Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MMEL1	79258	broad.mit.edu	37	1	2524105	2524105	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2524105G>T	uc001ajy.2	-	21	2270	c.2056C>A	c.(2056-2058)CAA>AAA	p.Q686K	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	686	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		TTATAGGCTTGCCGCACCCCT	0.647													4	14	---	---	---	---	capture	Missense_Mutation	SNP	2524105	2524105	MMEL1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	9558	43
ACTRT2	140625	broad.mit.edu	37	1	2939073	2939073	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2939073G>A	uc001ajz.2	+	1	1028	c.823G>A	c.(823-825)GGG>AGG	p.G275R		NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2	275						cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		CCAGAGCCCCGGGCTCTCGAA	0.627													48	130	---	---	---	---	capture	Missense_Mutation	SNP	2939073	2939073	ACTRT2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	219	43
FLG	2312	broad.mit.edu	37	1	152279722	152279722	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152279722G>A	uc001ezu.1	-	3	7676	c.7640C>T	c.(7639-7641)TCG>TTG	p.S2547L		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2547	Ser-rich.|Filaggrin 15.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCCACCTGCGAGTGTCCAGA	0.577									Ichthyosis				164	403	---	---	---	---	capture	Missense_Mutation	SNP	152279722	152279722	FLG	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5867	43
NPR1	4881	broad.mit.edu	37	1	153660673	153660673	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153660673G>A	uc001fcs.3	+	15	2814	c.2393G>A	c.(2392-2394)CGC>CAC	p.R798H	NPR1_uc010pdz.1_Missense_Mutation_p.R544H|NPR1_uc010pea.1_Missense_Mutation_p.R276H	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	798	Cytoplasmic (Potential).|Protein kinase.				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CAGCAGATCCGCCTGACGTTG	0.602													38	91	---	---	---	---	capture	Missense_Mutation	SNP	153660673	153660673	NPR1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10501	43
NPR1	4881	broad.mit.edu	37	1	153660684	153660684	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153660684C>T	uc001fcs.3	+	15	2825	c.2404C>T	c.(2404-2406)CGC>TGC	p.R802C	NPR1_uc010pdz.1_Missense_Mutation_p.R548C|NPR1_uc010pea.1_Missense_Mutation_p.R280C	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	802	Cytoplasmic (Potential).|Protein kinase.				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CCTGACGTTGCGCAAATTTAA	0.587													38	95	---	---	---	---	capture	Missense_Mutation	SNP	153660684	153660684	NPR1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10501	43
F5	2153	broad.mit.edu	37	1	169519050	169519050	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169519050G>A	uc001ggg.1	-	10	1745	c.1600C>T	c.(1600-1602)CGA>TGA	p.R534*	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	534	F5/8 type A 2.	Cleavage; by activated protein C.			cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TGTATTCCTTGCCTGTCCAGG	0.428													27	77	---	---	---	---	capture	Nonsense_Mutation	SNP	169519050	169519050	F5	1	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	5302	43
CEP350	9857	broad.mit.edu	37	1	179991889	179991889	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179991889G>A	uc001gnt.2	+	13	3675	c.3292G>A	c.(3292-3294)GCA>ACA	p.A1098T	CEP350_uc009wxl.2_Missense_Mutation_p.A1097T|CEP350_uc001gnu.2_Missense_Mutation_p.A932T	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1098						centrosome|nucleus|spindle				ovary(4)	4						GAATGCCACCGCAACTCCTCT	0.398													3	36	---	---	---	---	capture	Missense_Mutation	SNP	179991889	179991889	CEP350	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3222	43
PTEN	5728	broad.mit.edu	37	10	89692792	89692792	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692792C>A	uc001kfb.2	+	6	1307	c.276C>A	c.(274-276)GAC>GAA	p.D92E		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	92	Phosphatase tensin-type.			D->A: 700-fold reduction in phosphatase activity towards PtdIns(3,4,5)P3. Loss of protein phosphatase activity. Unable to inhibit focal adhesion formation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.D92H(3)|p.D92V(2)|p.?(2)|p.Y27fs*1(2)|p.D92G(2)|p.D92N(2)|p.Y27_N212>Y(2)|p.D92fs*7(1)|p.D92Y(1)|p.D92E(1)|p.Q87_P96del(1)|p.D92A(1)|p.N82_P95del(1)|p.F90_P95>L(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTTTTGAAGACCATAACCCAC	0.333		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			38	88	---	---	---	---	capture	Missense_Mutation	SNP	89692792	89692792	PTEN	10	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	12633	43
TRAF6	7189	broad.mit.edu	37	11	36518817	36518817	+	Splice_Site	SNP	C	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36518817C>A	uc001mwr.1	-	5	788	c.448_splice	c.e5-1	p.D150_splice	TRAF6_uc001mws.1_Splice_Site_p.D150_splice	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)				CTTGATGATCCTATAATTAAA	0.363													4	95	---	---	---	---	capture	Splice_Site	SNP	36518817	36518817	TRAF6	11	C	A	A	A	1	0	0	0	0	0	0	1	0	312	24	5	4	16328	43
SERPING1	710	broad.mit.edu	37	11	57379257	57379257	+	Missense_Mutation	SNP	G	A	A	rs139000758		TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57379257G>A	uc001nkp.1	+	7	1288	c.1097G>A	c.(1096-1098)CGT>CAT	p.R366H	SERPING1_uc001nkq.1_Intron|SERPING1_uc010rju.1_Missense_Mutation_p.R314H|SERPING1_uc010rjv.1_Missense_Mutation_p.R371H|SERPING1_uc001nkr.1_Missense_Mutation_p.R366H|SERPING1_uc009ymi.1_Missense_Mutation_p.R375H|SERPING1_uc009ymj.1_Intron|SERPING1_uc001nks.1_Missense_Mutation_p.R57H	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	366					blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						CTGAAACATCGTCTTGAAGAC	0.493									Hereditary_Angioedema				74	106	---	---	---	---	capture	Missense_Mutation	SNP	57379257	57379257	SERPING1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14009	43
SIPA1	6494	broad.mit.edu	37	11	65408796	65408796	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65408796T>G	uc001ofb.2	+	2	571	c.404T>G	c.(403-405)ATG>AGG	p.M135R	SIPA1_uc010rom.1_Missense_Mutation_p.M135R|SIPA1_uc001ofd.2_Missense_Mutation_p.M135R	NM_006747	NP_006738	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated protein	135					cell proliferation|cytoskeleton organization|intracellular signal transduction|negative regulation of cell adhesion|negative regulation of cell cycle|negative regulation of cell growth	cytosol|endomembrane system|membrane|perinuclear region of cytoplasm	Rap GTPase activator activity				0						TCTCAGGGGATGGGGAGCCAC	0.622													6	82	---	---	---	---	capture	Missense_Mutation	SNP	65408796	65408796	SIPA1	11	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	14221	43
GAB2	9846	broad.mit.edu	37	11	77991912	77991912	+	Silent	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77991912G>A	uc001ozh.2	-	2	111	c.111C>T	c.(109-111)GGC>GGT	p.G37G	GAB2_uc001ozg.2_5'UTR	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a	37	PH.				osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CGCTCATCCGGCCACTCCGCA	0.463													4	157	---	---	---	---	capture	Silent	SNP	77991912	77991912	GAB2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	6091	43
EXPH5	23086	broad.mit.edu	37	11	108385420	108385420	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108385420A>T	uc001pkk.2	-	6	925	c.814T>A	c.(814-816)TAT>AAT	p.Y272N	EXPH5_uc010rvy.1_Missense_Mutation_p.Y84N|EXPH5_uc010rvz.1_Missense_Mutation_p.Y116N|EXPH5_uc010rwa.1_Missense_Mutation_p.Y196N	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	272					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		AGGATGTCATAGATAGACATA	0.383													5	122	---	---	---	---	capture	Missense_Mutation	SNP	108385420	108385420	EXPH5	11	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	5277	43
SPIC	121599	broad.mit.edu	37	12	101880330	101880330	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101880330C>T	uc001tid.2	+	6	687	c.528C>T	c.(526-528)TAC>TAT	p.Y176Y	SPIC_uc009zua.2_Silent_p.Y51Y|SPIC_uc010svp.1_Silent_p.Y175Y	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	176	ETS.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						TCAGAAATTACGGAAGAAGTG	0.448													32	102	---	---	---	---	capture	Silent	SNP	101880330	101880330	SPIC	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14943	43
OR4Q3	441669	broad.mit.edu	37	14	20216091	20216091	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20216091T>C	uc010tkt.1	+	1	505	c.505T>C	c.(505-507)TTC>CTC	p.F169L		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCAGCTGCCTTTCTGTGGGCC	0.512													20	253	---	---	---	---	capture	Missense_Mutation	SNP	20216091	20216091	OR4Q3	14	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	10985	43
C14orf149	112849	broad.mit.edu	37	14	59942820	59942820	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:59942820G>A	uc001xee.1	-	3	830	c.791C>T	c.(790-792)GCA>GTA	p.A264V		NM_144581	NP_653182	Q96EM0	PRCM_HUMAN	proline racemase-like	264							proline racemase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.14)	L-Proline(DB00172)	CTGTTCATCTGCAAAAACACA	0.353													5	283	---	---	---	---	capture	Missense_Mutation	SNP	59942820	59942820	C14orf149	14	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	1738	43
GPR68	8111	broad.mit.edu	37	14	91700713	91700713	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:91700713G>A	uc001xzg.2	-	2	1023	c.682C>T	c.(682-684)CGG>TGG	p.R228W	GPR68_uc001xzh.2_Missense_Mutation_p.R238W	NM_003485	NP_003476	Q15743	OGR1_HUMAN	G protein-coupled receptor 68	228	Cytoplasmic (Potential).				inflammatory response	integral to plasma membrane	G-protein coupled receptor activity			kidney(1)	1		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		AGCACCAGCCGCTGGATCTGG	0.677													8	9	---	---	---	---	capture	Missense_Mutation	SNP	91700713	91700713	GPR68	14	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	6640	43
RIN3	79890	broad.mit.edu	37	14	93118186	93118186	+	Silent	SNP	C	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:93118186C>A	uc001yap.2	+	6	944	c.792C>A	c.(790-792)CCC>CCA	p.P264P	RIN3_uc010auk.2_5'UTR|RIN3_uc001yaq.2_Silent_p.P189P|RIN3_uc001yar.1_5'UTR|RIN3_uc001yas.1_5'UTR	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	264	Pro-rich.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				CTTTGCCGCCCACCTCTGATG	0.443													4	139	---	---	---	---	capture	Silent	SNP	93118186	93118186	RIN3	14	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	13265	43
SNX1	6642	broad.mit.edu	37	15	64415724	64415724	+	Silent	SNP	A	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:64415724A>G	uc002amv.2	+	5	525	c.489A>G	c.(487-489)GTA>GTG	p.V163V	SNX1_uc010bgv.2_Intron|SNX1_uc010uio.1_Silent_p.V163V|SNX1_uc002amw.2_Silent_p.V163V|SNX1_uc002amx.2_Silent_p.V98V|SNX1_uc002amy.2_Silent_p.V92V|SNX1_uc010bgw.2_Silent_p.V65V	NM_003099	NP_003090	Q13596	SNX1_HUMAN	sorting nexin 1 isoform a	163	PX.				cell communication|early endosome to Golgi transport|endocytosis|intracellular protein transport	early endosome membrane|Golgi apparatus	phosphatidylinositol binding|protein binding|protein transporter activity				0						ATGCATATGTAGCCTACAAAG	0.418													44	101	---	---	---	---	capture	Silent	SNP	64415724	64415724	SNX1	15	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	14772	43
ANPEP	290	broad.mit.edu	37	15	90340926	90340926	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90340926C>T	uc002bop.3	-	15	2329	c.2037G>A	c.(2035-2037)GCG>GCA	p.A679A		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	679	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	TGTTGTTCAGCGCCAGAGTGA	0.587													33	186	---	---	---	---	capture	Silent	SNP	90340926	90340926	ANPEP	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	704	43
ARRDC4	91947	broad.mit.edu	37	15	98512581	98512581	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:98512581G>A	uc010bom.2	+	5	1013	c.854G>A	c.(853-855)TGC>TAC	p.C285Y	ARRDC4_uc002bui.3_Missense_Mutation_p.C198Y	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	285					signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTGGATTGCTGCATTATCAGA	0.423													6	117	---	---	---	---	capture	Missense_Mutation	SNP	98512581	98512581	ARRDC4	15	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	978	43
MPG	4350	broad.mit.edu	37	16	133088	133088	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:133088G>A	uc002cfn.2	+	4	671	c.353G>A	c.(352-354)CGA>CAA	p.R118Q	MPG_uc002cfm.2_Missense_Mutation_p.R101Q|MPG_uc010bqp.2_Missense_Mutation_p.R101Q|MPG_uc002cfo.2_Missense_Mutation_p.R113Q	NM_002434	NP_002425	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase isoform a	118					depurination|DNA dealkylation involved in DNA repair	nucleoplasm	alkylbase DNA N-glycosylase activity|damaged DNA binding|identical protein binding			ovary(1)|skin(1)	2		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				ACAGAACTCCGAGGCCGCATC	0.637								BER_DNA_glycosylases					73	217	---	---	---	---	capture	Missense_Mutation	SNP	133088	133088	MPG	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9636	43
CIITA	4261	broad.mit.edu	37	16	11002910	11002910	+	Silent	SNP	G	A	A	rs148091568	byFrequency	TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:11002910G>A	uc002dai.3	+	12	2815	c.2682G>A	c.(2680-2682)GCG>GCA	p.A894A	CIITA_uc002daj.3_Silent_p.A895A|CIITA_uc002dak.3_Silent_p.A310A|CIITA_uc010bup.1_Intron	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	894					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						ACACGGTGGCGCTGTGGGAGT	0.602			T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								25	57	---	---	---	---	capture	Silent	SNP	11002910	11002910	CIITA	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3393	43
ZNF688	146542	broad.mit.edu	37	16	30581364	30581364	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30581364G>A	uc002dyt.2	-	3	1482	c.704C>T	c.(703-705)TCC>TTC	p.S235F	ZNF688_uc002dys.2_Missense_Mutation_p.S221F|uc002dyu.2_5'Flank	NM_145271	NP_660314	P0C7X2	ZN688_HUMAN	zinc finger protein 688 isoform a	235					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCCGGAGCAGGAGCGGTGGAT	0.716													5	18	---	---	---	---	capture	Missense_Mutation	SNP	30581364	30581364	ZNF688	16	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	17971	43
CYLD	1540	broad.mit.edu	37	16	50788289	50788289	+	Silent	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50788289G>A	uc002egp.1	+	6	1282	c.867G>A	c.(865-867)GCG>GCA	p.A289A	CYLD_uc002egn.1_Silent_p.A289A|CYLD_uc002ego.2_Silent_p.A289A|CYLD_uc010cbs.1_Silent_p.A289A|CYLD_uc002egq.1_Silent_p.A289A|CYLD_uc002egr.1_Silent_p.A289A|CYLD_uc002egs.1_Silent_p.A289A	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	289	Interaction with TRIP.				cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	p.A289A(1)		skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				GTAGTTTTGCGTGTGTTGAAA	0.303			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				22	61	---	---	---	---	capture	Silent	SNP	50788289	50788289	CYLD	16	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4103	43
LRRC50	123872	broad.mit.edu	37	16	84203617	84203617	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84203617A>T	uc002fhl.3	+	8	1364	c.1183A>T	c.(1183-1185)AGT>TGT	p.S395C	LRRC50_uc010vnw.1_Missense_Mutation_p.S159C	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	395	Pro-rich.				axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						GGAAAAGCCAAGTGGAGAGGA	0.577									Kartagener_syndrome				23	65	---	---	---	---	capture	Missense_Mutation	SNP	84203617	84203617	LRRC50	16	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	8924	43
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	T	T	rs28934575		TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577548C>T	uc002gim.2	-	7	927	c.733G>A	c.(733-735)GGC>AGC	p.G245S	TP53_uc002gig.1_Missense_Mutation_p.G245S|TP53_uc002gih.2_Missense_Mutation_p.G245S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G113S|TP53_uc010cng.1_Missense_Mutation_p.G113S|TP53_uc002gii.1_Missense_Mutation_p.G113S|TP53_uc010cnh.1_Missense_Mutation_p.G245S|TP53_uc010cni.1_Missense_Mutation_p.G245S|TP53_uc002gij.2_Missense_Mutation_p.G245S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G152S|TP53_uc002gio.2_Missense_Mutation_p.G113S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	245	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G245S(274)|p.G245D(93)|p.G245V(50)|p.G245C(47)|p.G245R(10)|p.G245A(8)|p.0?(7)|p.G245G(3)|p.G245fs*2(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.G245fs*22(1)|p.M243fs*18(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGGTTCATGCCGCCCATGCAG	0.577	G245S(SKLMS1_SOFT_TISSUE)|G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKMEL2_SKIN)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			8	50	---	---	---	---	capture	Missense_Mutation	SNP	7577548	7577548	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	43
MYH8	4626	broad.mit.edu	37	17	10300223	10300223	+	Missense_Mutation	SNP	G	A	A	rs150344258		TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10300223G>A	uc002gmm.2	-	31	4354	c.4259C>T	c.(4258-4260)ACG>ATG	p.T1420M	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1420	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						CCGCTGCTTCGTCTTCTCAAG	0.493									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				13	103	---	---	---	---	capture	Missense_Mutation	SNP	10300223	10300223	MYH8	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9951	43
PIRT	644139	broad.mit.edu	37	17	10728581	10728581	+	Missense_Mutation	SNP	G	A	A	rs150727776	by1000genomes	TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10728581G>A	uc010col.2	-	2	677	c.382C>T	c.(382-384)CGC>TGC	p.R128C		NM_001101387	NP_001094857	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of	128						integral to membrane				ovary(1)	1						TTGAGGCTGCGTAAGAAATTC	0.532													12	55	---	---	---	---	capture	Missense_Mutation	SNP	10728581	10728581	PIRT	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11848	43
NF1	4763	broad.mit.edu	37	17	29548907	29548907	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29548907T>C	uc002hgg.2	+	15	2014	c.1681T>C	c.(1681-1683)TGG>CGG	p.W561R	NF1_uc002hgf.1_Missense_Mutation_p.W561R|NF1_uc002hgh.2_Missense_Mutation_p.W561R|NF1_uc010csn.1_Missense_Mutation_p.W421R	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	561					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CATTGATTTGTGGAATCCTGA	0.279			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			9	84	---	---	---	---	capture	Missense_Mutation	SNP	29548907	29548907	NF1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	10263	43
NF1	4763	broad.mit.edu	37	17	29586056	29586056	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29586056C>A	uc002hgg.2	+	33	4672	c.4339C>A	c.(4339-4341)CAG>AAG	p.Q1447K	NF1_uc002hgh.2_Missense_Mutation_p.Q1426K|NF1_uc002hgi.1_Missense_Mutation_p.Q459K	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1447	Ras-GAP.				actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(3)|p.Q1447K(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTAGATACTTCAGAGTATTGC	0.308			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			12	19	---	---	---	---	capture	Missense_Mutation	SNP	29586056	29586056	NF1	17	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	10263	43
DHX40	79665	broad.mit.edu	37	17	57651146	57651146	+	Missense_Mutation	SNP	C	G	G	rs2523371	by1000genomes	TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:57651146C>G	uc002ixn.1	+	5	739	c.592C>G	c.(592-594)CCT>GCT	p.P198A	DHX40_uc010woe.1_Missense_Mutation_p.P121A|DHX40_uc002ixo.1_Missense_Mutation_p.P99A	NM_024612	NP_078888	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	198	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GGAGAAGTCTCCTAATAGGAA	0.343													3	67	---	---	---	---	capture	Missense_Mutation	SNP	57651146	57651146	DHX40	17	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	4470	43
LAMA1	284217	broad.mit.edu	37	18	7011447	7011447	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7011447C>T	uc002knm.2	-	25	3633	c.3539G>A	c.(3538-3540)CGT>CAT	p.R1180H	LAMA1_uc010wzj.1_Missense_Mutation_p.R656H	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1180	Laminin IV type A 2.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGAAACCACACGCAGAAGAGG	0.552													3	17	---	---	---	---	capture	Missense_Mutation	SNP	7011447	7011447	LAMA1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8525	43
MBD1	4152	broad.mit.edu	37	18	47803460	47803460	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:47803460C>T	uc010dow.1	-	3	662	c.225G>A	c.(223-225)AAG>AAA	p.K75K	MBD1_uc002lef.2_5'Flank|MBD1_uc002leg.2_Silent_p.K75K|MBD1_uc010xdi.1_Silent_p.K101K|MBD1_uc002leh.3_Silent_p.K75K|MBD1_uc002len.2_Silent_p.K75K|MBD1_uc002lei.3_Silent_p.K75K|MBD1_uc002lej.3_Silent_p.K75K|MBD1_uc002lek.3_Silent_p.K75K|MBD1_uc002lel.3_Silent_p.K75K|MBD1_uc002lem.3_Silent_p.K75K|MBD1_uc010xdj.1_Silent_p.K75K|MBD1_uc010xdk.1_Silent_p.K75K|MBD1_uc010dox.1_Silent_p.K75K|MBD1_uc002leo.2_Silent_p.K75K	NM_015846	NP_056671	Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1 isoform 1	75					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|nuclear speck	methyl-CpG binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TGTGAAGTACCTTGGGGGCTG	0.537													20	44	---	---	---	---	capture	Silent	SNP	47803460	47803460	MBD1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	9255	43
FECH	2235	broad.mit.edu	37	18	55238743	55238743	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55238743C>T	uc002lgq.3	-	4	461	c.344G>A	c.(343-345)CGA>CAA	p.R115Q	FECH_uc002lgp.3_Missense_Mutation_p.R121Q|FECH_uc002lgr.3_5'UTR	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor	115					generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding			central_nervous_system(1)	1		Colorectal(73;0.227)				CTTGGGGGTTCGGCGTTTGGC	0.473													48	130	---	---	---	---	capture	Missense_Mutation	SNP	55238743	55238743	FECH	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5754	43
PIAS4	51588	broad.mit.edu	37	19	4029001	4029001	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4029001G>A	uc002lzg.2	+	7	884	c.874G>A	c.(874-876)GGG>AGG	p.G292R		NM_015897	NP_056981	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	292					positive regulation of protein sumoylation|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|PML body	DNA binding|SUMO ligase activity|ubiquitin protein ligase binding|zinc ion binding			pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGACCATTGGGGTAAAGCA	0.652													6	18	---	---	---	---	capture	Missense_Mutation	SNP	4029001	4029001	PIAS4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	11781	43
RGL3	57139	broad.mit.edu	37	19	11512738	11512738	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11512738G>A	uc002mrp.2	-	13	1497	c.1433C>T	c.(1432-1434)CCG>CTG	p.P478L	RGL3_uc002mrn.2_Missense_Mutation_p.P242L|RGL3_uc002mrm.2_Missense_Mutation_p.P242L|RGL3_uc002mro.2_Missense_Mutation_p.P478L	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	478	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						CAGGATGGGCGGGTGGGGGCT	0.672													20	85	---	---	---	---	capture	Missense_Mutation	SNP	11512738	11512738	RGL3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13173	43
CC2D1A	54862	broad.mit.edu	37	19	14034593	14034593	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14034593C>T	uc002mxo.2	+	17	2208	c.1909C>T	c.(1909-1911)CGC>TGC	p.R637C	CC2D1A_uc002mxp.2_Missense_Mutation_p.R637C|CC2D1A_uc010dzh.2_Missense_Mutation_p.R206C|CC2D1A_uc002mxq.1_Missense_Mutation_p.R282C	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	637					positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			GCCCACCGCCCGCTTTGAGCA	0.627													47	176	---	---	---	---	capture	Missense_Mutation	SNP	14034593	14034593	CC2D1A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2700	43
BRD4	23476	broad.mit.edu	37	19	15374294	15374294	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15374294G>T	uc002nar.2	-	7	1500	c.1278C>A	c.(1276-1278)TTC>TTA	p.F426L	BRD4_uc002nas.2_Missense_Mutation_p.F426L|BRD4_uc002nat.3_Missense_Mutation_p.F426L|BRD4_uc002nau.3_Missense_Mutation_p.F426L	NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	426	Bromo 2.				interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			AGCAGTTGGAGAACATCAATC	0.562			T	NUT|C15orf55	lethal midline carcinoma of young people								8	116	---	---	---	---	capture	Missense_Mutation	SNP	15374294	15374294	BRD4	19	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	1492	43
CYP4F3	4051	broad.mit.edu	37	19	15763403	15763403	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15763403G>A	uc002nbj.2	+	8	993	c.943G>A	c.(943-945)GAT>AAT	p.D315N	CYP4F3_uc010xok.1_Missense_Mutation_p.D315N|CYP4F3_uc010xol.1_Missense_Mutation_p.D315N|CYP4F3_uc010xom.1_Missense_Mutation_p.D166N|CYP4F3_uc002nbk.2_Missense_Mutation_p.D315N|CYP4F3_uc010xon.1_Missense_Mutation_p.D25N	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	315					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GAAGTTGTCCGATGAGGACAT	0.517													79	276	---	---	---	---	capture	Missense_Mutation	SNP	15763403	15763403	CYP4F3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4150	43
LRP3	4037	broad.mit.edu	37	19	33695616	33695616	+	Silent	SNP	A	C	C			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33695616A>C	uc010edh.2	+	4	426	c.333A>C	c.(331-333)CCA>CCC	p.P111P	LRP3_uc010xrp.1_5'UTR|LRP3_uc002nuk.3_5'UTR	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	111	Extracellular (Potential).|CUB 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CAGCAGCCCCACCCCGCCAGG	0.662													8	99	---	---	---	---	capture	Silent	SNP	33695616	33695616	LRP3	19	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	8874	43
FCGBP	8857	broad.mit.edu	37	19	40368569	40368569	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40368569C>G	uc002omp.3	-	28	12787	c.12779G>C	c.(12778-12780)CGG>CCG	p.R4260P		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	4260	VWFD 10.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCAGGACCCCCGACATTCGTC	0.662													15	119	---	---	---	---	capture	Missense_Mutation	SNP	40368569	40368569	FCGBP	19	C	G	G	G	1	0	0	0	0	1	0	0	0	299	23	4	4	5724	43
LIPE	3991	broad.mit.edu	37	19	42909550	42909550	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42909550C>T	uc002otr.2	-	8	2806	c.2529G>A	c.(2527-2529)TCG>TCA	p.S843S	uc010eif.1_Intron	NM_005357	NP_005348	Q05469	LIPS_HUMAN	hormone-sensitive lipase	843					cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding			ovary(1)|breast(1)	2		Prostate(69;0.00682)				CTATGGGCTCCGACATCTTCT	0.592													9	69	---	---	---	---	capture	Silent	SNP	42909550	42909550	LIPE	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8741	43
SIGLEC11	114132	broad.mit.edu	37	19	50461997	50461997	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50461997C>T	uc010ybh.1	-	7	1357	c.1266G>A	c.(1264-1266)GAG>GAA	p.E422E	SIGLEC11_uc010ybi.1_Silent_p.E422E	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	422	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TGGGTGGCAGCTCCAGGACCC	0.667													24	117	---	---	---	---	capture	Silent	SNP	50461997	50461997	SIGLEC11	19	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	14200	43
NLRP12	91662	broad.mit.edu	37	19	54314437	54314437	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54314437C>T	uc002qch.3	-	3	696	c.476G>A	c.(475-477)CGG>CAG	p.R159Q	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.R159Q|NLRP12_uc002qcj.3_Missense_Mutation_p.R159Q|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.R159Q	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	159					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CAGCAGGAGCCGGGTGTACCG	0.617													60	136	---	---	---	---	capture	Missense_Mutation	SNP	54314437	54314437	NLRP12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10381	43
FCAR	2204	broad.mit.edu	37	19	55385735	55385735	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55385735G>A	uc002qhr.1	+	1	187	c.-10G>A	c.(-12--8)CCGTG>CCATG		FCAR_uc002qhq.2_Translation_Start_Site|FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Translation_Start_Site|FCAR_uc010esi.1_Translation_Start_Site|FCAR_uc002qhu.1_Translation_Start_Site|FCAR_uc002qhv.1_Translation_Start_Site|FCAR_uc002qhw.1_Translation_Start_Site|FCAR_uc002qhx.1_Translation_Start_Site|FCAR_uc002qhy.1_Translation_Start_Site|FCAR_uc002qhz.1_Translation_Start_Site|FCAR_uc002qia.1_Translation_Start_Site	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		GGCTGAGGCCGTGTCAGCACG	0.493													49	192	---	---	---	---	capture	Translation_Start_Site	SNP	55385735	55385735	FCAR	19	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	5719	43
NLRP8	126205	broad.mit.edu	37	19	56485114	56485114	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56485114C>T	uc002qmh.2	+	7	2702	c.2631C>T	c.(2629-2631)AAC>AAT	p.N877N	NLRP8_uc010etg.2_Silent_p.N858N	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	877	LRR 4.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TGGCAGAAAACGCCTTGAAAG	0.493													84	315	---	---	---	---	capture	Silent	SNP	56485114	56485114	NLRP8	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10390	43
LOC150786	150786	broad.mit.edu	37	2	132120971	132120971	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:132120971A>G	uc002tsr.2	-	1	761	c.323T>C	c.(322-324)ATT>ACT	p.I108T		NM_001077637	NP_001071105	Q53S08	Q53S08_HUMAN	RAB6C-like	108					protein transport|small GTPase mediated signal transduction		GTP binding				0				BRCA - Breast invasive adenocarcinoma(221;0.078)		GACATCATCAATCCACTTTGT	0.428													4	395	---	---	---	---	capture	Missense_Mutation	SNP	132120971	132120971	LOC150786	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	8789	43
LRP2	4036	broad.mit.edu	37	2	170113633	170113633	+	Splice_Site	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170113633C>T	uc002ues.2	-	18	2852	c.2639_splice	c.e18+1	p.A880_splice	LRP2_uc010zdf.1_Splice_Site_p.A743_splice	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTCCTACTTACGCCCAATCGA	0.458													35	63	---	---	---	---	capture	Splice_Site	SNP	170113633	170113633	LRP2	2	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	8872	43
TTN	7273	broad.mit.edu	37	2	179547505	179547505	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179547505G>A	uc010zfg.1	-	132	29505	c.29281C>T	c.(29281-29283)CCA>TCA	p.P9761S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P6422S|TTN_uc010fre.1_Missense_Mutation_p.P608S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10688							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCTGTTGGTTCATACTCC	0.368													71	225	---	---	---	---	capture	Missense_Mutation	SNP	179547505	179547505	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	16617	43
SGOL2	151246	broad.mit.edu	37	2	201436763	201436763	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201436763C>A	uc002uvw.2	+	7	1807	c.1694C>A	c.(1693-1695)ACA>AAA	p.T565K	SGOL2_uc010zhd.1_Missense_Mutation_p.T565K|SGOL2_uc010zhe.1_Missense_Mutation_p.T565K	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	565					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						CTAGACGTCACAAATGAATTT	0.323													12	145	---	---	---	---	capture	Missense_Mutation	SNP	201436763	201436763	SGOL2	2	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	14110	43
ZNF335	63925	broad.mit.edu	37	20	44590737	44590737	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44590737G>A	uc002xqw.2	-	10	1741	c.1618C>T	c.(1618-1620)CGG>TGG	p.R540W	ZNF335_uc010zxk.1_Missense_Mutation_p.R385W	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	540	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				GCGGCGTGCCGAATGACGTCC	0.622													46	103	---	---	---	---	capture	Missense_Mutation	SNP	44590737	44590737	ZNF335	20	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	17732	43
ZNF295	49854	broad.mit.edu	37	21	43411960	43411960	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43411960C>T	uc002zab.3	-	3	2459	c.2245G>A	c.(2245-2247)GTC>ATC	p.V749I	ZNF295_uc002yzz.3_Missense_Mutation_p.V548I|ZNF295_uc002yzy.3_Missense_Mutation_p.V749I|ZNF295_uc002zaa.3_Missense_Mutation_p.V749I	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	749	C2H2-type 4; atypical.				negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3						TAAGGGCAGACGGCCGCGTTC	0.552													117	329	---	---	---	---	capture	Missense_Mutation	SNP	43411960	43411960	ZNF295	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17707	43
ELFN2	114794	broad.mit.edu	37	22	37769260	37769260	+	Missense_Mutation	SNP	C	T	T	rs141641460		TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37769260C>T	uc003asq.3	-	3	3101	c.2315G>A	c.(2314-2316)CGC>CAC	p.R772H		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	772	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					GGGCCGGAAGCGCTCCCAGAT	0.617													34	98	---	---	---	---	capture	Missense_Mutation	SNP	37769260	37769260	ELFN2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5013	43
TTLL12	23170	broad.mit.edu	37	22	43570225	43570225	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:43570225G>A	uc003bdq.2	-	8	1251	c.1219C>T	c.(1219-1221)CGG>TGG	p.R407W	TTLL12_uc003bdr.1_Missense_Mutation_p.R407W	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	407	TTL.				protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)				CACCTTTCCCGCTGCTGGAAG	0.667													81	204	---	---	---	---	capture	Missense_Mutation	SNP	43570225	43570225	TTLL12	22	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	16607	43
CNTN6	27255	broad.mit.edu	37	3	1262380	1262380	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:1262380T>A	uc003boz.2	+	3	332	c.65T>A	c.(64-66)CTT>CAT	p.L22H	CNTN6_uc010hbo.2_Missense_Mutation_p.L17H|CNTN6_uc011asj.1_5'UTR|CNTN6_uc003bpa.2_Missense_Mutation_p.L22H	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	22					axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGTGATGGTCTTTTAAGCCGT	0.333													45	116	---	---	---	---	capture	Missense_Mutation	SNP	1262380	1262380	CNTN6	3	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	3610	43
BBX	56987	broad.mit.edu	37	3	107497367	107497367	+	Splice_Site	SNP	G	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:107497367G>T	uc010hpr.2	+	13	2530	c.2203_splice	c.e13+1	p.G735_splice	BBX_uc003dwk.3_Splice_Site_p.G735_splice|BBX_uc003dwl.3_Splice_Site_p.K398_splice|BBX_uc003dwm.3_Splice_Site_p.G735_splice|BBX_uc003dwo.3_Splice_Site_p.K84_splice	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			ACCAGCAAAGGTTAGGTGTGA	0.428													23	85	---	---	---	---	capture	Splice_Site	SNP	107497367	107497367	BBX	3	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	1332	43
ZCCHC4	29063	broad.mit.edu	37	4	25366728	25366728	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25366728G>A	uc003grl.3	+	12	1382	c.1346G>A	c.(1345-1347)GGT>GAT	p.G449D	ZCCHC4_uc003grn.3_Intron	NM_024936	NP_079212	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	449	CCHC-type.						methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(2)	2		Breast(46;0.0503)				TTTATTTGTGGTGAACTGGAT	0.398													43	85	---	---	---	---	capture	Missense_Mutation	SNP	25366728	25366728	ZCCHC4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	17470	43
GABRA4	2557	broad.mit.edu	37	4	46930680	46930680	+	Silent	SNP	A	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46930680A>G	uc003gxg.2	-	9	1366	c.1227T>C	c.(1225-1227)CAT>CAC	p.H409H		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	409	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATTTGCTTGAATGGTTTCCCA	0.418													36	88	---	---	---	---	capture	Silent	SNP	46930680	46930680	GABRA4	4	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	6105	43
DCHS2	54798	broad.mit.edu	37	4	155287453	155287453	+	Silent	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155287453G>A	uc003inw.2	-	5	603	c.603C>T	c.(601-603)GCC>GCT	p.A201A	DCHS2_uc003inx.2_Silent_p.A795A	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	201	Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CCTGGTCAGTGGCAAGAACAT	0.473													38	78	---	---	---	---	capture	Silent	SNP	155287453	155287453	DCHS2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	4247	43
SLC12A7	10723	broad.mit.edu	37	5	1057736	1057736	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1057736G>A	uc003jbu.2	-	22	2942	c.2876C>T	c.(2875-2877)GCG>GTG	p.A959V		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	959	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGTGTGGGACGCGGTGTTCCT	0.662													55	135	---	---	---	---	capture	Missense_Mutation	SNP	1057736	1057736	SLC12A7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14281	43
DNAH5	1767	broad.mit.edu	37	5	13865969	13865969	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13865969C>T	uc003jfd.2	-	27	4205	c.4163G>A	c.(4162-4164)GGA>GAA	p.G1388E		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1388	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AAGCTCCTCTCCTCCAGTATA	0.328									Kartagener_syndrome				9	161	---	---	---	---	capture	Missense_Mutation	SNP	13865969	13865969	DNAH5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	4561	43
ADAMTS12	81792	broad.mit.edu	37	5	33576987	33576987	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33576987G>C	uc003jia.1	-	19	3307	c.3144C>G	c.(3142-3144)ATC>ATG	p.I1048M	ADAMTS12_uc010iuq.1_Missense_Mutation_p.I963M	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1048	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TAGGGCTGCTGATTGCTGGAG	0.562										HNSCC(64;0.19)			3	124	---	---	---	---	capture	Missense_Mutation	SNP	33576987	33576987	ADAMTS12	5	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	257	43
MGC42105	167359	broad.mit.edu	37	5	43280335	43280335	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:43280335G>A	uc003jno.2	+	4	1696	c.815G>A	c.(814-816)CGG>CAG	p.R272Q		NM_153361	NP_699192	Q8IY84	NIM1_HUMAN	serine/threonine-protein kinase NIM1	272	Protein kinase.						ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						ATGCCATTTCGGGCAGAAACC	0.557													32	100	---	---	---	---	capture	Missense_Mutation	SNP	43280335	43280335	MGC42105	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9464	43
SPINK9	643394	broad.mit.edu	37	5	147715209	147715209	+	Silent	SNP	T	C	C			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147715209T>C	uc003lpe.1	+	1	88	c.33T>C	c.(31-33)GCT>GCC	p.A11A	uc003lpb.1_Intron	NM_001040433	NP_001035523	Q5DT21	ISK9_HUMAN	serine peptidase inhibitor, Kazal type 9	11						extracellular region	protein binding|serine-type endopeptidase inhibitor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTCTTGGCTCTGACACTTG	0.473													6	163	---	---	---	---	capture	Silent	SNP	147715209	147715209	SPINK9	5	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	14958	43
HIST1H2BE	8344	broad.mit.edu	37	6	26184184	26184184	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26184184G>A	uc003ngt.2	+	1	161	c.161G>A	c.(160-162)GGC>GAC	p.G54D		NM_003523	NP_003514	P62807	H2B1C_HUMAN	histone cluster 1, H2be	54					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0						CCCGACACCGGCATCTCCTCT	0.577													5	382	---	---	---	---	capture	Missense_Mutation	SNP	26184184	26184184	HIST1H2BE	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7069	43
USP49	25862	broad.mit.edu	37	6	41774357	41774357	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41774357G>A	uc003ori.2	-	4	587	c.365C>T	c.(364-366)TCG>TTG	p.S122L		NM_018561	NP_061031	Q70CQ1	UBP49_HUMAN	ubiquitin thioesterase 49	122					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GTCCTCACCCGAAGCCATGGA	0.692													17	26	---	---	---	---	capture	Missense_Mutation	SNP	41774357	41774357	USP49	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16962	43
ABCB5	340273	broad.mit.edu	37	7	20778686	20778686	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20778686C>T	uc003suw.3	+	15	2159	c.1613C>T	c.(1612-1614)TCG>TTG	p.S538L	ABCB5_uc010kuh.2_Missense_Mutation_p.S983L	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	538	Cytoplasmic (Potential).				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AAAGCCAAATCGGGGGCTGCG	0.423													11	73	---	---	---	---	capture	Missense_Mutation	SNP	20778686	20778686	ABCB5	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	44	43
CDK13	8621	broad.mit.edu	37	7	40132451	40132451	+	Silent	SNP	T	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40132451T>G	uc003thh.3	+	13	3585	c.3303T>G	c.(3301-3303)TCT>TCG	p.S1101S	CDK13_uc003thi.3_Intron|CDK13_uc003thj.2_Silent_p.S152S|CDK13_uc003thk.2_Silent_p.S34S	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1101					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						TACTACAATCTAAAACAAGTG	0.343													27	143	---	---	---	---	capture	Silent	SNP	40132451	40132451	CDK13	7	T	G	G	G	1	0	0	0	0	0	0	0	1	678	53	4	4	3099	43
COBL	23242	broad.mit.edu	37	7	51111289	51111289	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:51111289C>T	uc003tpr.3	-	8	1382	c.1197G>A	c.(1195-1197)GCG>GCA	p.A399A	COBL_uc003tps.2_Silent_p.A456A|COBL_uc011kcl.1_Silent_p.A399A|COBL_uc010kzc.2_Silent_p.A399A|COBL_uc003tpp.3_Silent_p.A185A|COBL_uc003tpq.3_Silent_p.A340A	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	399										skin(3)|ovary(2)	5	Glioma(55;0.08)					TGTCCTCCGACGCAAAACAGC	0.607													30	96	---	---	---	---	capture	Silent	SNP	51111289	51111289	COBL	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	3618	43
PIK3CG	5294	broad.mit.edu	37	7	106508499	106508499	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106508499G>A	uc003vdv.3	+	2	578	c.493G>A	c.(493-495)GTC>ATC	p.V165I	PIK3CG_uc003vdu.2_Missense_Mutation_p.V165I|PIK3CG_uc003vdw.2_Missense_Mutation_p.V165I	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	165					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CGTCACTGACGTCAGCAACGT	0.677													15	47	---	---	---	---	capture	Missense_Mutation	SNP	106508499	106508499	PIK3CG	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11819	43
CADPS2	93664	broad.mit.edu	37	7	122261662	122261662	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:122261662G>A	uc010lkp.2	-	5	1140	c.977C>T	c.(976-978)TCG>TTG	p.S326L	CADPS2_uc003vkg.3_Missense_Mutation_p.S26L|CADPS2_uc010lkq.2_Missense_Mutation_p.S326L	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	326					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						ACCACCTTTCGAAACTGGAAG	0.363													35	164	---	---	---	---	capture	Missense_Mutation	SNP	122261662	122261662	CADPS2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2547	43
FGF20	26281	broad.mit.edu	37	8	16850701	16850701	+	Silent	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:16850701G>A	uc003wxc.1	-	3	649	c.516C>T	c.(514-516)GAC>GAT	p.D172D	FGF20_uc010lsv.1_RNA|FGF20_uc010lsw.1_3'UTR	NM_019851	NP_062825	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	172					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	extracellular region|soluble fraction	growth factor activity			lung(1)	1				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		TTGGAGTTCCGTCTTTGTTAA	0.428													24	262	---	---	---	---	capture	Silent	SNP	16850701	16850701	FGF20	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5795	43
KCNV1	27012	broad.mit.edu	37	8	110984912	110984912	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110984912C>T	uc003ynr.3	-	2	908	c.566G>A	c.(565-567)TGT>TAT	p.C189Y	KCNV1_uc010mcw.2_Missense_Mutation_p.C189Y	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	189	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			AACAGTGGGACAAGGTCCTTG	0.483													48	135	---	---	---	---	capture	Missense_Mutation	SNP	110984912	110984912	KCNV1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	8016	43
SLURP1	57152	broad.mit.edu	37	8	143823793	143823793	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143823793C>T	uc003ywy.2	-	1	37	c.11G>A	c.(10-12)CGC>CAC	p.R4H		NM_020427	NP_065160	P55000	SLUR1_HUMAN	ARS component B precursor	4					cell activation|cell adhesion	extracellular space	cytokine activity				0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CACAGCCCAGCGAGAGGCCAT	0.642													9	36	---	---	---	---	capture	Missense_Mutation	SNP	143823793	143823793	SLURP1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14648	43
OR1Q1	158131	broad.mit.edu	37	9	125377107	125377107	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125377107T>G	uc011lyy.1	+	1	91	c.91T>G	c.(91-93)TTC>GTC	p.F31V		NM_012364	NP_036496	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CTTCCTTGTTTTCTCACTCAT	0.483													7	347	---	---	---	---	capture	Missense_Mutation	SNP	125377107	125377107	OR1Q1	9	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	10875	43
NTNG2	84628	broad.mit.edu	37	9	135073896	135073896	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135073896C>T	uc004cbh.2	+	3	1533	c.757C>T	c.(757-759)CGC>TGC	p.R253C		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	253	Laminin N-terminal.				axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		CACCGACCTGCGCATGCGGCT	0.637													21	102	---	---	---	---	capture	Missense_Mutation	SNP	135073896	135073896	NTNG2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10612	43
CSF2RA	1438	broad.mit.edu	37	X	1407423	1407423	+	Silent	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1407423C>T	uc010nct.2	+	6	553	c.231C>T	c.(229-231)AAC>AAT	p.N77N	CSF2RA_uc011mhb.1_Silent_p.N77N|CSF2RA_uc004cpq.2_Silent_p.N77N|CSF2RA_uc004cpn.2_Silent_p.N77N|CSF2RA_uc004cpo.2_Silent_p.N77N|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Translation_Start_Site|CSF2RA_uc004cpp.2_Silent_p.N77N|CSF2RA_uc010ncv.2_Silent_p.N77N|CSF2RA_uc004cpr.2_Silent_p.N77N	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	77	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TCAGTAACAACGAATGTTCGT	0.343													77	408	---	---	---	---	capture	Silent	SNP	1407423	1407423	CSF2RA	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3899	43
SLC25A6	293	broad.mit.edu	37	X	1505534	1505534	+	Silent	SNP	G	A	A			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1505534G>A	uc004cpt.2	-	4	954	c.858C>T	c.(856-858)TTC>TTT	p.F286F	SLC25A6_uc004cpu.2_RNA	NM_001636	NP_001627	P12236	ADT3_HUMAN	adenine nucleotide translocator 3	286	Helical; Name=6; (By similarity).|Solcar 3.				active induction of host immune response by virus|apoptosis|energy reserve metabolic process|regulation of insulin secretion|viral infectious cycle	integral to membrane|mitochondrial inner membrane presequence translocase complex	ATP:ADP antiporter activity|protein binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	GGACCAGCACGAAGGCGCCCC	0.602													24	243	---	---	---	---	capture	Silent	SNP	1505534	1505534	SLC25A6	23	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	14405	43
NRK	203447	broad.mit.edu	37	X	105153812	105153812	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105153812C>T	uc004emd.2	+	13	2482	c.2179C>T	c.(2179-2181)CGC>TGC	p.R727C	NRK_uc010npc.1_Missense_Mutation_p.R395C	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	727	Potential.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CAGGCAAAGGCGCCAACGCAG	0.408										HNSCC(51;0.14)			3	5	---	---	---	---	capture	Missense_Mutation	SNP	105153812	105153812	NRK	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10562	43
ZNRF1	84937	broad.mit.edu	37	16	75140419	75140419	+	Frame_Shift_Del	DEL	G	-	-	rs141362193	byFrequency	TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75140419delG	uc002fdk.2	+	4	1321	c.666delG	c.(664-666)CCGfs	p.P222fs	ZNRF1_uc002fdl.1_Frame_Shift_Del_p.P222fs|ZNRF1_uc010cgr.1_Frame_Shift_Del_p.P273fs	NM_032268	NP_115644	Q8ND25	ZNRF1_HUMAN	zinc and ring finger protein 1	222	RING-type; atypical.					cell junction|endosome|lysosome|synaptic vesicle membrane	ligase activity|protein binding|zinc ion binding				0						GATCTTGTCCGGAACACCCTG	0.612													12	129	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	75140419	75140419	ZNRF1	16	G	-	-	-	1	0	1	0	1	0	0	0	0	496	39	5	5	18087	43
HAT1	8520	broad.mit.edu	37	2	172841151	172841157	+	Frame_Shift_Del	DEL	TTGTCAA	-	-			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:172841151_172841157delTTGTCAA	uc002uhi.2	+	9	955_961	c.879_885delTTGTCAA	c.(877-885)CTTTGTCAAfs	p.L293fs	HAT1_uc010fqi.2_Frame_Shift_Del_p.L128fs|HAT1_uc002uhj.2_Frame_Shift_Del_p.L208fs	NM_003642	NP_003633	O14929	HAT1_HUMAN	histone acetyltransferase 1	293_295					chromatin silencing at telomere|DNA packaging	cytoplasm|nuclear matrix|nucleoplasm	histone acetyltransferase activity|protein binding			large_intestine(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.216)			TTGTGAAGCTTTGTCAAGATTTGCCCT	0.338													17	112	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	172841151	172841157	HAT1	2	TTGTCAA	-	-	-	1	0	1	0	1	0	0	0	0	821	64	5	5	6891	43
PIK3R1	5295	broad.mit.edu	37	5	67591135	67591136	+	Frame_Shift_Ins	INS	-	A	A	rs149090706	byFrequency	TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591135_67591136insA	uc003jva.2	+	13	2288_2289	c.1728_1729insA	c.(1726-1731)ACGAGAfs	p.T576fs	PIK3R1_uc003jvb.2_Frame_Shift_Ins_p.T576fs|PIK3R1_uc003jvc.2_Frame_Shift_Ins_p.T276fs|PIK3R1_uc003jvd.2_Frame_Shift_Ins_p.T306fs|PIK3R1_uc003jve.2_Frame_Shift_Ins_p.T255fs|PIK3R1_uc011crb.1_Frame_Shift_Ins_p.T246fs	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	576_577					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.T576del(3)|p.R574_T576del(2)|p.L570_D578del(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TGAGAAAGACGAGAGACCAATA	0.371			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			10	159	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	67591135	67591136	PIK3R1	5	-	A	A	A	1	0	1	1	0	0	0	0	0	470	37	5	5	11821	43
CDK13	8621	broad.mit.edu	37	7	40132440	40132442	+	In_Frame_Del	DEL	CTA	-	-			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40132440_40132442delCTA	uc003thh.3	+	13	3574_3576	c.3292_3294delCTA	c.(3292-3294)CTAdel	p.L1099del	CDK13_uc003thi.3_Intron|CDK13_uc003thj.2_In_Frame_Del_p.L150del|CDK13_uc003thk.2_In_Frame_Del_p.L32del	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1099					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						TCTACTAAACCTACTACAATCTA	0.335													24	165	---	---	---	---	capture_indel	In_Frame_Del	DEL	40132440	40132442	CDK13	7	CTA	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	3099	43
PCLO	27445	broad.mit.edu	37	7	82595145	82595146	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0190-01	TCGA-06-0190-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82595145_82595146insG	uc003uhx.2	-	4	4247_4248	c.3958_3959insC	c.(3958-3960)CAGfs	p.Q1320fs	PCLO_uc003uhv.2_Frame_Shift_Ins_p.Q1320fs	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1259					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGGCTGTGGCTGTTCTTTTATT	0.406													11	256	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	82595145	82595146	PCLO	7	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	11486	43
