Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HMCN1	83872	broad.mit.edu	37	1	185815175	185815175	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185815175A>T	uc001grq.1	+	2	515	c.286A>T	c.(286-288)ATT>TTT	p.I96F		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	96	VWFA.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCCAGTGACAATTACCACAGA	0.358													10	81	---	---	---	---	capture	Missense_Mutation	SNP	185815175	185815175	HMCN1	1	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	7145	42
OR5D13	390142	broad.mit.edu	37	11	55541191	55541191	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55541191C>A	uc010ril.1	+	1	278	c.278C>A	c.(277-279)ACC>AAC	p.T93N		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				GAATACAGAACCATCTCTTTC	0.398													25	303	---	---	---	---	capture	Missense_Mutation	SNP	55541191	55541191	OR5D13	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	11058	42
ABCC9	10060	broad.mit.edu	37	12	22069980	22069980	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:22069980T>C	uc001rfi.1	-	4	484	c.464A>G	c.(463-465)TAC>TGC	p.Y155C	ABCC9_uc001rfh.2_Missense_Mutation_p.Y155C|ABCC9_uc001rfj.1_Missense_Mutation_p.Y155C	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	155	Extracellular (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGACTGACAGTACTTAACCAA	0.388													30	211	---	---	---	---	capture	Missense_Mutation	SNP	22069980	22069980	ABCC9	12	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	59	42
PKP2	5318	broad.mit.edu	37	12	33030958	33030958	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:33030958A>C	uc001rlj.3	-	3	971	c.856T>G	c.(856-858)TCC>GCC	p.S286A	PKP2_uc001rlk.3_Missense_Mutation_p.S286A|PKP2_uc010skj.1_Missense_Mutation_p.S286A	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	286					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GAGGACCTGGAAGCCCTGTTC	0.652													3	83	---	---	---	---	capture	Missense_Mutation	SNP	33030958	33030958	PKP2	12	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	11888	42
MFSD5	84975	broad.mit.edu	37	12	53647741	53647741	+	Silent	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53647741G>A	uc001sci.1	+	2	1313	c.1122G>A	c.(1120-1122)CAG>CAA	p.Q374Q	MFSD5_uc001sch.1_Silent_p.Q481Q	NM_032889	NP_116278	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing	374					transport	integral to membrane				skin(2)|ovary(1)	3						AGACAGAGCAGGCTGGTGTAC	0.502													14	150	---	---	---	---	capture	Silent	SNP	53647741	53647741	MFSD5	12	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	9446	42
GLT1D1	144423	broad.mit.edu	37	12	129360490	129360490	+	Missense_Mutation	SNP	G	A	A	rs146263464	byFrequency	TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129360490G>A	uc010tbh.1	+	2	76	c.67G>A	c.(67-69)GTT>ATT	p.V23I	GLT1D1_uc001uhx.1_Missense_Mutation_p.V34I|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	34					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		GCACGTGTGCGTTTTGAAGGA	0.473													22	314	---	---	---	---	capture	Missense_Mutation	SNP	129360490	129360490	GLT1D1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6401	42
C14orf115	55237	broad.mit.edu	37	14	74824348	74824348	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74824348C>T	uc001xpw.3	+	2	1053	c.862C>T	c.(862-864)CGC>TGC	p.R288C		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	288					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		CCTCTGTGAGCGCTACAGCGT	0.647													9	86	---	---	---	---	capture	Missense_Mutation	SNP	74824348	74824348	C14orf115	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1726	42
PLA2G4E	123745	broad.mit.edu	37	15	42298316	42298316	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42298316C>T	uc001zow.1	-	3	310	c.310G>A	c.(310-312)GTG>ATG	p.V104M		NM_001080490	NP_001073959	Q3MJ16	PA24E_HUMAN	phospholipase A2, group 4E	115	C2.				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity				0		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		AACTCTAGCACGTTCTAGGGG	0.507													14	115	---	---	---	---	capture	Missense_Mutation	SNP	42298316	42298316	PLA2G4E	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11908	42
DET1	55070	broad.mit.edu	37	15	89070986	89070986	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89070986G>A	uc002bmr.2	-	3	1267	c.1115C>T	c.(1114-1116)ACG>ATG	p.T372M	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_Intron|DET1_uc002bmq.2_Missense_Mutation_p.T383M	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	372						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			CACCTCTGTCGTCACCATATT	0.433													3	36	---	---	---	---	capture	Missense_Mutation	SNP	89070986	89070986	DET1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4408	42
CACNA1H	8912	broad.mit.edu	37	16	1257299	1257299	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1257299G>A	uc002cks.2	+	14	3180	c.2932G>A	c.(2932-2934)GTG>ATG	p.V978M	CACNA1H_uc002ckt.2_Missense_Mutation_p.V978M|CACNA1H_uc002cku.2_5'Flank|CACNA1H_uc010brj.2_5'Flank|CACNA1H_uc002ckv.2_5'Flank	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	978	II.|Extracellular (Potential).				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	GGACTGGAACGTGGTCCTGTA	0.632													4	15	---	---	---	---	capture	Missense_Mutation	SNP	1257299	1257299	CACNA1H	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2521	42
ALG1	56052	broad.mit.edu	37	16	5129756	5129756	+	Silent	SNP	A	G	G			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:5129756A>G	uc002cym.2	+	9	950	c.909A>G	c.(907-909)GAA>GAG	p.E303E	ALG1_uc002cyj.2_Silent_p.E192E|ALG1_uc002cyn.2_Silent_p.E303E|ALG1_uc010bue.2_Silent_p.E192E|ALG1_uc010uxy.1_Silent_p.E192E	NM_019109	NP_061982	Q9BT22	ALG1_HUMAN	beta-1,4-mannosyltransferase	303	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(90;0.0164)				CAGAGTTTGAACAACTGACTC	0.348													4	189	---	---	---	---	capture	Silent	SNP	5129756	5129756	ALG1	16	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	510	42
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	T	T	rs28934578		TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578406C>T	uc002gim.2	-	5	718	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGGGGGCAGCGCCTCACAAC	0.652	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			10	109	---	---	---	---	capture	Missense_Mutation	SNP	7578406	7578406	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	42
KRTAP4-7	100132476	broad.mit.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	C	C	rs139671425	by1000genomes	TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240627T>C	uc010wfn.1	+	1	169	c.169T>C	c.(169-171)TCT>CCT	p.S57P		NM_033061	NP_149050			keratin associated protein 4-7												0						GTGCTGCCAGTCTGTGTGCTG	0.493													5	53	---	---	---	---	capture	Missense_Mutation	SNP	39240627	39240627	KRTAP4-7	17	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	8475	42
ATP6V0A1	535	broad.mit.edu	37	17	40646356	40646356	+	Silent	SNP	G	A	A	rs142629560		TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40646356G>A	uc002hzr.2	+	12	1346	c.1179G>A	c.(1177-1179)CCG>CCA	p.P393P	ATP6V0A1_uc002hzq.2_Silent_p.P393P|ATP6V0A1_uc002hzs.2_Silent_p.P400P|ATP6V0A1_uc010wgj.1_Silent_p.P350P|ATP6V0A1_uc010wgk.1_Silent_p.P350P|ATP6V0A1_uc010cyg.2_Silent_p.P39P|ATP6V0A1_uc010wgl.1_Silent_p.P252P	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	393	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TCATAGCTCCGTATACTATTA	0.368													15	151	---	---	---	---	capture	Silent	SNP	40646356	40646356	ATP6V0A1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1159	42
SFRS2	6427	broad.mit.edu	37	17	74732284	74732284	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74732284G>T	uc002jsv.2	-	2	795	c.625C>A	c.(625-627)CCC>ACC	p.P209T	SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Missense_Mutation_p.P209T|SFRS2_uc010wtg.1_Missense_Mutation_p.P197T|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	NM_003016	NP_003007	Q01130	SRSF2_HUMAN	splicing factor, arginine/serine-rich 2	209	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity				0						GACTTGGGGGGACTCTTCGAT	0.537													18	213	---	---	---	---	capture	Missense_Mutation	SNP	74732284	74732284	SFRS2	17	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	14068	42
STXBP2	6813	broad.mit.edu	37	19	7711219	7711219	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7711219G>C	uc002mha.3	+	16	1486	c.1441G>C	c.(1441-1443)GAT>CAT	p.D481H	STXBP2_uc002mhb.3_Missense_Mutation_p.D478H|STXBP2_uc010dvj.2_RNA|STXBP2_uc010xjr.1_Missense_Mutation_p.D492H|STXBP2_uc010dvk.2_Missense_Mutation_p.D449H|STXBP2_uc002mhc.3_Intron|STXBP2_uc002mhe.1_Missense_Mutation_p.D109H	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a	481					leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						GGTCATCAAGGATGTAATGGA	0.677													2	14	---	---	---	---	capture	Missense_Mutation	SNP	7711219	7711219	STXBP2	19	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	15243	42
MUC16	94025	broad.mit.edu	37	19	9045842	9045842	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9045842C>G	uc002mkp.2	-	5	35993	c.35789G>C	c.(35788-35790)GGA>GCA	p.G11930A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11932	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCTGGGGGTCCAACTGAAGT	0.493													5	185	---	---	---	---	capture	Missense_Mutation	SNP	9045842	9045842	MUC16	19	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9883	42
UXS1	80146	broad.mit.edu	37	2	106761696	106761696	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:106761696T>C	uc002tdm.2	-	6	505	c.407A>G	c.(406-408)GAG>GGG	p.E136G	UXS1_uc002tdn.2_Missense_Mutation_p.E141G|UXS1_uc002tdo.2_Missense_Mutation_p.E79G|UXS1_uc010ywh.1_Intron	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	136	NAD.|Lumenal (Potential).				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						CTCGAAGTTCTCATGTCCGAT	0.512													20	77	---	---	---	---	capture	Missense_Mutation	SNP	106761696	106761696	UXS1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	16991	42
NCKAP5	344148	broad.mit.edu	37	2	133541813	133541813	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:133541813A>C	uc002ttp.2	-	14	2945	c.2571T>G	c.(2569-2571)TTT>TTG	p.F857L	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	857							protein binding				0						ATCGTAATTCAAAGAGGGGCC	0.532													16	200	---	---	---	---	capture	Missense_Mutation	SNP	133541813	133541813	NCKAP5	2	A	C	C	C	1	0	0	0	0	1	0	0	0	63	5	4	4	10130	42
CST9	128822	broad.mit.edu	37	20	23586397	23586397	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23586397C>T	uc002wtl.2	-	1	214	c.105G>A	c.(103-105)ATG>ATA	p.M35I		NM_001008693	NP_001008693	Q5W186	CST9_HUMAN	cystatin 9 precursor	35						extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1	Colorectal(13;0.0993)					TATTACCACCCATTTCCTCTT	0.517													9	357	---	---	---	---	capture	Missense_Mutation	SNP	23586397	23586397	CST9	20	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	3944	42
NPBWR2	2832	broad.mit.edu	37	20	62738130	62738130	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62738130G>A	uc011abt.1	-	1	55	c.55C>T	c.(55-57)CCC>TCC	p.P19S		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	19	Extracellular (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					CCCATCGTGGGGAGGGAGAAG	0.637													10	162	---	---	---	---	capture	Missense_Mutation	SNP	62738130	62738130	NPBWR2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10476	42
TM4SF19	116211	broad.mit.edu	37	3	196051173	196051173	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196051173A>G	uc003fwl.1	-	4	543	c.418T>C	c.(418-420)TAT>CAT	p.Y140H	TM4SF19_uc003fwj.2_RNA|uc003fwk.1_3'UTR|TM4SF19_uc010iad.1_Missense_Mutation_p.Y140H|TM4SF19_uc011btv.1_Missense_Mutation_p.Y114H	NM_138461	NP_612470	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19	140	Extracellular (Potential).					integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		GGGTAACCATATTTCCAAGCT	0.438													7	93	---	---	---	---	capture	Missense_Mutation	SNP	196051173	196051173	TM4SF19	3	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	15853	42
UGT2B4	7363	broad.mit.edu	37	4	70359506	70359506	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70359506G>A	uc003hek.3	-	2	822	c.775C>T	c.(775-777)CGA>TGA	p.R259*	UGT2B4_uc011cap.1_Nonsense_Mutation_p.R123*|UGT2B4_uc003hel.3_Nonsense_Mutation_p.R259*	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	259					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						CAGTAGTTTCGAATAAGCCAT	0.413													7	131	---	---	---	---	capture	Nonsense_Mutation	SNP	70359506	70359506	UGT2B4	4	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	16843	42
STK10	6793	broad.mit.edu	37	5	171520876	171520876	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:171520876G>A	uc003mbo.1	-	9	1394	c.1094C>T	c.(1093-1095)CCG>CTG	p.P365L		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	365							ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGTGCCAGCGGGGTGGAAGG	0.587													7	76	---	---	---	---	capture	Missense_Mutation	SNP	171520876	171520876	STK10	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15176	42
RUNX2	860	broad.mit.edu	37	6	45514682	45514682	+	Silent	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:45514682G>A	uc011dvx.1	+	9	1416	c.1206G>A	c.(1204-1206)CCG>CCA	p.P402P	RUNX2_uc011dvy.1_Silent_p.P380P|RUNX2_uc003oxt.2_Silent_p.P388P	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	402	Interaction with MYST3 (By similarity).|Pro/Ser/Thr-rich.|Interaction with MYST4.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						CTTACACCCCGCCAGTCACCT	0.577													6	94	---	---	---	---	capture	Silent	SNP	45514682	45514682	RUNX2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13640	42
WBSCR27	155368	broad.mit.edu	37	7	73249094	73249094	+	Silent	SNP	C	T	T			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73249094C>T	uc003tzj.2	-	6	757	c.717G>A	c.(715-717)AGG>AGA	p.R239R	RFC2_uc011kfa.1_Intron	NM_152559	NP_689772	Q8N6F8	WBS27_HUMAN	Williams-Beuren syndrome chromosome region 27	239										central_nervous_system(1)	1		Lung NSC(55;0.159)				ACCTGGGTCGCCTTCCACTTT	0.632													8	67	---	---	---	---	capture	Silent	SNP	73249094	73249094	WBSCR27	7	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	17147	42
CUX1	1523	broad.mit.edu	37	7	101847816	101847816	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:101847816A>G	uc003uyx.3	+	19	3091	c.3053A>G	c.(3052-3054)CAG>CGG	p.Q1018R	CUX1_uc003uys.3_Missense_Mutation_p.Q1029R|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	1018	CUT 2.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						CTACCCGTCCAGGGCCAGCAG	0.647													9	118	---	---	---	---	capture	Missense_Mutation	SNP	101847816	101847816	CUX1	7	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	4024	42
AASS	10157	broad.mit.edu	37	7	121756793	121756793	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121756793G>A	uc003vka.2	-	7	884	c.788C>T	c.(787-789)ACG>ATG	p.T263M	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Missense_Mutation_p.T263M|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	263	Lysine-ketoglutarate reductase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	ACTTAACACCGTCCCATACAC	0.353													10	98	---	---	---	---	capture	Missense_Mutation	SNP	121756793	121756793	AASS	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	24	42
GRM8	2918	broad.mit.edu	37	7	126882805	126882805	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126882805C>G	uc003vlr.2	-	1	765	c.454G>C	c.(454-456)GGT>CGT	p.G152R	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.G152R|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	152	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	GCTGCAGCACCTATGACGCCA	0.433										HNSCC(24;0.065)			17	174	---	---	---	---	capture	Missense_Mutation	SNP	126882805	126882805	GRM8	7	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	6736	42
PHF20L1	51105	broad.mit.edu	37	8	133829196	133829196	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133829196A>C	uc003ytt.2	+	11	1572	c.1247A>C	c.(1246-1248)CAG>CCG	p.Q416P	PHF20L1_uc003yts.2_Missense_Mutation_p.Q416P|PHF20L1_uc011lja.1_Missense_Mutation_p.Q390P|PHF20L1_uc003ytu.1_Intron	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	416							nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AGAAGATCTCAGCGTTTAGCC	0.453													6	96	---	---	---	---	capture	Missense_Mutation	SNP	133829196	133829196	PHF20L1	8	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	11735	42
CXorf23	256643	broad.mit.edu	37	X	19968977	19968977	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0189-01	TCGA-06-0189-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:19968977T>G	uc004czp.2	-	7	1639	c.1639A>C	c.(1639-1641)AAA>CAA	p.K547Q	CXorf23_uc010nfn.2_RNA|CXorf23_uc011mjg.1_Missense_Mutation_p.K112Q|CXorf23_uc004czo.2_Missense_Mutation_p.K497Q	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643	547						mitochondrion				lung(1)|skin(1)	2						TCTATTATTTTGATCAGAGTC	0.363													4	64	---	---	---	---	capture	Missense_Mutation	SNP	19968977	19968977	CXorf23	23	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	4063	42
