE2_uc004akn.2_Missense_Mutation_p.R14Q	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	14					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						GCGTTTGCTTCGATTCTGAAA	0.323													25	60	---	---	---	---	capture	Missense_Mutation	SNP	79469120	79469120	PRUNE2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12536	41
AKNA	80709	broad.mit.edu	37	9	117129898	117129898	+	Silent	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117129898C>T	uc004biq.3	-	5	1788	c.1653G>A	c.(1651-1653)CGG>CGA	p.R551R	AKNA_uc004bio.3_Silent_p.R11R|AKNA_uc004bip.3_Silent_p.R470R|AKNA_uc004bir.3_Silent_p.R551R|AKNA_uc004bis.3_Silent_p.R551R|AKNA_uc010mve.2_Silent_p.R432R|AKNA_uc004biu.1_Silent_p.R292R|AKNA_uc004biv.1_Silent_p.R551R	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	551					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						CAGAGATGTCCCGGTTCTCCG	0.617													82	76	---	---	---	---	capture	Silent	SNP	117129898	117129898	AKNA	9	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	463	41
TNC	3371	broad.mit.edu	37	9	117797581	117797581	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117797581C>T	uc004bjj.3	-	22	6051	c.5689G>A	c.(5689-5691)GAG>AAG	p.E1897K	TNC_uc010mvf.2_Missense_Mutation_p.E1624K	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1897	Fibronectin type-III 15.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding	p.E1897K(1)		central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GACTGAACCTCAGTAGCAGTC	0.433													60	124	---	---	---	---	capture	Missense_Mutation	SNP	117797581	117797581	TNC	9	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	16153	41
OR5C1	392391	broad.mit.edu	37	9	125551260	125551260	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125551260G>A	uc011lzd.1	+	1	49	c.49G>A	c.(49-51)GTC>ATC	p.V17I		NM_001001923	NP_001001923	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1						TGCTGAATTCGTCCTCCTGGG	0.587													42	96	---	---	---	---	capture	Missense_Mutation	SNP	125551260	125551260	OR5C1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11057	41
ZNF41	7592	broad.mit.edu	37	X	47308259	47308259	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47308259T>C	uc004dhs.3	-	4	1103	c.1036A>G	c.(1036-1038)AGC>GGC	p.S346G	ZNF41_uc004dhu.3_Missense_Mutation_p.S338G|ZNF41_uc004dht.3_Missense_Mutation_p.S218G|ZNF41_uc004dhv.3_Missense_Mutation_p.S314G|ZNF41_uc004dhw.3_Missense_Mutation_p.S306G|ZNF41_uc004dhy.3_Missense_Mutation_p.S304G|ZNF41_uc004dhx.3_Missense_Mutation_p.S304G|ZNF41_uc011mlm.1_Missense_Mutation_p.S218G	NM_153380	NP_700359	P51814	ZNF41_HUMAN	zinc finger protein 41	346	C2H2-type 2; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3		all_lung(315;0.000129)				ACTTTGTTGCTTTTGTCACAT	0.418													3	163	---	---	---	---	capture	Missense_Mutation	SNP	47308259	47308259	ZNF41	23	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	17769	41
BCORL1	63035	broad.mit.edu	37	X	129190028	129190028	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129190028G>T	uc004evb.1	+	13	5167	c.5053G>T	c.(5053-5055)GAG>TAG	p.E1685*	BCORL1_uc004evc.1_Nonsense_Mutation_p.E521*	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1685					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						AGGCTCCTCTGAGACTGTGGA	0.627													67	20	---	---	---	---	capture	Nonsense_Mutation	SNP	129190028	129190028	BCORL1	23	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	1376	41
PASD1	139135	broad.mit.edu	37	X	150770028	150770028	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150770028G>T	uc004fev.3	+	2	335	c.3G>T	c.(1-3)ATG>ATT	p.M1I		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	1						nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AATAATGAATGAAGATGAGAG	0.408													64	9	---	---	---	---	capture	Missense_Mutation	SNP	150770028	150770028	PASD1	23	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	11374	41
PTEN	5728	broad.mit.edu	37	10	89720812	89720812	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720812delA	uc001kfb.2	+	9	1994	c.963delA	c.(961-963)ACAfs	p.T321fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	321	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.T321fs*23(9)|p.T321fs*3(7)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.N323fs*2(2)|p.T319_K332del(1)|p.T321fs*22(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*1(1)|p.W274_F341del(1)|p.V317_K322del(1)|p.T321fs*4(1)|p.T321fs*6(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTACTTTAACAAAAAATGATC	0.323		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			127	64	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89720812	89720812	PTEN	10	A	-	-	-	1	0	1	0	1	0	0	0	0	54	5	5	5	12633	41
OR4K5	79317	broad.mit.edu	37	14	20389501	20389501	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20389501delG	uc010tkw.1	+	1	736	c.736delG	c.(736-738)GTAfs	p.V246fs		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	246	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCATATTGCAGTAGTAATATT	0.398													151	571	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	20389501	20389501	OR4K5	14	G	-	-	-	1	0	1	0	1	0	0	0	0	468	36	5	5	10977	41
TMPRSS11A	339967	broad.mit.edu	37	4	68784698	68784698	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0188-01	TCGA-06-0188-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68784698delG	uc003hdr.1	-	8	1075	c.954delC	c.(952-954)TACfs	p.Y318fs	LOC550112_uc003hdl.3_Intron|TMPRSS11A_uc003hds.1_Frame_Shift_Del_p.Y315fs	NM_182606	NP_872412	Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A isoform 1	318	Peptidase S1.|Extracellular (Potential).				cell cycle|proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			skin(1)	1						CACCACCATAGTAAAGTGCTC	0.453													120	165	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	68784698	68784698	TMPRSS11A	4	G	-	-	-	1	0	1	0	1	0	0	0	0	464	36	5	5	16122	41
