Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MECR	51102	broad.mit.edu	37	1	29557372	29557372	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:29557372T>G	uc001brq.1	-	1	83	c.47A>C	c.(46-48)CAG>CCG	p.Q16P	MECR_uc001brp.1_5'UTR|MECR_uc001brr.1_5'UTR|MECR_uc001brs.1_RNA|MECR_uc001brt.1_5'UTR|MECR_uc010ofz.1_Missense_Mutation_p.Q16P	NM_016011	NP_057095	Q9BV79	MECR_HUMAN	trans-2-enoyl-CoA reductase, mitochondrial	16					fatty acid biosynthetic process	mitochondrion	trans-2-enoyl-CoA reductase (NADPH) activity|zinc ion binding			ovary(1)	1		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		CCCCCGCCACTGCCGGGCGGG	0.692													9	11	---	---	---	---	capture	Missense_Mutation	SNP	29557372	29557372	MECR	1	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	9337	44
FOXJ3	22887	broad.mit.edu	37	1	42657151	42657151	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:42657151G>A	uc001che.2	-	11	1486	c.1174C>T	c.(1174-1176)CAG>TAG	p.Q392*	FOXJ3_uc001chf.2_Nonsense_Mutation_p.Q392*|FOXJ3_uc001chg.2_Nonsense_Mutation_p.Q392*|FOXJ3_uc001chh.1_Nonsense_Mutation_p.Q358*	NM_014947	NP_055762	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	392					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGCGGATGCTGCGGTAAACCA	0.592													49	128	---	---	---	---	capture	Nonsense_Mutation	SNP	42657151	42657151	FOXJ3	1	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	5957	44
ELTD1	64123	broad.mit.edu	37	1	79403509	79403509	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:79403509G>T	uc001diq.3	-	6	899	c.743C>A	c.(742-744)ACA>AAA	p.T248K		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	248	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CGTTGAATTTGTATCAAACTC	0.378													63	167	---	---	---	---	capture	Missense_Mutation	SNP	79403509	79403509	ELTD1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	5039	44
LCE1F	353137	broad.mit.edu	37	1	152749095	152749095	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152749095G>A	uc010pdv.1	+	1	248	c.248G>A	c.(247-249)CGT>CAT	p.R83H		NM_178354	NP_848131	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	83	Poly-Arg.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACAGACGGCGTAGGTCCCAC	0.706													17	43	---	---	---	---	capture	Missense_Mutation	SNP	152749095	152749095	LCE1F	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8584	44
TOMM40L	84134	broad.mit.edu	37	1	161198259	161198259	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161198259G>A	uc001fzd.2	+	8	878	c.649G>A	c.(649-651)GCC>ACC	p.A217T	TOMM40L_uc010pkl.1_Missense_Mutation_p.A183T|TOMM40L_uc009wue.2_Missense_Mutation_p.A99T|TOMM40L_uc009wuf.1_RNA|TOMM40L_uc001fze.2_Missense_Mutation_p.A217T	NM_032174	NP_115550	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40	217					protein transport	mitochondrial outer membrane|pore complex	porin activity|voltage-gated anion channel activity			large_intestine(1)	1	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			ATCAGGCGGGGCCCATGCAAG	0.488													14	71	---	---	---	---	capture	Missense_Mutation	SNP	161198259	161198259	TOMM40L	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16242	44
FMOD	2331	broad.mit.edu	37	1	203316988	203316988	+	Silent	SNP	G	A	A	rs141206727		TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:203316988G>A	uc001gzr.2	-	2	547	c.411C>T	c.(409-411)CAC>CAT	p.H137H	FMOD_uc010pqi.1_RNA	NM_002023	NP_002014	Q06828	FMOD_HUMAN	fibromodulin precursor	137	LRR 2.				transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)			TCTGGTTGCCGTGGAGAGCAA	0.557													10	115	---	---	---	---	capture	Silent	SNP	203316988	203316988	FMOD	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5903	44
C1orf107	27042	broad.mit.edu	37	1	210008454	210008454	+	Silent	SNP	A	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:210008454A>G	uc001hhr.1	+	5	673	c.597A>G	c.(595-597)AAA>AAG	p.K199K	C1orf107_uc009xcu.1_5'UTR	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	199					multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		AAGAACTGAAAGAAAAAGCAA	0.403													21	68	---	---	---	---	capture	Silent	SNP	210008454	210008454	C1orf107	1	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	1963	44
CHRM3	1131	broad.mit.edu	37	1	240071276	240071276	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:240071276G>A	uc001hyp.2	+	5	1304	c.525G>A	c.(523-525)ACG>ACA	p.T175T		NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	175	Cytoplasmic (By similarity).				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	GGCCGCTCACGTACCGAGCCA	0.507													85	186	---	---	---	---	capture	Silent	SNP	240071276	240071276	CHRM3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	3343	44
OR2T3	343173	broad.mit.edu	37	1	248637245	248637245	+	Silent	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248637245C>T	uc001iel.1	+	1	594	c.594C>T	c.(592-594)TCC>TCT	p.S198S		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	198	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTGACGTCTCCCTCTATAAGA	0.522													13	186	---	---	---	---	capture	Silent	SNP	248637245	248637245	OR2T3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	10927	44
KLF6	1316	broad.mit.edu	37	10	3827115	3827115	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:3827115T>C	uc001iha.2	-	1	359	c.92A>G	c.(91-93)TAC>TGC	p.Y31C	KLF6_uc010qaj.1_Missense_Mutation_p.Y31C|KLF6_uc010qak.1_RNA|KLF6_uc010qal.1_Missense_Mutation_p.Y31C|KLF6_uc001ihb.2_Missense_Mutation_p.Y31C	NM_001300	NP_001291	Q99612	KLF6_HUMAN	Kruppel-like factor 6 isoform A	31					B cell differentiation	nucleus	zinc ion binding			central_nervous_system(3)|lung(1)	4				Colorectal(1;0.238)		CTGTTGCCAGTACTCCTCCAG	0.567													3	29	---	---	---	---	capture	Missense_Mutation	SNP	3827115	3827115	KLF6	10	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	8270	44
FAM21C	253725	broad.mit.edu	37	10	46265058	46265058	+	Silent	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:46265058C>T	uc001jcu.2	+	20	2130	c.2031C>T	c.(2029-2031)GCC>GCT	p.A677A	FAM21C_uc001jcs.1_Silent_p.A620A|FAM21C_uc001jct.2_Silent_p.A675A|FAM21C_uc010qfi.1_Silent_p.A653A|FAM21C_uc010qfj.1_5'UTR|FAM21C_uc010qfk.1_5'UTR	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725	677										ovary(1)	1						TTGCCATTGCCAAGGACAGGT	0.478													48	249	---	---	---	---	capture	Silent	SNP	46265058	46265058	FAM21C	10	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	5492	44
PTEN	5728	broad.mit.edu	37	10	89720794	89720794	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720794T>A	uc001kfb.2	+	9	1976	c.945T>A	c.(943-945)TAT>TAA	p.Y315*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	315	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.Y315fs*9(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*2(1)|p.W274_F341del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ACAAGGAATATCTAGTACTTA	0.328		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			36	44	---	---	---	---	capture	Nonsense_Mutation	SNP	89720794	89720794	PTEN	10	T	A	A	A	1	0	0	0	0	0	1	0	0	647	50	5	4	12633	44
TPP1	1200	broad.mit.edu	37	11	6637552	6637552	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6637552C>T	uc001mel.1	-	8	1130	c.1069G>A	c.(1069-1071)GCC>ACC	p.A357T	TPP1_uc001mek.1_Missense_Mutation_p.A114T	NM_000391	NP_000382	O14773	TPP1_HUMAN	tripeptidyl-peptidase I preproprotein	357					bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)		TCACCTGAGGCGAAGAGCAGG	0.567													40	155	---	---	---	---	capture	Missense_Mutation	SNP	6637552	6637552	TPP1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16294	44
CTR9	9646	broad.mit.edu	37	11	10774300	10774300	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:10774300A>G	uc001mja.2	+	2	276	c.127A>G	c.(127-129)ATA>GTA	p.I43V		NM_014633	NP_055448	Q6PD62	CTR9_HUMAN	SH2 domain binding protein 1	43	TPR 1.				histone H2B ubiquitination|histone monoubiquitination	Cdc73/Paf1 complex|nuclear speck				ovary(2)	2				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		ACAACTGCACATATGGATTGC	0.363													8	125	---	---	---	---	capture	Missense_Mutation	SNP	10774300	10774300	CTR9	11	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	3987	44
LUZP2	338645	broad.mit.edu	37	11	24936063	24936063	+	Silent	SNP	G	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:24936063G>C	uc001mqs.2	+	7	735	c.501G>C	c.(499-501)GGG>GGC	p.G167G	LUZP2_uc009yif.2_Silent_p.G81G|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor	167	Potential.|Leucine-zipper.					extracellular region				ovary(1)|skin(1)	2						TTCGTTATGGGAAGAAGGATT	0.318													9	13	---	---	---	---	capture	Silent	SNP	24936063	24936063	LUZP2	11	G	C	C	C	1	0	0	0	0	0	0	0	1	522	41	4	4	9002	44
LRP4	4038	broad.mit.edu	37	11	46880714	46880714	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46880714G>A	uc001ndn.3	-	38	5684	c.5538C>T	c.(5536-5538)GAC>GAT	p.D1846D	uc001ndl.2_Intron|LRP4_uc001ndm.3_Silent_p.D88D	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1846	Cytoplasmic (Potential).				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		TGGACACCGTGTCTGTCTTCA	0.582													14	116	---	---	---	---	capture	Silent	SNP	46880714	46880714	LRP4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	8875	44
OR5F1	338674	broad.mit.edu	37	11	55761167	55761167	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55761167G>A	uc010riv.1	-	1	935	c.935C>T	c.(934-936)TCC>TTC	p.S312F		NM_003697	NP_003688	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F,	312	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					TCACAGAAAGGAAGAGGTCCT	0.338													18	48	---	---	---	---	capture	Missense_Mutation	SNP	55761167	55761167	OR5F1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11062	44
OR9G9	504191	broad.mit.edu	37	11	56468297	56468297	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56468297C>A	uc010rjn.1	+	1	434	c.434C>A	c.(433-435)GCA>GAA	p.A145E		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTGCTGGTAGCAGTCTCATAT	0.463													45	316	---	---	---	---	capture	Missense_Mutation	SNP	56468297	56468297	OR9G9	11	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	11156	44
DPF2	5977	broad.mit.edu	37	11	65107936	65107936	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65107936G>A	uc001odm.2	+	2	125	c.113G>A	c.(112-114)CGC>CAC	p.R38H	DPF2_uc001odn.2_Missense_Mutation_p.R38H|DPF2_uc010roe.1_Missense_Mutation_p.R38H	NM_006268	NP_006259	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	38					apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						CGCAGCGTGCGCCTGCCTTTC	0.552													8	201	---	---	---	---	capture	Missense_Mutation	SNP	65107936	65107936	DPF2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4672	44
PGR	5241	broad.mit.edu	37	11	100999454	100999454	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:100999454G>C	uc001pgh.2	-	1	1091	c.348C>G	c.(346-348)GAC>GAG	p.D116E	PGR_uc001pgi.2_Missense_Mutation_p.D116E|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA|uc010rum.1_5'Flank	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	116	Modulating, Pro-Rich.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	CCAACAGAGTGTCCAAGACAC	0.622													8	20	---	---	---	---	capture	Missense_Mutation	SNP	100999454	100999454	PGR	11	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	11708	44
DDI1	414301	broad.mit.edu	37	11	103908056	103908056	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:103908056A>C	uc001phr.2	+	1	749	c.506A>C	c.(505-507)GAA>GCA	p.E169A	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	169					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CCCTTGGCGGAAGCCCTGCTC	0.602													33	135	---	---	---	---	capture	Missense_Mutation	SNP	103908056	103908056	DDI1	11	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	4287	44
SPATA19	219938	broad.mit.edu	37	11	133711992	133711992	+	Missense_Mutation	SNP	C	T	T	rs140608295		TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:133711992C>T	uc001qgv.1	-	6	497	c.446G>A	c.(445-447)CGT>CAT	p.R149H		NM_174927	NP_777587	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19 precursor	149					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrial outer membrane					0	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		ATCTGTAAGACGGGATATGCT	0.602													15	147	---	---	---	---	capture	Missense_Mutation	SNP	133711992	133711992	SPATA19	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14896	44
CLEC1A	51267	broad.mit.edu	37	12	10241786	10241786	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10241786C>T	uc001qxb.2	-	2	235	c.151G>A	c.(151-153)GCC>ACC	p.A51T	CLEC1A_uc009zhf.2_5'UTR|CLEC1A_uc001qxc.2_5'UTR|CLEC1A_uc001qxd.2_Intron|CLEC1A_uc010sgx.1_Intron	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1	51	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2						AGGGTCAGGGCCACTGGTCGC	0.547													34	62	---	---	---	---	capture	Missense_Mutation	SNP	10241786	10241786	CLEC1A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3470	44
LST-3TM12	338821	broad.mit.edu	37	12	21168708	21168708	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21168708G>A	uc010sin.1	+	1	79	c.79G>A	c.(79-81)GAA>AAA	p.E27K	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	27						membrane	transporter activity				0						TGGAAGCTTCGAAATAGGTAG	0.244													5	12	---	---	---	---	capture	Missense_Mutation	SNP	21168708	21168708	LST-3TM12	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8981	44
ABCC9	10060	broad.mit.edu	37	12	22005399	22005399	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:22005399T>C	uc001rfi.1	-	21	2566	c.2546A>G	c.(2545-2547)CAT>CGT	p.H849R	ABCC9_uc001rfh.2_Missense_Mutation_p.H849R|ABCC9_uc001rfj.1_Missense_Mutation_p.H813R	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	849	Cytoplasmic (Potential).|ABC transporter 1.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CTGCATTAAATGATCACTCAA	0.403													41	69	---	---	---	---	capture	Missense_Mutation	SNP	22005399	22005399	ABCC9	12	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	59	44
ARNTL2	56938	broad.mit.edu	37	12	27521311	27521311	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27521311C>T	uc001rht.1	+	2	166	c.148C>T	c.(148-150)CGA>TGA	p.R50*	ARNTL2_uc001rhw.2_Nonsense_Mutation_p.R61*|ARNTL2_uc010sjp.1_Nonsense_Mutation_p.R61*|ARNTL2_uc001rhu.1_Nonsense_Mutation_p.R50*|ARNTL2_uc009zji.1_Nonsense_Mutation_p.R50*|ARNTL2_uc001rhv.1_Nonsense_Mutation_p.R50*	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear	50					circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					AGAGTTTCCACGAAAACGCAA	0.483													37	71	---	---	---	---	capture	Nonsense_Mutation	SNP	27521311	27521311	ARNTL2	12	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	961	44
ASB8	140461	broad.mit.edu	37	12	48543629	48543629	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48543629G>T	uc001rrh.2	-	4	556	c.387C>A	c.(385-387)AAC>AAA	p.N129K	ASB8_uc010slr.1_Missense_Mutation_p.N125K	NM_024095	NP_077000	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box-containing 8	129	ANK 3.				intracellular signal transduction	cytoplasm|nucleus				kidney(1)	1						ACTCAGCATTGTTCTTAAAGG	0.527													48	95	---	---	---	---	capture	Missense_Mutation	SNP	48543629	48543629	ASB8	12	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	1020	44
SMARCC2	6601	broad.mit.edu	37	12	56563342	56563342	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56563342C>T	uc001skb.2	-	24	2699	c.2593G>A	c.(2593-2595)GCC>ACC	p.A865T	SMARCC2_uc001skd.2_Missense_Mutation_p.A896T|SMARCC2_uc001ska.2_Missense_Mutation_p.A896T|SMARCC2_uc001skc.2_Missense_Mutation_p.A895T|SMARCC2_uc010sqf.1_Missense_Mutation_p.A785T	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated	865	Poly-Ala.				chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			gcggccagggcggcggcagca	0.244													7	68	---	---	---	---	capture	Missense_Mutation	SNP	56563342	56563342	SMARCC2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14668	44
FGD6	55785	broad.mit.edu	37	12	95603382	95603382	+	Missense_Mutation	SNP	G	A	A	rs149076340	byFrequency	TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95603382G>A	uc001tdp.3	-	2	1902	c.1678C>T	c.(1678-1680)CGG>TGG	p.R560W	FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	560					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						TCTGAAGCCCGTTTAGGCATA	0.423													57	158	---	---	---	---	capture	Missense_Mutation	SNP	95603382	95603382	FGD6	12	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	5783	44
CDK17	5128	broad.mit.edu	37	12	96688901	96688901	+	Splice_Site	SNP	C	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96688901C>G	uc001tep.1	-	10	1363	c.874_splice	c.e10-1	p.L292_splice	CDK17_uc009ztk.2_Splice_Site_p.L292_splice|CDK17_uc010svb.1_Splice_Site_p.L239_splice	NM_002595	NP_002586	Q00537	CDK17_HUMAN	PCTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity			ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						ACAGAAACAGCTACAGAAACA	0.358													19	69	---	---	---	---	capture	Splice_Site	SNP	96688901	96688901	CDK17	12	C	G	G	G	1	0	0	0	0	0	0	1	0	364	28	5	4	3103	44
ZIC2	7546	broad.mit.edu	37	13	100634942	100634942	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:100634942G>A	uc001von.2	+	1	624	c.624G>A	c.(622-624)GCG>GCA	p.A208A		NM_007129	NP_009060	O95409	ZIC2_HUMAN	zinc finger protein of the cerebellum 2	208	Necessary for interaction with MDFIC and transcriptional activation or repression (By similarity).				brain development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|visual perception	cytoplasm|nucleus	chromatin DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ACTCGGCGGCGCAACTCCACA	0.577													10	33	---	---	---	---	capture	Silent	SNP	100634942	100634942	ZIC2	13	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17559	44
MDGA2	161357	broad.mit.edu	37	14	47530541	47530541	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:47530541G>A	uc001wwj.3	-	7	1425	c.1229C>T	c.(1228-1230)ACG>ATG	p.T410M	MDGA2_uc001wwi.3_Missense_Mutation_p.T181M|MDGA2_uc010ani.2_Translation_Start_Site	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	410	Ig-like 4.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CCCAAAATCCGTGAATTTTAA	0.428													5	44	---	---	---	---	capture	Missense_Mutation	SNP	47530541	47530541	MDGA2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9320	44
OR4N4	283694	broad.mit.edu	37	15	22382513	22382513	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:22382513T>A	uc001yuc.1	+	7	1022	c.41T>A	c.(40-42)CTC>CAC	p.L14H	LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Missense_Mutation_p.L14H	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		GAATTTATCCTCCTTGGTCTG	0.343													76	134	---	---	---	---	capture	Missense_Mutation	SNP	22382513	22382513	OR4N4	15	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	10982	44
GABRB3	2562	broad.mit.edu	37	15	26812854	26812854	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26812854A>G	uc001zaz.2	-	7	851	c.709T>C	c.(709-711)TTT>CTT	p.F237L	GABRB3_uc010uae.1_Missense_Mutation_p.F152L|GABRB3_uc001zba.2_Missense_Mutation_p.F237L|GABRB3_uc001zbb.2_Missense_Mutation_p.F293L	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	237	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TTCAACCGAAAGCTCAGTGAC	0.418													18	46	---	---	---	---	capture	Missense_Mutation	SNP	26812854	26812854	GABRB3	15	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	6110	44
TTBK2	146057	broad.mit.edu	37	15	43038437	43038437	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43038437G>A	uc001zqo.2	-	15	3730	c.3291C>T	c.(3289-3291)GTC>GTT	p.V1097V	TTBK2_uc010bcy.2_Silent_p.V1028V|uc001zqn.2_5'Flank	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	1097					cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		TACTCCCTAGGACTTTATATC	0.393													19	39	---	---	---	---	capture	Silent	SNP	43038437	43038437	TTBK2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	16559	44
USP50	373509	broad.mit.edu	37	15	50838708	50838708	+	Silent	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50838708C>T	uc001zyq.3	-	1	195	c.15G>A	c.(13-15)CCG>CCA	p.P5P		NM_203494	NP_987090	E9PP86	E9PP86_HUMAN	ubiquitin specific protease 50	5					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			lung(1)|breast(1)	2				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		CAGGGAGAGACGGCTGAGAAG	0.453													14	80	---	---	---	---	capture	Silent	SNP	50838708	50838708	USP50	15	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	16964	44
GRIN2A	2903	broad.mit.edu	37	16	9858210	9858210	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9858210G>A	uc002czo.3	-	13	3739	c.3191C>T	c.(3190-3192)ACG>ATG	p.T1064M	GRIN2A_uc010uym.1_Missense_Mutation_p.T1064M|GRIN2A_uc010uyn.1_Missense_Mutation_p.T907M|GRIN2A_uc002czr.3_Missense_Mutation_p.T1064M	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1064	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CCGATTTGACGTTTCTGAAAT	0.507													86	268	---	---	---	---	capture	Missense_Mutation	SNP	9858210	9858210	GRIN2A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6712	44
HERPUD1	9709	broad.mit.edu	37	16	56973164	56973164	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56973164G>A	uc002eke.1	+	5	856	c.447G>A	c.(445-447)CAG>CAA	p.Q149Q	HERPUD1_uc002ekf.1_Silent_p.Q148Q|HERPUD1_uc002ekg.1_Silent_p.Q124Q|HERPUD1_uc010cco.1_Silent_p.Q210Q|HERPUD1_uc010ccp.1_Intron|HERPUD1_uc002ekh.1_5'UTR	NM_014685	NP_055500	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum	149	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	protein binding				0						AAGCTGCCCAGCAGGCATTCC	0.423			T	ERG	prostate								30	321	---	---	---	---	capture	Silent	SNP	56973164	56973164	HERPUD1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	6989	44
TAT	6898	broad.mit.edu	37	16	71603782	71603782	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71603782C>T	uc002fap.2	-	10	1199	c.1100G>A	c.(1099-1101)CGC>CAC	p.R367H		NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase	367					2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	CCCAGAAGGGCGGACTGGCCG	0.512													16	37	---	---	---	---	capture	Missense_Mutation	SNP	71603782	71603782	TAT	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15478	44
MYO1D	4642	broad.mit.edu	37	17	31105570	31105570	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:31105570G>A	uc002hho.1	-	3	338	c.326C>T	c.(325-327)ACG>ATG	p.T109M	MYO1D_uc002hhp.1_Missense_Mutation_p.T109M|MYO1D_uc010wcb.1_Missense_Mutation_p.T109M	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	109	ATP (Potential).|Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			ACTGGCTTCCGTTTTACCAGC	0.393													5	73	---	---	---	---	capture	Missense_Mutation	SNP	31105570	31105570	MYO1D	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9981	44
HOXB13	10481	broad.mit.edu	37	17	46804366	46804366	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46804366C>T	uc002ioa.2	-	2	797	c.641G>A	c.(640-642)CGT>CAT	p.R214H	hsa-mir-3185|MI0014227_5'Flank	NM_006361	NP_006352	Q92826	HXB13_HUMAN	homeobox B13	214					angiogenesis|epidermis development|response to wounding		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCGGCCGCGACGAAAGGCGCA	0.622													25	77	---	---	---	---	capture	Missense_Mutation	SNP	46804366	46804366	HOXB13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7225	44
ANKRD30B	374860	broad.mit.edu	37	18	14851607	14851607	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14851607C>T	uc010dlo.2	+	36	3487	c.3307C>T	c.(3307-3309)CAT>TAT	p.H1103Y	ANKRD30B_uc010xal.1_Missense_Mutation_p.H245Y	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1188	Potential.									ovary(1)|skin(1)	2						CACACTGAAACATCAACACCA	0.343													3	7	---	---	---	---	capture	Missense_Mutation	SNP	14851607	14851607	ANKRD30B	18	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	655	44
DSG3	1830	broad.mit.edu	37	18	29052301	29052301	+	Missense_Mutation	SNP	T	A	A	rs113457225		TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29052301T>A	uc002kws.2	+	13	2061	c.1952T>A	c.(1951-1953)GTG>GAG	p.V651E	DSG3_uc002kwt.2_5'Flank	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	651	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ACTGGGGGAGTGACAGGTGGT	0.478													4	117	---	---	---	---	capture	Missense_Mutation	SNP	29052301	29052301	DSG3	18	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	4733	44
LPHN1	22859	broad.mit.edu	37	19	14261968	14261968	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14261968C>T	uc010xnn.1	-	24	4438	c.4142G>A	c.(4141-4143)CGG>CAG	p.R1381Q	LPHN1_uc010xno.1_Missense_Mutation_p.R1376Q|uc002myf.2_Intron	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	1381	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						GAGGGAGTCCCGGCCAGGAGG	0.731													6	15	---	---	---	---	capture	Missense_Mutation	SNP	14261968	14261968	LPHN1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8831	44
CYP4F3	4051	broad.mit.edu	37	19	15770048	15770048	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15770048G>A	uc002nbj.2	+	13	1466	c.1416G>A	c.(1414-1416)GCG>GCA	p.A472A	CYP4F3_uc010xok.1_Silent_p.A472A|CYP4F3_uc010xol.1_Silent_p.A472A|CYP4F3_uc010xom.1_Silent_p.A323A|CYP4F3_uc002nbk.2_Silent_p.A472A|CYP4F3_uc010xon.1_Silent_p.A182A	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	472					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						TCGGGCAGGCGTTCGCGATGG	0.672													11	84	---	---	---	---	capture	Silent	SNP	15770048	15770048	CYP4F3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4150	44
CYP4F2	8529	broad.mit.edu	37	19	15989728	15989728	+	Silent	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15989728C>T	uc002nbs.1	-	13	1466	c.1416G>A	c.(1414-1416)ACG>ACA	p.T472T	CYP4F2_uc010xot.1_Silent_p.T323T	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	472					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						CCATCGCGAACGTCTGCCCGA	0.672													7	135	---	---	---	---	capture	Silent	SNP	15989728	15989728	CYP4F2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4148	44
ZNF430	80264	broad.mit.edu	37	19	21239692	21239692	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:21239692A>G	uc002npj.2	+	5	688	c.578A>G	c.(577-579)AAT>AGT	p.N193S	ZNF430_uc002npk.2_Missense_Mutation_p.N192S	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	193					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						TCAAATCCAAATATACAAAAG	0.279													11	48	---	---	---	---	capture	Missense_Mutation	SNP	21239692	21239692	ZNF430	19	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	17784	44
IRGC	56269	broad.mit.edu	37	19	44223553	44223553	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44223553G>A	uc002oxh.2	+	2	990	c.843G>A	c.(841-843)CCG>CCA	p.P281P		NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	281						membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)				AGGCCCTGCCGGTCCCAGGGC	0.632													8	157	---	---	---	---	capture	Silent	SNP	44223553	44223553	IRGC	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7761	44
LILRB1	10859	broad.mit.edu	37	19	55143186	55143186	+	Silent	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55143186C>T	uc002qgj.2	+	5	646	c.306C>T	c.(304-306)AGC>AGT	p.S102S	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Silent_p.S102S|LILRB1_uc002qgk.2_Silent_p.S102S|LILRB1_uc002qgm.2_Silent_p.S102S|LILRB1_uc010erq.2_Silent_p.S102S|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	102	Ig-like C2-type 1.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		ACTATGGTAGCGACACTGCAG	0.602										HNSCC(37;0.09)			9	169	---	---	---	---	capture	Silent	SNP	55143186	55143186	LILRB1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	8710	44
HPCAL1	3241	broad.mit.edu	37	2	10560060	10560060	+	Silent	SNP	C	T	T	rs142524922		TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:10560060C>T	uc002raj.2	+	3	551	c.177C>T	c.(175-177)GGC>GGT	p.G59G	HPCAL1_uc002rak.2_Silent_p.G59G|HPCAL1_uc002ral.2_Silent_p.G59G|HPCAL1_uc010exe.2_RNA|HPCAL1_uc010exf.2_Silent_p.G59G	NM_002149	NP_002140	P37235	HPCL1_HUMAN	hippocalcin-like 1	59							calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)		TCCCCTACGGCGACGCTTCCA	0.602													9	114	---	---	---	---	capture	Silent	SNP	10560060	10560060	HPCAL1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7255	44
FAM123C	205147	broad.mit.edu	37	2	131521170	131521170	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131521170G>A	uc002trw.2	+	2	1715	c.1525G>A	c.(1525-1527)GTC>ATC	p.V509I	FAM123C_uc010fmv.2_Missense_Mutation_p.V509I|FAM123C_uc010fms.1_Missense_Mutation_p.V509I|FAM123C_uc010fmt.1_Missense_Mutation_p.V509I|FAM123C_uc010fmu.1_Missense_Mutation_p.V509I	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	509										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CATGGGCATCGTCAGCTGGCT	0.677													12	21	---	---	---	---	capture	Missense_Mutation	SNP	131521170	131521170	FAM123C	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5378	44
HECW2	57520	broad.mit.edu	37	2	197183877	197183877	+	Silent	SNP	G	A	A	rs111271189	byFrequency	TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:197183877G>A	uc002utm.1	-	9	1920	c.1737C>T	c.(1735-1737)GGC>GGT	p.G579G	HECW2_uc002utl.1_Silent_p.G223G	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	579					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						CTGTGTCTGCGCCACTTGTGG	0.607													28	74	---	---	---	---	capture	Silent	SNP	197183877	197183877	HECW2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6969	44
ALS2CR12	130540	broad.mit.edu	37	2	202154207	202154207	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202154207A>C	uc010ftg.2	-	14	1628	c.1184T>G	c.(1183-1185)ATC>AGC	p.I395S	ALS2CR12_uc002uya.3_Missense_Mutation_p.I372S|ALS2CR12_uc010fth.2_RNA	NM_139163	NP_631902	Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	395	Potential.				regulation of GTPase activity		protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						TTCCGTCAGGATCTGTATGGT	0.413													52	176	---	---	---	---	capture	Missense_Mutation	SNP	202154207	202154207	ALS2CR12	2	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	553	44
TRPM8	79054	broad.mit.edu	37	2	234869620	234869620	+	Silent	SNP	C	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234869620C>A	uc002vvh.2	+	12	1603	c.1563C>A	c.(1561-1563)CTC>CTA	p.L521L	TRPM8_uc010fyj.2_Silent_p.L209L	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	521	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	ATGCCCTCCTCACGTTTGTCT	0.507													36	70	---	---	---	---	capture	Silent	SNP	234869620	234869620	TRPM8	2	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	16475	44
PLCG1	5335	broad.mit.edu	37	20	39801169	39801169	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39801169G>A	uc002xjp.1	+	26	3135	c.3014G>A	c.(3013-3015)CGA>CAA	p.R1005Q	PLCG1_uc002xjo.1_Missense_Mutation_p.R1005Q|PLCG1_uc010zwe.1_Missense_Mutation_p.R631Q	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	1005	PI-PLC Y-box.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				CAGTACAATCGACTGCAGCTC	0.542													21	78	---	---	---	---	capture	Missense_Mutation	SNP	39801169	39801169	PLCG1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11938	44
TMPRSS15	5651	broad.mit.edu	37	21	19647560	19647560	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19647560T>A	uc002ykw.2	-	24	2889	c.2858A>T	c.(2857-2859)AAT>ATT	p.N953I		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	953	Extracellular (Potential).|Peptidase S1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						ACATATCATATTTTCAGTAAT	0.383													37	120	---	---	---	---	capture	Missense_Mutation	SNP	19647560	19647560	TMPRSS15	21	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	16129	44
MX2	4600	broad.mit.edu	37	21	42778692	42778692	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:42778692G>A	uc002yzf.1	+	13	1776	c.1672G>A	c.(1672-1674)GTG>ATG	p.V558M	MX2_uc002yzg.1_Missense_Mutation_p.V281M|MX2_uc010gop.1_Missense_Mutation_p.V40M	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	558					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				AGACATAAAAGTGAAACACAC	0.343													11	88	---	---	---	---	capture	Missense_Mutation	SNP	42778692	42778692	MX2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	9908	44
KRTAP10-3	386682	broad.mit.edu	37	21	45978487	45978487	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45978487C>T	uc002zfj.1	-	1	157	c.112G>A	c.(112-114)GCC>ACC	p.A38T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	38	3.|18 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						GGGGCCGGGGCGCAGCAGCTG	0.697													8	66	---	---	---	---	capture	Missense_Mutation	SNP	45978487	45978487	KRTAP10-3	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8430	44
GAL3ST1	9514	broad.mit.edu	37	22	30951019	30951019	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30951019A>C	uc003aig.1	-	4	1333	c.1193T>G	c.(1192-1194)ATC>AGC	p.I398S	GAL3ST1_uc003aih.1_Missense_Mutation_p.I398S|GAL3ST1_uc003aii.1_Missense_Mutation_p.I398S|GAL3ST1_uc010gvz.1_Missense_Mutation_p.I398S	NM_004861	NP_004852	Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	398	Lumenal (Potential).				protein N-linked glycosylation	Golgi membrane|integral to plasma membrane|membrane fraction	galactosylceramide sulfotransferase activity				0						CAGGTACTGGATCTCGGGCGT	0.642													39	98	---	---	---	---	capture	Missense_Mutation	SNP	30951019	30951019	GAL3ST1	22	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	6137	44
GOLGA4	2803	broad.mit.edu	37	3	37369037	37369037	+	Nonsense_Mutation	SNP	T	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:37369037T>G	uc003cgv.2	+	14	5964	c.5660T>G	c.(5659-5661)TTA>TGA	p.L1887*	GOLGA4_uc010hgr.1_Nonsense_Mutation_p.L1448*|GOLGA4_uc003cgw.2_Nonsense_Mutation_p.L1909*|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Nonsense_Mutation_p.L1768*	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	1887	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						TTACAGGCTTTACAACAGATG	0.353													6	36	---	---	---	---	capture	Nonsense_Mutation	SNP	37369037	37369037	GOLGA4	3	T	G	G	G	1	0	0	0	0	0	1	0	0	793	61	5	4	6491	44
ATP13A4	84239	broad.mit.edu	37	3	193160209	193160209	+	Silent	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:193160209C>T	uc003ftd.2	-	19	2397	c.2289G>A	c.(2287-2289)GAG>GAA	p.E763E	ATP13A4_uc003fte.1_Silent_p.E763E|ATP13A4_uc011bsr.1_Silent_p.E234E|ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	763	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TGTGTTTCTTCTCTTCTACTA	0.433													5	40	---	---	---	---	capture	Silent	SNP	193160209	193160209	ATP13A4	3	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	1117	44
TMEM174	134288	broad.mit.edu	37	5	72469988	72469988	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72469988G>A	uc010izc.2	+	2	776	c.728G>A	c.(727-729)CGC>CAC	p.R243H		NM_153217	NP_694949	Q8WUU8	TM174_HUMAN	transmembrane protein 174	243						integral to membrane				ovary(1)	1		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		TCTCTCCCTCGCTAGAGGCTA	0.478													51	84	---	---	---	---	capture	Missense_Mutation	SNP	72469988	72469988	TMEM174	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15973	44
PCDHGB4	8641	broad.mit.edu	37	5	140768990	140768990	+	Silent	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140768990C>T	uc003lkc.1	+	1	1539	c.1539C>T	c.(1537-1539)TTC>TTT	p.F513F	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.F513F	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	513	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTGGTGTTCGCGCAGCGCG	0.667													45	154	---	---	---	---	capture	Silent	SNP	140768990	140768990	PCDHGB4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	11468	44
WWC1	23286	broad.mit.edu	37	5	167868746	167868746	+	Nonsense_Mutation	SNP	G	A	A	rs148699341		TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167868746G>A	uc003lzu.2	+	16	2433	c.2340G>A	c.(2338-2340)TGG>TGA	p.W780*	WWC1_uc003lzv.2_Nonsense_Mutation_p.W780*|WWC1_uc011den.1_Nonsense_Mutation_p.W780*|WWC1_uc003lzw.2_Nonsense_Mutation_p.W579*|WWC1_uc010jjf.1_Nonsense_Mutation_p.W47*	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3	780	C2.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CGACTCGCTGGTACAACCTTC	0.602													21	89	---	---	---	---	capture	Nonsense_Mutation	SNP	167868746	167868746	WWC1	5	G	A	A	A	1	0	0	0	0	0	1	0	0	572	44	5	2	17292	44
OR2B2	81697	broad.mit.edu	37	6	27879956	27879956	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27879956C>T	uc011dkw.1	-	1	142	c.142G>A	c.(142-144)GTG>ATG	p.V48M		NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B,	48	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACATGTGACACAAGAATTATT	0.388													6	101	---	---	---	---	capture	Missense_Mutation	SNP	27879956	27879956	OR2B2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	10893	44
MAS1L	116511	broad.mit.edu	37	6	29455605	29455605	+	Silent	SNP	G	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29455605G>C	uc011dlq.1	-	1	75	c.75C>G	c.(73-75)CTC>CTG	p.L25L		NM_052967	NP_443199	P35410	MAS1L_HUMAN	MAS1 oncogene-like	25	Extracellular (Potential).					cytoplasm|integral to membrane|nucleus|plasma membrane	G-protein coupled receptor activity			ovary(7)|lung(2)	9						GGCTACATGAGAGAGATATCT	0.522													9	151	---	---	---	---	capture	Silent	SNP	29455605	29455605	MAS1L	6	G	C	C	C	1	0	0	0	0	0	0	0	1	418	33	4	4	9234	44
HLA-F	3134	broad.mit.edu	37	6	29691648	29691648	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29691648A>G	uc010jrl.2	+	2	402	c.278A>G	c.(277-279)CAG>CGG	p.Q93R	HLA-F_uc003nnm.3_Missense_Mutation_p.Q93R|HLA-F_uc003nno.3_Missense_Mutation_p.Q93R|HLA-F_uc011dlx.1_Missense_Mutation_p.Q93R|HLA-F_uc011dly.1_RNA	NM_018950	NP_061823	P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	93	Alpha-1.|Extracellular (Potential).				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity				0						GCCAACGCACAGACTGACCGA	0.682													6	14	---	---	---	---	capture	Missense_Mutation	SNP	29691648	29691648	HLA-F	6	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	7136	44
AGPAT1	10554	broad.mit.edu	37	6	32139093	32139093	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32139093G>A	uc003oae.2	-	2	499	c.181C>T	c.(181-183)CGC>TGC	p.R61C	PPT2_uc003nzy.1_RNA|AGPAT1_uc011dpj.1_RNA|AGPAT1_uc011dpk.1_Missense_Mutation_p.T54M|AGPAT1_uc003oaf.2_Missense_Mutation_p.R61C|AGPAT1_uc003oag.2_Missense_Mutation_p.T54M|AGPAT1_uc003oah.2_Missense_Mutation_p.R61C|AGPAT1_uc003oai.1_Missense_Mutation_p.R61C|AGPAT1_uc011dpl.1_Translation_Start_Site	NM_006411	NP_006402	Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	61					energy reserve metabolic process|phosphatidic acid biosynthetic process|positive regulation of cellular metabolic process|positive regulation of cytokine production|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			central_nervous_system(1)	1						TCGACGTTGCGTCCTCGCACG	0.567													75	161	---	---	---	---	capture	Missense_Mutation	SNP	32139093	32139093	AGPAT1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	386	44
MAPK13	5603	broad.mit.edu	37	6	36099124	36099124	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36099124G>A	uc003ols.2	+	2	294	c.196G>A	c.(196-198)GCC>ACC	p.A66T	MAPK13_uc003olt.2_RNA	NM_002754	NP_002745	O15264	MK13_HUMAN	mitogen-activated protein kinase 13	66	Protein kinase.				cell cycle|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|positive regulation of interleukin-6 production|Ras protein signal transduction|response to stress		ATP binding|MAP kinase activity|protein binding			breast(2)|central_nervous_system(1)	3						CGAGATCTTCGCCAAGCGCGC	0.662													34	96	---	---	---	---	capture	Missense_Mutation	SNP	36099124	36099124	MAPK13	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9188	44
TDRD6	221400	broad.mit.edu	37	6	46659003	46659003	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46659003T>A	uc003oyj.2	+	1	3138	c.3138T>A	c.(3136-3138)GAT>GAA	p.D1046E	TDRD6_uc010jze.2_Missense_Mutation_p.D1040E	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1046	Tudor 5.				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			AGTATACTGATGGAAACTGGT	0.358													37	54	---	---	---	---	capture	Missense_Mutation	SNP	46659003	46659003	TDRD6	6	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	15619	44
TAAR1	134864	broad.mit.edu	37	6	132966960	132966960	+	Silent	SNP	G	C	C			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:132966960G>C	uc003qdm.1	-	1	183	c.183C>G	c.(181-183)CTC>CTG	p.L61L		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	61	Helical; Name=2; (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	TGGAATGAATGAGCCAATTTG	0.423													5	74	---	---	---	---	capture	Silent	SNP	132966960	132966960	TAAR1	6	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	15377	44
GRM1	2911	broad.mit.edu	37	6	146350618	146350618	+	Translation_Start_Site	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146350618C>T	uc010khw.1	+	2	435	c.-35C>T	c.(-37--33)AACGC>AATGC		GRM1_uc010khu.1_Translation_Start_Site|GRM1_uc010khv.1_Translation_Start_Site|GRM1_uc003qll.2_Translation_Start_Site|GRM1_uc011edz.1_Translation_Start_Site|GRM1_uc011eea.1_Translation_Start_Site	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	AGCGTGGGAACGCGGCTGGCA	0.647													25	92	---	---	---	---	capture	Translation_Start_Site	SNP	146350618	146350618	GRM1	6	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	6729	44
SNX9	51429	broad.mit.edu	37	6	158331016	158331016	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158331016C>T	uc003qqv.1	+	9	1081	c.908C>T	c.(907-909)TCA>TTA	p.S303L		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	303	PX.				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		AAGTTTGGGTCAGCCATTCCA	0.408													27	114	---	---	---	---	capture	Missense_Mutation	SNP	158331016	158331016	SNX9	6	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	14801	44
GPR141	353345	broad.mit.edu	37	7	37780793	37780793	+	Silent	SNP	C	T	T	rs146749644	byFrequency	TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37780793C>T	uc003tfm.1	+	1	798	c.798C>T	c.(796-798)AAC>AAT	p.N266N	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	266	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						CATTTTATAACGAAATCTTCT	0.383													54	226	---	---	---	---	capture	Silent	SNP	37780793	37780793	GPR141	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6583	44
HIPK2	28996	broad.mit.edu	37	7	139316027	139316027	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139316027G>A	uc003vvf.3	-	4	1405	c.1231C>T	c.(1231-1233)CGG>TGG	p.R411W	HIPK2_uc003vvd.3_Missense_Mutation_p.R411W	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	411	Protein kinase.|Interaction with DAXX.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					GAAATATACCGAATCTGCAAG	0.408													5	24	---	---	---	---	capture	Missense_Mutation	SNP	139316027	139316027	HIPK2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	7042	44
KEL	3792	broad.mit.edu	37	7	142658446	142658446	+	Splice_Site	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142658446C>T	uc003wcb.2	-	3	433	c.223_splice	c.e3+1	p.R75_splice		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					ATCTTGCTTACGAGGGCCACA	0.602													31	105	---	---	---	---	capture	Splice_Site	SNP	142658446	142658446	KEL	7	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	8064	44
PRUNE2	158471	broad.mit.edu	37	9	79322930	79322930	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79322930G>A	uc010mpk.2	-	8	4384	c.4260C>T	c.(4258-4260)TCC>TCT	p.S1420S		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	1420					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						GGTTATCTGCGGACATCCCTG	0.443													25	127	---	---	---	---	capture	Silent	SNP	79322930	79322930	PRUNE2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	12536	44
CYBB	1536	broad.mit.edu	37	X	37663372	37663372	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37663372G>A	uc004ddr.2	+	9	1201	c.1140G>A	c.(1138-1140)TGG>TGA	p.W380*	CYBB_uc011mke.1_RNA|CYBB_uc011mkf.1_Nonsense_Mutation_p.W348*|CYBB_uc011mkg.1_Nonsense_Mutation_p.W113*	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide	380	Cytoplasmic (Potential).|FAD-binding FR-type.				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						AAGATGCGTGGAAACTACCTA	0.423													21	29	---	---	---	---	capture	Nonsense_Mutation	SNP	37663372	37663372	CYBB	23	G	A	A	A	1	0	0	0	0	0	1	0	0	533	41	5	2	4093	44
ZCCHC5	203430	broad.mit.edu	37	X	77913863	77913863	+	Missense_Mutation	SNP	G	A	A	rs148985625		TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77913863G>A	uc004edc.1	-	2	351	c.55C>T	c.(55-57)CGG>TGG	p.R19W		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	19							nucleic acid binding|zinc ion binding			ovary(1)	1						TGAGCCTGCCGAATTTCATTC	0.463													11	12	---	---	---	---	capture	Missense_Mutation	SNP	77913863	77913863	ZCCHC5	23	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	17471	44
GPR174	84636	broad.mit.edu	37	X	78426556	78426556	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78426556C>T	uc004edg.1	+	1	88	c.52C>T	c.(52-54)CGA>TGA	p.R18*		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	18	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						TACAGATTTTCGATACTTTAT	0.383										HNSCC(63;0.18)			13	10	---	---	---	---	capture	Nonsense_Mutation	SNP	78426556	78426556	GPR174	23	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	6606	44
NKAP	79576	broad.mit.edu	37	X	119077554	119077554	+	Silent	SNP	G	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119077554G>A	uc004esh.2	-	1	182	c.15C>T	c.(13-15)TCC>TCT	p.S5S		NM_024528	NP_078804	Q8N5F7	NKAP_HUMAN	NFKB activating protein	5	Ser-rich.				negative regulation of transcription, DNA-dependent|Notch signaling pathway|positive regulation of alpha-beta T cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|protein binding			ovary(2)	2						TGCGTGAGCCGGACACCGGAG	0.692													12	24	---	---	---	---	capture	Silent	SNP	119077554	119077554	NKAP	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10346	44
NF1	4763	broad.mit.edu	37	17	29677208	29677209	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29677208_29677209insA	uc002hgg.2	+	50	7662_7663	c.7329_7330insA	c.(7327-7332)CTTACAfs	p.L2443fs	NF1_uc002hgh.2_Frame_Shift_Ins_p.L2422fs|NF1_uc010cso.2_Frame_Shift_Ins_p.L631fs|NF1_uc010wbt.1_5'UTR|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2443_2444					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TAGCTTTACTTACAGTGTCTGA	0.356			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			23	37	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	29677208	29677209	NF1	17	-	A	A	A	1	0	1	1	0	0	0	0	0	782	61	5	5	10263	44
ZNF296	162979	broad.mit.edu	37	19	45575604	45575605	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45575604_45575605insG	uc002pao.2	-	3	739_740	c.682_683insC	c.(682-684)CGGfs	p.R228fs		NM_145288	NP_660331	Q8WUU4	ZN296_HUMAN	zinc finger protein 296	228					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGGGCTCCGCCGGGTGAGGCCG	0.678													7	192	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	45575604	45575605	ZNF296	19	-	G	G	G	1	0	1	1	0	0	0	0	0	299	23	5	5	17708	44
IWS1	55677	broad.mit.edu	37	2	128262546	128262547	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128262546_128262547insG	uc002ton.2	-	3	1235_1236	c.932_933insC	c.(931-933)CCTfs	p.P311fs	IWS1_uc010yzl.1_RNA|uc002too.1_5'Flank|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	311	Glu-rich.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		AGTCACTGGCAGGCCCCTTCTG	0.540													7	530	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	128262546	128262547	IWS1	2	-	G	G	G	1	0	1	1	0	0	0	0	0	80	7	5	5	7854	44
ABCB1	5243	broad.mit.edu	37	7	87190658	87190658	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87190658delC	uc003uiz.1	-	9	1166	c.748delG	c.(748-750)GCTfs	p.A250fs	ABCB1_uc011khc.1_Frame_Shift_Del_p.A186fs	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	250	ABC transmembrane type-1 1.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	p.A250T(1)		ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	ACTGCTCCAGCTTTTGCATAC	0.318													13	71	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	87190658	87190658	ABCB1	7	C	-	-	-	1	0	1	0	1	0	0	0	0	364	28	5	5	40	44
PCM1	5108	broad.mit.edu	37	8	17872225	17872226	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0192-01	TCGA-06-0192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17872225_17872226insA	uc003wyi.3	+	36	6139_6140	c.5717_5718insA	c.(5716-5718)TTAfs	p.L1906fs	PCM1_uc011kyh.1_Frame_Shift_Ins_p.L1898fs|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Frame_Shift_Ins_p.L705fs|PCM1_uc011kyj.1_Frame_Shift_Ins_p.L662fs|PCM1_uc003wyk.3_Frame_Shift_Ins_p.L588fs|PCM1_uc011kyk.1_Frame_Shift_Ins_p.L522fs	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1	1906					centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		CCTTTGCCGTTACGTTTACCTG	0.436			T	RET|JAK2	papillary thyroid|CML|MPD								14	19	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	17872225	17872226	PCM1	8	-	A	A	A	1	0	1	1	0	0	0	0	0	793	61	5	5	11487	44
