Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GJB5	2709	broad.mit.edu	37	1	35223555	35223555	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35223555G>A	uc001bxu.2	+	2	724	c.624G>A	c.(622-624)CTG>CTA	p.L208L	GJB4_uc001bxv.1_5'Flank	NM_005268	NP_005259	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	208	Helical; (Potential).				cell communication|epidermis development	connexon complex|integral to membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)				TCATCTACCTGGTGAGCAAGA	0.552													65	111	---	---	---	---	capture	Silent	SNP	35223555	35223555	GJB5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	6348	45
DMAP1	55929	broad.mit.edu	37	1	44684377	44684377	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44684377C>T	uc001clq.1	+	6	750	c.670C>T	c.(670-672)CGA>TGA	p.R224*	DMAP1_uc010okt.1_3'UTR|DMAP1_uc001clr.1_Nonsense_Mutation_p.R224*|DMAP1_uc001cls.1_Nonsense_Mutation_p.R224*|DMAP1_uc010oku.1_Nonsense_Mutation_p.R214*	NM_001034024	NP_001029196	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	224					DNA methylation|histone H2A acetylation|histone H4 acetylation|negative regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex	DNA binding|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					TGGGCACGAACGACGGCGGAA	0.572											OREG0013437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	69	93	---	---	---	---	capture	Nonsense_Mutation	SNP	44684377	44684377	DMAP1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	4534	45
FLG	2312	broad.mit.edu	37	1	152286042	152286042	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152286042G>A	uc001ezu.1	-	3	1356	c.1320C>T	c.(1318-1320)CAC>CAT	p.H440H	uc001ezv.2_RNA	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	440	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGCCTTTCCGTGGCCTGACA	0.592									Ichthyosis				217	226	---	---	---	---	capture	Silent	SNP	152286042	152286042	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5867	45
NES	10763	broad.mit.edu	37	1	156640774	156640774	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156640774T>A	uc001fpq.2	-	4	3339	c.3206A>T	c.(3205-3207)GAT>GTT	p.D1069V		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	1069	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCCACATCATCTTCCACCAG	0.682													16	114	---	---	---	---	capture	Missense_Mutation	SNP	156640774	156640774	NES	1	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	10244	45
C1orf129	80133	broad.mit.edu	37	1	170961421	170961421	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:170961421C>T	uc001ghg.2	+	12	1275	c.1145C>T	c.(1144-1146)ACG>ATG	p.T382M	C1orf129_uc009wvy.2_Missense_Mutation_p.T189M|C1orf129_uc010plz.1_Missense_Mutation_p.T382M	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	382							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GACACCGTAACGGAAGGGAAA	0.468													48	76	---	---	---	---	capture	Missense_Mutation	SNP	170961421	170961421	C1orf129	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1978	45
LHX9	56956	broad.mit.edu	37	1	197896816	197896816	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197896816C>A	uc001guk.1	+	4	1266	c.829C>A	c.(829-831)CAC>AAC	p.H277N	LHX9_uc001gui.1_Missense_Mutation_p.H268N|LHX9_uc001guj.1_Missense_Mutation_p.H283N	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	277	Homeobox.				motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						TTTCAAGCATCACCAGCTCCG	0.527													160	271	---	---	---	---	capture	Missense_Mutation	SNP	197896816	197896816	LHX9	1	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	8697	45
PCNXL2	80003	broad.mit.edu	37	1	233394108	233394108	+	Silent	SNP	T	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233394108T>C	uc001hvl.2	-	5	1735	c.1500A>G	c.(1498-1500)ACA>ACG	p.T500T	PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	500						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				ACTCGGAGCCTGTATCAGGTG	0.562													54	85	---	---	---	---	capture	Silent	SNP	233394108	233394108	PCNXL2	1	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	11495	45
GDF2	2658	broad.mit.edu	37	10	48413762	48413762	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:48413762G>A	uc001jfa.1	-	2	1269	c.1106C>T	c.(1105-1107)ACG>ATG	p.T369M		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	369					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3						TTTCGTCGGCGTCACATCGTC	0.582													57	17	---	---	---	---	capture	Missense_Mutation	SNP	48413762	48413762	GDF2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6254	45
PTEN	5728	broad.mit.edu	37	10	89692992	89692992	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692992G>A	uc001kfb.2	+	6	1507	c.476G>A	c.(475-477)AGG>AAG	p.R159K		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	159	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R159S(4)|p.R55fs*1(4)|p.R159K(4)|p.?(2)|p.Y27fs*1(2)|p.R159fs*8(2)|p.Y27_N212>Y(2)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGGGAAGTAAGGACCAGAGAC	0.363		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			52	12	---	---	---	---	capture	Missense_Mutation	SNP	89692992	89692992	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	12633	45
PRDM11	56981	broad.mit.edu	37	11	45117447	45117447	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45117447G>A	uc001myo.2	+	2	340	c.91G>A	c.(91-93)GAG>AAG	p.E31K		NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11	31										upper_aerodigestive_tract(1)	1						ttaccagagagagaaagtaag	0.035													36	41	---	---	---	---	capture	Missense_Mutation	SNP	45117447	45117447	PRDM11	11	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	12348	45
BCL9L	283149	broad.mit.edu	37	11	118773532	118773532	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118773532G>A	uc001pug.2	-	6	1885	c.920C>T	c.(919-921)CCG>CTG	p.P307L	BCL9L_uc009zal.2_Missense_Mutation_p.P302L	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	307	Pro-rich.|Necessary for interaction with CTNNB1 (By similarity).				negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity			ovary(1)|pancreas(1)	2	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TGGCGGCGGCGGCAGTGGAGG	0.716													42	5	---	---	---	---	capture	Missense_Mutation	SNP	118773532	118773532	BCL9L	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1371	45
TRIM29	23650	broad.mit.edu	37	11	120008709	120008709	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120008709C>T	uc001pwz.2	-	1	155	c.31G>A	c.(31-33)GGG>AGG	p.G11R	TRIM29_uc001pxa.2_RNA	NM_012101	NP_036233	Q14134	TRI29_HUMAN	tripartite motif protein TRIM29	11					transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		GGGCTCGACCCGTTGCTCCTG	0.632													15	193	---	---	---	---	capture	Missense_Mutation	SNP	120008709	120008709	TRIM29	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16386	45
LRTM2	654429	broad.mit.edu	37	12	1943505	1943505	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:1943505T>G	uc001qjt.2	+	5	1537	c.731T>G	c.(730-732)ATG>AGG	p.M244R	CACNA2D4_uc001qjp.2_Intron|CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron|CACNA2D4_uc009zdr.1_Intron|LRTM2_uc001qju.2_Missense_Mutation_p.M244R|LRTM2_uc010sdx.1_Missense_Mutation_p.M244R|LRTM2_uc001qjv.2_Missense_Mutation_p.M6R	NM_001039029	NP_001034118	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	244	LRRCT.|Extracellular (Potential).					integral to membrane				large_intestine(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			ATGGTCCCCATGGAGATGTTC	0.597													24	18	---	---	---	---	capture	Missense_Mutation	SNP	1943505	1943505	LRTM2	12	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	8960	45
CD163L1	283316	broad.mit.edu	37	12	7527093	7527093	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7527093G>A	uc001qsy.2	-	13	3380	c.3354C>T	c.(3352-3354)CGC>CGT	p.R1118R	CD163L1_uc010sge.1_Silent_p.R1128R	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1118	SRCR 10.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						GCCCCCAGCCGCGGGAAGGGC	0.617													22	19	---	---	---	---	capture	Silent	SNP	7527093	7527093	CD163L1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2939	45
OVCH1	341350	broad.mit.edu	37	12	29628035	29628035	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:29628035C>T	uc001rix.1	-	14	1559	c.1559G>A	c.(1558-1560)CGT>CAT	p.R520H		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	520	CUB 2.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	p.R520H(1)		ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GCCTTGTAAACGATTTTTACC	0.338													2	2	---	---	---	---	capture	Missense_Mutation	SNP	29628035	29628035	OVCH1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11227	45
KRT79	338785	broad.mit.edu	37	12	53217720	53217720	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53217720G>A	uc001sbb.2	-	6	1130	c.1097C>T	c.(1096-1098)ACC>ATC	p.T366I	KRT79_uc001sba.2_Missense_Mutation_p.T137I	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	366	Rod.|Coil 2.					keratin filament	structural molecule activity			ovary(2)|skin(2)	4						GATAGTGCGGGTGAGCTCAGC	0.612													22	23	---	---	---	---	capture	Missense_Mutation	SNP	53217720	53217720	KRT79	12	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	8412	45
EIF4B	1975	broad.mit.edu	37	12	53421578	53421578	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53421578G>A	uc001sbh.3	+	7	886	c.680G>A	c.(679-681)CGT>CAT	p.R227H	EIF4B_uc009zmp.1_RNA|EIF4B_uc010snu.1_Missense_Mutation_p.R227H|EIF4B_uc010snv.1_Missense_Mutation_p.R188H|EIF4B_uc001sbi.2_5'UTR	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	227	Arg-rich.|Asp-rich.				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2						TATCGAGATCGTTATGATTCA	0.373													67	155	---	---	---	---	capture	Missense_Mutation	SNP	53421578	53421578	EIF4B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4982	45
CPSF6	11052	broad.mit.edu	37	12	69646899	69646899	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69646899A>C	uc001sut.3	+	3	449	c.339A>C	c.(337-339)AAA>AAC	p.K113N	CPSF6_uc001suu.3_Missense_Mutation_p.K113N	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	113	RRM.|Necessary for interaction with NUDT21/CPSF5.				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			TGGAGATAAAATTTTTTGAAA	0.323													19	41	---	---	---	---	capture	Missense_Mutation	SNP	69646899	69646899	CPSF6	12	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	3794	45
HAL	3034	broad.mit.edu	37	12	96389631	96389631	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96389631C>T	uc001tem.1	-	2	355	c.58G>A	c.(58-60)GCG>ACG	p.A20T	HAL_uc009zti.1_RNA|HAL_uc010suw.1_5'UTR|HAL_uc010sux.1_Missense_Mutation_p.A20T	NM_002108	NP_002099	P42357	HUTH_HUMAN	histidine ammonia-lyase	20					biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity			ovary(2)|skin(1)	3					L-Histidine(DB00117)	GTGAGCTGCGCGTCCTGGCAG	0.642													11	13	---	---	---	---	capture	Missense_Mutation	SNP	96389631	96389631	HAL	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6874	45
STAB2	55576	broad.mit.edu	37	12	104126949	104126949	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104126949C>T	uc001tjw.2	+	51	5635	c.5449C>T	c.(5449-5451)CGA>TGA	p.R1817*	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1817	Extracellular (Potential).|FAS1 6.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TCATGTGATACGAGATGCCAA	0.463													4	199	---	---	---	---	capture	Nonsense_Mutation	SNP	104126949	104126949	STAB2	12	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	15128	45
NFYB	4801	broad.mit.edu	37	12	104517017	104517017	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104517017T>C	uc001tkl.1	-	5	617	c.416A>G	c.(415-417)CAG>CGG	p.Q139R	NFYB_uc001tkk.1_Missense_Mutation_p.Q137R	NM_006166	NP_006157	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	139	B domain.					CCAAT-binding factor complex	repressing transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						TCTGAATTTCTGAAGGTATAA	0.244													21	47	---	---	---	---	capture	Missense_Mutation	SNP	104517017	104517017	NFYB	12	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	10297	45
TPCN1	53373	broad.mit.edu	37	12	113724880	113724880	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113724880C>T	uc001tuw.2	+	19	1912	c.1615C>T	c.(1615-1617)CGC>TGC	p.R539C	TPCN1_uc001tux.2_Missense_Mutation_p.R611C|TPCN1_uc010syt.1_Missense_Mutation_p.R471C	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	539	Helical; Name=S4 of repeat II; (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						CGTGGTCCTGCGCCCCCTCCA	0.617													4	154	---	---	---	---	capture	Missense_Mutation	SNP	113724880	113724880	TPCN1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16278	45
SDSL	113675	broad.mit.edu	37	12	113873227	113873227	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113873227G>A	uc001tvi.2	+	7	747	c.537G>A	c.(535-537)CTG>CTA	p.L179L	SDSL_uc009zwh.2_Silent_p.L179L	NM_138432	NP_612441	Q96GA7	SDSL_HUMAN	serine dehydratase-like	179					cellular amino acid metabolic process		L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	GGGGTCTCCTGGCCGGGGTGG	0.657													14	18	---	---	---	---	capture	Silent	SNP	113873227	113873227	SDSL	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	13869	45
SCARB1	949	broad.mit.edu	37	12	125292425	125292425	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125292425G>A	uc001ugo.3	-	7	1144	c.891C>T	c.(889-891)CCC>CCT	p.P297P	SCARB1_uc001ugn.3_Silent_p.P297P|SCARB1_uc001ugm.3_Silent_p.P297P|SCARB1_uc010tbd.1_Silent_p.P297P|SCARB1_uc010tbe.1_Silent_p.P256P|SCARB1_uc001ugp.3_Silent_p.P297P	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1	297	Extracellular (Potential).		P -> S (mutation carriers have increased HDL cholesterol levels and a reduction in cholesterol efflux from macrophages).		adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	AGCGATAGGTGGGGATGCCTT	0.582													36	84	---	---	---	---	capture	Silent	SNP	125292425	125292425	SCARB1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	13773	45
RB1	5925	broad.mit.edu	37	13	48947596	48947596	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48947596C>T	uc001vcb.2	+	12	1349	c.1183C>T	c.(1183-1185)CAA>TAA	p.Q395*	RB1_uc010act.1_Nonsense_Mutation_p.Q96*	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	395	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.Q395*(2)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGCAAGTGATCAACCTTCAGA	0.294		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			68	37	---	---	---	---	capture	Nonsense_Mutation	SNP	48947596	48947596	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	12993	45
OR4K5	79317	broad.mit.edu	37	14	20389151	20389151	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20389151C>A	uc010tkw.1	+	1	386	c.386C>A	c.(385-387)CCC>CAC	p.P129H		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	129	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATATGCAAACCCTTATACTAT	0.448													267	373	---	---	---	---	capture	Missense_Mutation	SNP	20389151	20389151	OR4K5	14	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	10977	45
ITGAX	3687	broad.mit.edu	37	16	31392315	31392315	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31392315C>T	uc002ebu.1	+	29	3441	c.3374C>T	c.(3373-3375)GCG>GTG	p.A1125V	ITGAX_uc002ebt.2_Missense_Mutation_p.A1125V	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	1125	Helical; (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CTCATCACAGCGGTACTGTAC	0.542													43	43	---	---	---	---	capture	Missense_Mutation	SNP	31392315	31392315	ITGAX	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7812	45
SLC16A13	201232	broad.mit.edu	37	17	6941650	6941650	+	Missense_Mutation	SNP	G	A	A	rs139041380		TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6941650G>A	uc002geh.2	+	3	831	c.523G>A	c.(523-525)GTG>ATG	p.V175M		NM_201566	NP_963860	Q7RTY0	MOT13_HUMAN	monocarboxylate transporter 13	175	Helical; (Potential).					integral to membrane|plasma membrane	symporter activity			ovary(1)|skin(1)	2						CCTGCTGCTGGTGTCTGCCCT	0.667													42	68	---	---	---	---	capture	Missense_Mutation	SNP	6941650	6941650	SLC16A13	17	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	14299	45
DVL2	1856	broad.mit.edu	37	17	7130543	7130543	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7130543G>A	uc002gez.1	-	13	1691	c.1409C>T	c.(1408-1410)CCT>CTT	p.P470L	DVL2_uc010vtr.1_Missense_Mutation_p.P464L	NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	470	DEP.				canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity			lung(1)|kidney(1)	2						CCGCCGCTCAGGAAAGCCCTC	0.577													60	117	---	---	---	---	capture	Missense_Mutation	SNP	7130543	7130543	DVL2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	4791	45
TP53	7157	broad.mit.edu	37	17	7577096	7577096	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577096T>G	uc002gim.2	-	8	1036	c.842A>C	c.(841-843)GAC>GCC	p.D281A	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.D281A|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D149A|TP53_uc010cng.1_Missense_Mutation_p.D149A|TP53_uc002gii.1_Missense_Mutation_p.D149A|TP53_uc010cnh.1_Missense_Mutation_p.D281A|TP53_uc010cni.1_Missense_Mutation_p.D281A|TP53_uc002gij.2_Missense_Mutation_p.D281A	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	281	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> A (in sporadic cancers; somatic mutation).|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.D281E(25)|p.D281H(19)|p.D281N(18)|p.D281G(10)|p.0?(7)|p.D281Y(6)|p.D281D(5)|p.D281V(3)|p.D281fs*63(2)|p.?(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.D281R(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGTGCGCCGGTCTCTCCCAGG	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			31	61	---	---	---	---	capture	Missense_Mutation	SNP	7577096	7577096	TP53	17	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	16264	45
TP53	7157	broad.mit.edu	37	17	7577142	7577142	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577142C>T	uc002gim.2	-	8	990	c.796G>A	c.(796-798)GGA>AGA	p.G266R	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.G266R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G134R|TP53_uc010cng.1_Missense_Mutation_p.G134R|TP53_uc002gii.1_Missense_Mutation_p.G134R|TP53_uc010cnh.1_Missense_Mutation_p.G266R|TP53_uc010cni.1_Missense_Mutation_p.G266R|TP53_uc002gij.2_Missense_Mutation_p.G266R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	266	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> A (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G266E(45)|p.G266R(42)|p.G266V(31)|p.G266*(12)|p.0?(7)|p.G266fs*79(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266G(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.G266fs*9(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CTGTTCCGTCCCAGTAGATTA	0.517		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			24	26	---	---	---	---	capture	Missense_Mutation	SNP	7577142	7577142	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	16264	45
CCDC42	146849	broad.mit.edu	37	17	8638499	8638499	+	Missense_Mutation	SNP	G	A	A	rs141089641	byFrequency	TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8638499G>A	uc002gln.2	-	6	1015	c.788C>T	c.(787-789)ACG>ATG	p.T263M	CCDC42_uc002glo.2_Missense_Mutation_p.T189M	NM_144681	NP_653282	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42 isoform 1	263										ovary(1)	1						GAGGTTCAGCGTGGCCATCTT	0.587													38	70	---	---	---	---	capture	Missense_Mutation	SNP	8638499	8638499	CCDC42	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2788	45
SLFN5	162394	broad.mit.edu	37	17	33591324	33591324	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33591324T>C	uc002hjf.3	+	4	1378	c.1261T>C	c.(1261-1263)TTT>CTT	p.F421L	SLFN5_uc010wcg.1_Intron	NM_144975	NP_659412	Q08AF3	SLFN5_HUMAN	schlafen family member 5	421					cell differentiation		ATP binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		AATATTGATTTTTTCTCAAAG	0.418													81	119	---	---	---	---	capture	Missense_Mutation	SNP	33591324	33591324	SLFN5	17	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	14629	45
FAM117A	81558	broad.mit.edu	37	17	47788746	47788746	+	Silent	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47788746C>T	uc002ipk.2	-	8	1302	c.1233G>A	c.(1231-1233)CCG>CCA	p.P411P	FAM117A_uc010wlz.1_Silent_p.P139P	NM_030802	NP_110429	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	411	Pro-rich.									ovary(1)	1						TGGGGCTGGCCGGGGGAAGGG	0.652													22	45	---	---	---	---	capture	Silent	SNP	47788746	47788746	FAM117A	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5363	45
KCTD2	23510	broad.mit.edu	37	17	73049201	73049201	+	Splice_Site	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73049201G>A	uc002jmp.2	+	3	607	c.540_splice	c.e3+1	p.Q180_splice	KCTD2_uc010dfz.2_Splice_Site|KCTD2_uc002jmq.2_Splice_Site	NM_015353	NP_056168	Q14681	KCTD2_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity				0	all_lung(278;0.226)					AACTTCACAAGTAATGTATTT	0.478													38	40	---	---	---	---	capture	Splice_Site	SNP	73049201	73049201	KCTD2	17	G	A	A	A	1	0	0	0	0	0	0	1	0	468	36	5	2	8029	45
NFIX	4784	broad.mit.edu	37	19	13184252	13184252	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13184252G>A	uc010xmx.1	+	4	716	c.663G>A	c.(661-663)CAG>CAA	p.Q221Q	NFIX_uc002mwd.2_Silent_p.Q213Q|NFIX_uc002mwe.2_Silent_p.Q205Q|NFIX_uc002mwf.2_Silent_p.Q216Q|NFIX_uc002mwg.1_Silent_p.Q212Q			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;	213					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			TAAGTTTCCAGGACTGTTTTG	0.522													25	111	---	---	---	---	capture	Silent	SNP	13184252	13184252	NFIX	19	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	10281	45
CYP4F3	4051	broad.mit.edu	37	19	15758051	15758051	+	Missense_Mutation	SNP	C	T	T	rs149124841	byFrequency	TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15758051C>T	uc002nbj.2	+	5	492	c.442C>T	c.(442-444)CGT>TGT	p.R148C	CYP4F3_uc010xok.1_Missense_Mutation_p.R148C|CYP4F3_uc010xol.1_Missense_Mutation_p.R148C|CYP4F3_uc010xom.1_5'UTR|CYP4F3_uc002nbk.2_Missense_Mutation_p.R148C|CYP4F3_uc010xon.1_5'Flank	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	148					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GAGCCGCCACCGTCGGATGCT	0.567													29	86	---	---	---	---	capture	Missense_Mutation	SNP	15758051	15758051	CYP4F3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4150	45
MYO9B	4650	broad.mit.edu	37	19	17309077	17309077	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17309077C>T	uc010eak.2	+	24	4350	c.4198C>T	c.(4198-4200)CCA>TCA	p.P1400S	MYO9B_uc002nfi.2_Missense_Mutation_p.P1400S|MYO9B_uc002nfj.1_Missense_Mutation_p.P1400S|MYO9B_uc002nfl.1_5'UTR	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1400	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						ATCCTCCCTCCCAGACGCAGG	0.622													15	42	---	---	---	---	capture	Missense_Mutation	SNP	17309077	17309077	MYO9B	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	9995	45
ZNF492	57615	broad.mit.edu	37	19	22847727	22847727	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22847727A>C	uc002nqw.3	+	4	1500	c.1256A>C	c.(1255-1257)AAA>ACA	p.K419T		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	419					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				ACTGGAGAGAAACCCTACAAA	0.368													22	116	---	---	---	---	capture	Missense_Mutation	SNP	22847727	22847727	ZNF492	19	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	17822	45
ZNF99	7652	broad.mit.edu	37	19	22941405	22941405	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22941405G>A	uc010xrh.1	-	5	1033	c.1033C>T	c.(1033-1035)CGT>TGT	p.R345C		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GCTGAGAAACGCTTAAAAGCT	0.373													25	67	---	---	---	---	capture	Missense_Mutation	SNP	22941405	22941405	ZNF99	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	18080	45
TEAD2	8463	broad.mit.edu	37	19	49852054	49852054	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49852054G>A	uc002pnj.2	-	8	732	c.641C>T	c.(640-642)TCG>TTG	p.S214L	TEAD2_uc002png.2_Missense_Mutation_p.S217L|TEAD2_uc002pnh.2_Missense_Mutation_p.S218L|TEAD2_uc002pni.2_Missense_Mutation_p.S217L|TEAD2_uc010yao.1_Missense_Mutation_p.S86L|TEAD2_uc010emw.2_Missense_Mutation_p.S217L	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	214	Transcriptional activation (Potential).|Pro-rich.				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		GGCTGGGGGCGATGGGGTAGG	0.572													7	25	---	---	---	---	capture	Missense_Mutation	SNP	49852054	49852054	TEAD2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15624	45
SHANK1	50944	broad.mit.edu	37	19	51205802	51205802	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51205802G>A	uc002psx.1	-	11	1688	c.1669C>T	c.(1669-1671)CGC>TGC	p.R557C		NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	557	SH3.				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ATGAAGGAGCGTCCGGGTACC	0.701													7	25	---	---	---	---	capture	Missense_Mutation	SNP	51205802	51205802	SHANK1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14157	45
CEP68	23177	broad.mit.edu	37	2	65309696	65309696	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:65309696G>A	uc002sdl.3	+	6	2345	c.2131G>A	c.(2131-2133)GCA>ACA	p.A711T	CEP68_uc010yqb.1_3'UTR|CEP68_uc002sdk.3_Missense_Mutation_p.A574T|CEP68_uc010yqc.1_Missense_Mutation_p.A711T	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	711					centrosome organization	centrosome				skin(1)	1						TGGGAGGATCGCAAAGCAGTC	0.463													5	160	---	---	---	---	capture	Missense_Mutation	SNP	65309696	65309696	CEP68	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3226	45
TTN	7273	broad.mit.edu	37	2	179589211	179589211	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179589211G>A	uc010zfg.1	-	69	17383	c.17159C>T	c.(17158-17160)ACG>ATG	p.T5720M	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.T2381M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6647							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGAGTGCACGTTTCTCCTAC	0.478													25	37	---	---	---	---	capture	Missense_Mutation	SNP	179589211	179589211	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16617	45
TTN	7273	broad.mit.edu	37	2	179637967	179637967	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179637967C>A	uc010zfg.1	-	33	7948	c.7724G>T	c.(7723-7725)AGT>ATT	p.S2575I	TTN_uc010zfh.1_Missense_Mutation_p.S2529I|TTN_uc010zfi.1_Missense_Mutation_p.S2529I|TTN_uc010zfj.1_Missense_Mutation_p.S2529I|TTN_uc002unb.2_Missense_Mutation_p.S2575I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2575							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATTTAGAACTGGGCTTGAT	0.353													19	47	---	---	---	---	capture	Missense_Mutation	SNP	179637967	179637967	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	16617	45
CCDC141	285025	broad.mit.edu	37	2	179701794	179701794	+	Silent	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179701794C>T	uc002unf.1	-	13	2484	c.2427G>A	c.(2425-2427)AGG>AGA	p.R809R	CCDC141_uc002une.1_Silent_p.R259R	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	809							protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GAACCATTTGCCTCTGATAGC	0.493													30	25	---	---	---	---	capture	Silent	SNP	179701794	179701794	CCDC141	2	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	2749	45
MPP4	58538	broad.mit.edu	37	2	202557686	202557686	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202557686C>A	uc002uyk.3	-	3	354	c.146G>T	c.(145-147)GGA>GTA	p.G49V	MPP4_uc010ftj.2_Missense_Mutation_p.G49V|MPP4_uc010zhq.1_Missense_Mutation_p.G49V|MPP4_uc010zhr.1_Missense_Mutation_p.G49V|MPP4_uc010zhs.1_Missense_Mutation_p.G49V|MPP4_uc002uyj.3_Missense_Mutation_p.G49V|MPP4_uc010zht.1_Missense_Mutation_p.G49V|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Missense_Mutation_p.G49V|MPP4_uc002uym.1_Missense_Mutation_p.G62V|MPP4_uc002uyn.2_Missense_Mutation_p.G49V	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4	49	L27 1.					cytoplasm	protein binding				0						GAGACACACTCCATTCACATC	0.547													10	17	---	---	---	---	capture	Missense_Mutation	SNP	202557686	202557686	MPP4	2	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	9648	45
DIS3L2	129563	broad.mit.edu	37	2	233028324	233028324	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233028324G>T	uc010fxz.2	+	9	1382	c.1106G>T	c.(1105-1107)AGC>ATC	p.S369I	DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vso.2_RNA	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	369							exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GAGGAGTTCAGCAAGAGAAGG	0.433													26	33	---	---	---	---	capture	Missense_Mutation	SNP	233028324	233028324	DIS3L2	2	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	4495	45
NEU2	4759	broad.mit.edu	37	2	233897493	233897493	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233897493G>A	uc010zmn.1	+	1	112	c.112G>A	c.(112-114)GCG>ACG	p.A38T		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	38							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		GCTGGCCTTCGCGGAACAGCG	0.622													41	87	---	---	---	---	capture	Missense_Mutation	SNP	233897493	233897493	NEU2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10249	45
DGKD	8527	broad.mit.edu	37	2	234358633	234358633	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234358633G>A	uc002vui.1	+	16	1906	c.1894G>A	c.(1894-1896)GAT>AAT	p.D632N	DGKD_uc002vuj.1_Missense_Mutation_p.D588N|DGKD_uc010fyh.1_Missense_Mutation_p.D499N|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	632					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CACAGCTGTCGATGAGCAGAA	0.642													13	46	---	---	---	---	capture	Missense_Mutation	SNP	234358633	234358633	DGKD	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4425	45
FOXS1	2307	broad.mit.edu	37	20	30432906	30432906	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30432906G>A	uc002wwt.1	-	1	515	c.440C>T	c.(439-441)ACG>ATG	p.T147M		NM_004118	NP_004109	O43638	FOXS1_HUMAN	forkhead box S1	147					anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|insulin receptor signaling pathway|lymphangiogenesis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|neural crest cell fate commitment|neuromuscular process controlling balance|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of multicellular organism growth|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|somitogenesis|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)	1						CCTGCCGGTCGTGGCGTTGGG	0.687													16	19	---	---	---	---	capture	Missense_Mutation	SNP	30432906	30432906	FOXS1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5979	45
PLCG1	5335	broad.mit.edu	37	20	39802384	39802384	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39802384G>A	uc002xjp.1	+	29	3608	c.3487G>A	c.(3487-3489)GAG>AAG	p.E1163K	PLCG1_uc002xjo.1_Missense_Mutation_p.E1163K|PLCG1_uc010zwe.1_Missense_Mutation_p.E828K	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	1163	C2.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				CGTGGTGTATGAGGAAGACAT	0.517											OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	89	146	---	---	---	---	capture	Missense_Mutation	SNP	39802384	39802384	PLCG1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11938	45
SEMG1	6406	broad.mit.edu	37	20	43836216	43836216	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43836216C>T	uc002xni.2	+	2	335	c.278C>T	c.(277-279)ACG>ATG	p.T93M	SEMG1_uc002xnj.2_Missense_Mutation_p.T93M|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.T93M	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	93					insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				CTACATAAGACGACAAAATCA	0.378													64	100	---	---	---	---	capture	Missense_Mutation	SNP	43836216	43836216	SEMG1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13937	45
COL6A2	1292	broad.mit.edu	37	21	47539015	47539015	+	Silent	SNP	C	T	T	rs61735827	byFrequency	TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47539015C>T	uc002zia.1	+	14	1333	c.1251C>T	c.(1249-1251)CGC>CGT	p.R417R	COL6A2_uc002zhy.1_Silent_p.R417R|COL6A2_uc002zhz.1_Silent_p.R417R|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	417	Triple-helical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	p.R417R(1)		central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CTGGGCCCCGCGGACCCAAAG	0.662													14	9	---	---	---	---	capture	Silent	SNP	47539015	47539015	COL6A2	21	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3665	45
TRIM71	131405	broad.mit.edu	37	3	32859692	32859692	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32859692G>A	uc003cff.2	+	1	183	c.120G>A	c.(118-120)ACG>ACA	p.T40T		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	40	RING-type.|Ser-rich.				multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						AGACGTCCACGTCGTcggggg	0.532													10	23	---	---	---	---	capture	Silent	SNP	32859692	32859692	TRIM71	3	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16427	45
SCAP	22937	broad.mit.edu	37	3	47460316	47460316	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47460316G>A	uc003crh.1	-	14	2213	c.1958C>T	c.(1957-1959)CCC>CTC	p.P653L	SCAP_uc011baz.1_Missense_Mutation_p.P398L|SCAP_uc003crg.2_Missense_Mutation_p.P261L	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	653	Lumenal (By similarity).				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		TGGGATGACGGGCAGCAGGCT	0.706													9	13	---	---	---	---	capture	Missense_Mutation	SNP	47460316	47460316	SCAP	3	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13769	45
FAM116A	201627	broad.mit.edu	37	3	57627463	57627463	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:57627463A>G	uc003dja.2	-	12	1120	c.1049T>C	c.(1048-1050)ATA>ACA	p.I350T		NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627	350										pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)		TACTCCTAATATAACTGAGGG	0.313													44	47	---	---	---	---	capture	Missense_Mutation	SNP	57627463	57627463	FAM116A	3	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	5361	45
RUVBL1	8607	broad.mit.edu	37	3	127784027	127784027	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:127784027G>C	uc003eke.2	-	5	540	c.276C>G	c.(274-276)ATC>ATG	p.I92M	RUVBL1_uc003ekf.2_3'UTR|SEC61A1_uc003ekb.2_Intron|SEC61A1_uc003ekc.2_Intron|SEC61A1_uc003ekd.2_Intron|SEC61A1_uc003ekg.2_5'UTR	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		CAGGTTTCCAGATGAGCTGGA	0.448													14	9	---	---	---	---	capture	Missense_Mutation	SNP	127784027	127784027	RUVBL1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	417	33	4	4	13644	45
TM4SF18	116441	broad.mit.edu	37	3	149051122	149051122	+	Silent	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:149051122C>A	uc003exa.2	-	2	185	c.48G>T	c.(46-48)CCG>CCT	p.P16P		NM_138786	NP_620141	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18	16	Helical; (Potential).					integral to membrane				ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			AAAGTGCAAGCGGAATCAGCA	0.443													11	47	---	---	---	---	capture	Silent	SNP	149051122	149051122	TM4SF18	3	C	A	A	A	1	0	0	0	0	0	0	0	1	340	27	4	4	15852	45
AADAC	13	broad.mit.edu	37	3	151532029	151532029	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:151532029G>A	uc003eze.2	+	1	169	c.79G>A	c.(79-81)GTT>ATT	p.V27I		NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase	27	Lumenal (Potential).				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity			skin(2)	2		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CCCAGATAACGTTGAGGAGCC	0.408													77	69	---	---	---	---	capture	Missense_Mutation	SNP	151532029	151532029	AADAC	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10	45
HTR3E	285242	broad.mit.edu	37	3	183822631	183822631	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183822631G>A	uc010hxq.2	+	5	912	c.446G>A	c.(445-447)CGC>CAC	p.R149H	HTR3E_uc003fml.3_Missense_Mutation_p.R134H|HTR3E_uc003fmm.2_Missense_Mutation_p.R164H|HTR3E_uc010hxr.2_Missense_Mutation_p.R175H|HTR3E_uc003fmn.2_Missense_Mutation_p.R149H	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	149	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			AATGAAGGTCGCATCAGGTAT	0.488													63	73	---	---	---	---	capture	Missense_Mutation	SNP	183822631	183822631	HTR3E	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7373	45
ATP13A4	84239	broad.mit.edu	37	3	193158372	193158372	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:193158372G>A	uc003ftd.2	-	21	2602	c.2494C>T	c.(2494-2496)CTG>TTG	p.L832L	ATP13A4_uc003fte.1_Silent_p.L832L|ATP13A4_uc011bsr.1_Silent_p.L303L|ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	832	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TCTTCCACCAGACTGGACTTC	0.458													54	49	---	---	---	---	capture	Silent	SNP	193158372	193158372	ATP13A4	3	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	1117	45
ZFYVE28	57732	broad.mit.edu	37	4	2306576	2306576	+	Silent	SNP	G	A	A	rs146596546	by1000genomes	TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:2306576G>A	uc003gex.1	-	8	1810	c.1491C>T	c.(1489-1491)GAC>GAT	p.D497D	ZFYVE28_uc011bvk.1_Silent_p.D427D|ZFYVE28_uc011bvl.1_Silent_p.D467D|ZFYVE28_uc003gew.1_Silent_p.D383D	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	497					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						CCGTCTCTGCGTCATCCGCAC	0.672													46	57	---	---	---	---	capture	Silent	SNP	2306576	2306576	ZFYVE28	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	17550	45
SH3TC1	54436	broad.mit.edu	37	4	8230213	8230213	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8230213G>A	uc003gkv.3	+	12	2893	c.2792G>A	c.(2791-2793)CGG>CAG	p.R931Q	SH3TC1_uc003gkw.3_Missense_Mutation_p.R855Q|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	931							binding			large_intestine(2)|pancreas(1)	3						GAGGCCGTGCGGCTGTTCTCG	0.701													25	34	---	---	---	---	capture	Missense_Mutation	SNP	8230213	8230213	SH3TC1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14154	45
RBM47	54502	broad.mit.edu	37	4	40440789	40440789	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440789C>T	uc003gvc.2	-	4	832	c.122G>A	c.(121-123)CGC>CAC	p.R41H	RBM47_uc003gvd.2_Missense_Mutation_p.R41H|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.R3H|RBM47_uc003gvg.1_Missense_Mutation_p.R41H	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	41						nucleus	nucleotide binding|RNA binding			breast(3)	3						GTAGCCCGTGCGCTCCATCAG	0.731													6	5	---	---	---	---	capture	Missense_Mutation	SNP	40440789	40440789	RBM47	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13036	45
CSN3	1448	broad.mit.edu	37	4	71115169	71115169	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71115169C>T	uc003hfe.3	+	4	600	c.542C>T	c.(541-543)ACG>ATG	p.T181M		NM_005212	NP_005203	P07498	CASK_HUMAN	casein kappa precursor	181				TPPT -> PTTS (in Ref. 5; AA sequence and 6; AA sequence).		extracellular region	protein binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						ACTCCACCTACGGCATAAAAA	0.413													35	46	---	---	---	---	capture	Missense_Mutation	SNP	71115169	71115169	CSN3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3914	45
MORF4	10934	broad.mit.edu	37	4	174537295	174537295	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:174537295G>T	uc011cke.1	-	1	500	c.500C>A	c.(499-501)TCC>TAC	p.S167Y		NM_006792	NP_006783			mortality factor 4												0		Prostate(90;0.00201)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0765)|all_hematologic(60;0.107)		all cancers(43;1.88e-18)|Epithelial(43;1.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		ATACACCTGGGACATGGGTGC	0.443													148	177	---	---	---	---	capture	Missense_Mutation	SNP	174537295	174537295	MORF4	4	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	9617	45
ADAMTS16	170690	broad.mit.edu	37	5	5232628	5232628	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5232628A>G	uc003jdl.2	+	12	1987	c.1849A>G	c.(1849-1851)AAG>GAG	p.K617E	ADAMTS16_uc003jdk.1_Missense_Mutation_p.K617E|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	617	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CACCAACCCCAAGTAAGTATG	0.527													72	120	---	---	---	---	capture	Missense_Mutation	SNP	5232628	5232628	ADAMTS16	5	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	261	45
TRPC7	57113	broad.mit.edu	37	5	135587388	135587388	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135587388C>T	uc003lbn.1	-	5	1528	c.1525G>A	c.(1525-1527)GAC>AAC	p.D509N	TRPC7_uc010jef.1_Missense_Mutation_p.D446N|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.D440N|TRPC7_uc010jei.1_Missense_Mutation_p.D385N|TRPC7_uc010jej.1_Missense_Mutation_p.D61N	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	510	Extracellular (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGCAGCGTGTCGTCCTGCACG	0.602													26	52	---	---	---	---	capture	Missense_Mutation	SNP	135587388	135587388	TRPC7	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16467	45
KIAA0141	9812	broad.mit.edu	37	5	141316857	141316857	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141316857C>T	uc003lls.2	+	11	1366	c.1244C>T	c.(1243-1245)TCA>TTA	p.S415L	KIAA0141_uc003llt.2_Missense_Mutation_p.S415L|KIAA0141_uc003llu.1_RNA	NM_001142603	NP_001136075	Q14154	DELE_HUMAN	hypothetical protein LOC9812 precursor	415	TPR 6.				apoptosis|regulation of caspase activity	mitochondrion	protein binding			skin(1)	1		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACCAGCAGTCAGCCGCTCTG	0.562													134	164	---	---	---	---	capture	Missense_Mutation	SNP	141316857	141316857	KIAA0141	5	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	8078	45
SOX30	11063	broad.mit.edu	37	5	157078323	157078323	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:157078323T>G	uc003lxb.1	-	1	1106	c.764A>C	c.(763-765)CAG>CCG	p.Q255P	SOX30_uc003lxc.1_Missense_Mutation_p.Q255P|SOX30_uc011dds.1_Intron	NM_178424	NP_848511	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30 isoform a	255					regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGGTCTTGCTGGTGCGGCCC	0.642													50	73	---	---	---	---	capture	Missense_Mutation	SNP	157078323	157078323	SOX30	5	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	14844	45
FILIP1	27145	broad.mit.edu	37	6	76023600	76023600	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76023600C>T	uc003pia.2	-	5	2321	c.1948G>A	c.(1948-1950)GAA>AAA	p.E650K	FILIP1_uc003phy.1_Missense_Mutation_p.E650K|FILIP1_uc003phz.2_Missense_Mutation_p.E551K|FILIP1_uc010kbe.2_Missense_Mutation_p.E653K|FILIP1_uc003pib.1_Missense_Mutation_p.E402K	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	650	Potential.									skin(3)|ovary(1)	4						AAATCCCCTTCGACCACTTCC	0.418													307	286	---	---	---	---	capture	Missense_Mutation	SNP	76023600	76023600	FILIP1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5839	45
HTR1B	3351	broad.mit.edu	37	6	78172165	78172165	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:78172165A>C	uc003pil.1	-	1	956	c.956T>G	c.(955-957)ATT>AGT	p.I319S		NM_000863	NP_000854	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B	319	Helical; Name=6; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cAMP biosynthetic process|synaptic transmission	integral to plasma membrane	protein binding|serotonin receptor activity				0		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Dexfenfluramine(DB01191)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Pindolol(DB00960)|Propranolol(DB00571)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Venlafaxine(DB00285)|Zolmitriptan(DB00315)	GGCTCCCAAAATGATCCCTAG	0.507													5	304	---	---	---	---	capture	Missense_Mutation	SNP	78172165	78172165	HTR1B	6	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	7362	45
HDAC2	3066	broad.mit.edu	37	6	114266601	114266601	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:114266601C>T	uc003pwd.1	-	10	1298	c.1298G>A	c.(1297-1299)GGA>GAA	p.G433E	HDAC2_uc003pwc.1_Missense_Mutation_p.G309E|HDAC2_uc003pwe.1_Missense_Mutation_p.G309E	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2	339					blood coagulation|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of proteolysis|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|transcription factor binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)	GAAGTCTGGTCCAAAATACTC	0.299													93	115	---	---	---	---	capture	Missense_Mutation	SNP	114266601	114266601	HDAC2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6934	45
SYNE1	23345	broad.mit.edu	37	6	152644693	152644693	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152644693G>A	uc010kiw.2	-	82	16439	c.15837C>T	c.(15835-15837)CTC>CTT	p.L5279L	SYNE1_uc003qot.3_Silent_p.L5208L|SYNE1_uc003qou.3_Silent_p.L5279L|SYNE1_uc010kiz.2_Silent_p.L1034L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5279	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCCATCCTGGAGCATGCTCA	0.567										HNSCC(10;0.0054)			50	59	---	---	---	---	capture	Silent	SNP	152644693	152644693	SYNE1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	15333	45
TIAM2	26230	broad.mit.edu	37	6	155571053	155571053	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155571053G>A	uc003qqb.2	+	23	5174	c.3901G>A	c.(3901-3903)GGG>AGG	p.G1301R	TIAM2_uc003qqe.2_Missense_Mutation_p.G1301R|TIAM2_uc010kjj.2_Missense_Mutation_p.G834R|TIAM2_uc003qqf.2_Missense_Mutation_p.G677R|TIAM2_uc011efl.1_Missense_Mutation_p.G637R|TIAM2_uc003qqg.2_Missense_Mutation_p.G613R|TIAM2_uc003qqh.2_Missense_Mutation_p.G226R	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1301					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TGAGGATTATGGGACCGTGTT	0.473													42	37	---	---	---	---	capture	Missense_Mutation	SNP	155571053	155571053	TIAM2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	15776	45
ZNF727	442319	broad.mit.edu	37	7	63529386	63529386	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63529386T>G	uc011kdm.1	+	2	300	c.121T>G	c.(121-123)TTC>GTC	p.F41V		NM_001159522	NP_001152994	A8MUV8	ZN727_HUMAN	zinc finger protein 727	41	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGGAAACCTGTTCTCCTTGGG	0.383													5	30	---	---	---	---	capture	Missense_Mutation	SNP	63529386	63529386	ZNF727	7	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	17999	45
ABCB4	5244	broad.mit.edu	37	7	87060779	87060779	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87060779C>T	uc003uiv.1	-	15	1910	c.1834G>A	c.(1834-1836)GGA>AGA	p.G612R	ABCB4_uc003uiw.1_Missense_Mutation_p.G612R|ABCB4_uc003uix.1_Missense_Mutation_p.G612R	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	612	ABC transporter 1.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					CTGTGGCTTCCTTGCTCCACA	0.478													57	157	---	---	---	---	capture	Missense_Mutation	SNP	87060779	87060779	ABCB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	43	45
DBF4	10926	broad.mit.edu	37	7	87525787	87525787	+	Splice_Site	SNP	A	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87525787A>T	uc003ujf.1	+	7	1102	c.598_splice	c.e7-2	p.G200_splice	DBF4_uc003ujh.1_Splice_Site|DBF4_uc003ujg.1_Splice_Site|DBF4_uc011khf.1_Splice_Site_p.G2_splice	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN	activator of S phase kinase						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding			lung(2)	2	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				ATTTTTTTTTAGGGCAAAAGA	0.299													4	91	---	---	---	---	capture	Splice_Site	SNP	87525787	87525787	DBF4	7	A	T	T	T	1	0	0	0	0	0	0	1	0	195	15	5	4	4207	45
NPTX2	4885	broad.mit.edu	37	7	98256538	98256538	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98256538C>T	uc003upl.2	+	4	1127	c.950C>T	c.(949-951)ACG>ATG	p.T317M		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	317	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GTCACCTGGACGACACGGGAT	0.642													27	100	---	---	---	---	capture	Missense_Mutation	SNP	98256538	98256538	NPTX2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10510	45
FBXO24	26261	broad.mit.edu	37	7	100187923	100187923	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100187923C>T	uc003uvm.1	+	3	558	c.265C>T	c.(265-267)CGC>TGC	p.R89C	FBXO24_uc010lha.1_RNA|FBXO24_uc003uvl.1_Missense_Mutation_p.R89C|FBXO24_uc003uvn.1_Intron|uc011kjy.1_RNA|FBXO24_uc011kjz.1_Missense_Mutation_p.R127C|FBXO24_uc011kka.1_Missense_Mutation_p.R77C	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	89						ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					ACTCAGTCCGCGCCTCCAAGA	0.602													24	78	---	---	---	---	capture	Missense_Mutation	SNP	100187923	100187923	FBXO24	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5681	45
DLD	1738	broad.mit.edu	37	7	107545876	107545876	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107545876G>A	uc003vet.2	+	7	619	c.509G>A	c.(508-510)GGC>GAC	p.G170D	DLD_uc010ljm.1_RNA|DLD_uc011kmg.1_Intron|DLD_uc011kmh.1_Missense_Mutation_p.G147D|DLD_uc011kmi.1_Missense_Mutation_p.G71D	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor	170					branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	GCTGATGGCGGCACTCAGGTT	0.358													4	168	---	---	---	---	capture	Missense_Mutation	SNP	107545876	107545876	DLD	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4509	45
SSPO	23145	broad.mit.edu	37	7	149508065	149508065	+	Silent	SNP	G	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149508065G>C	uc010lpk.2	+	67	9459	c.9459G>C	c.(9457-9459)CCG>CCC	p.P3153P		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	3153					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCTACCCCCCGGGCAGCACTG	0.602													17	77	---	---	---	---	capture	Silent	SNP	149508065	149508065	SSPO	7	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	15081	45
ACTR3C	653857	broad.mit.edu	37	7	149990455	149990455	+	Silent	SNP	T	C	C	rs146995367	by1000genomes	TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149990455T>C	uc003wgu.1	-	3	289	c.99A>G	c.(97-99)ACA>ACG	p.T33T		NM_001040135	NP_001035225	Q9C0K3	ARP3C_HUMAN	actin-related protein 3-beta isoform 2	33					regulation of actin filament polymerization	cytoskeleton	actin binding|ATP binding				0						TCCCCGTTAATGTACGTTCAC	0.468													4	52	---	---	---	---	capture	Silent	SNP	149990455	149990455	ACTR3C	7	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	214	45
PKHD1L1	93035	broad.mit.edu	37	8	110476765	110476765	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110476765C>A	uc003yne.2	+	49	7808	c.7704C>A	c.(7702-7704)AAC>AAA	p.N2568K		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2568	Extracellular (Potential).|PbH1 2.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCAACCCGAACAATACCATAC	0.468										HNSCC(38;0.096)			52	21	---	---	---	---	capture	Missense_Mutation	SNP	110476765	110476765	PKHD1L1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	11875	45
INSL6	11172	broad.mit.edu	37	9	5185586	5185586	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5185586C>T	uc003zix.2	-	1	33	c.17G>A	c.(16-18)CGC>CAC	p.R6H		NM_007179	NP_009110	Q9Y581	INSL6_HUMAN	insulin-like 6 precursor	6						extracellular region	hormone activity				0	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		CAGGGACAAGCGGAGGAGCCG	0.642													7	16	---	---	---	---	capture	Missense_Mutation	SNP	5185586	5185586	INSL6	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7693	45
PLIN2	123	broad.mit.edu	37	9	19116616	19116616	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19116616C>T	uc003zno.2	-	8	1123	c.944G>A	c.(943-945)CGC>CAC	p.R315H	PLIN2_uc011lna.1_Missense_Mutation_p.R287H	NM_001122	NP_001113	Q99541	PLIN2_HUMAN	adipose differentiation-related protein	315					cellular lipid metabolic process	endoplasmic reticulum|extracellular region|lipid particle				ovary(2)	2						AGTCAGGTTGCGGGCAATTGC	0.463													4	170	---	---	---	---	capture	Missense_Mutation	SNP	19116616	19116616	PLIN2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11993	45
FAM75C1	441452	broad.mit.edu	37	9	90537694	90537694	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90537694C>T	uc010mqi.2	+	4	2901	c.2872C>T	c.(2872-2874)CCT>TCT	p.P958S	FAM75C1_uc004apq.3_Missense_Mutation_p.P941S	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						AATGTTTCCCCCTACTCACAA	0.483													37	100	---	---	---	---	capture	Missense_Mutation	SNP	90537694	90537694	FAM75C1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5569	45
FBP1	2203	broad.mit.edu	37	9	97380089	97380089	+	Silent	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97380089G>A	uc004auw.3	-	3	718	c.387C>T	c.(385-387)TGC>TGT	p.C129C	FBP1_uc010mrl.2_Silent_p.C129C	NM_000507	NP_000498	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	129					gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	CGGACACAAGGCAATCGATGT	0.388													34	59	---	---	---	---	capture	Silent	SNP	97380089	97380089	FBP1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5651	45
BCOR	54880	broad.mit.edu	37	X	39931847	39931847	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39931847G>A	uc004den.3	-	4	3044	c.2752C>T	c.(2752-2754)CAA>TAA	p.Q918*	BCOR_uc004dep.3_Nonsense_Mutation_p.Q918*|BCOR_uc004deo.3_Nonsense_Mutation_p.Q918*|BCOR_uc004dem.3_Nonsense_Mutation_p.Q918*|BCOR_uc004deq.3_Nonsense_Mutation_p.Q918*	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	918					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						GGATCCTCTTGGGTTTTACCA	0.527													61	16	---	---	---	---	capture	Nonsense_Mutation	SNP	39931847	39931847	BCOR	23	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	1375	45
DGKK	139189	broad.mit.edu	37	X	50114831	50114831	+	Silent	SNP	C	T	T			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50114831C>T	uc010njr.1	-	27	3564	c.3504G>A	c.(3502-3504)CTG>CTA	p.L1168L		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	1168					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					CAGCACTTCTCAGCTGGTACA	0.468													17	3	---	---	---	---	capture	Silent	SNP	50114831	50114831	DGKK	23	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	4430	45
GLUD2	2747	broad.mit.edu	37	X	120183088	120183088	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:120183088C>A	uc004eto.2	+	1	1627	c.1550C>A	c.(1549-1551)TCT>TAT	p.S517Y		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	517					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	ATGGAGCGTTCTGCCAGGCAA	0.463													51	81	---	---	---	---	capture	Missense_Mutation	SNP	120183088	120183088	GLUD2	23	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	6413	45
KIAA0907	22889	broad.mit.edu	37	1	155886422	155886423	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155886422_155886423delCT	uc001fmi.1	-	12	1570_1571	c.1546_1547delAG	c.(1546-1548)AGGfs	p.R516fs	KIAA0907_uc001fmj.1_Frame_Shift_Del_p.R516fs|KIAA0907_uc009wrk.1_Frame_Shift_Del_p.R373fs|KIAA0907_uc009wrl.1_RNA	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	hypothetical protein LOC22889	516											0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TTACCTGTCCCTCTCTCTCTCT	0.396													8	480	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	155886422	155886423	KIAA0907	1	CT	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	8121	45
RNF151	146310	broad.mit.edu	37	16	2018613	2018614	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2018613_2018614insC	uc002cnt.1	+	4	433_434	c.425_426insC	c.(424-426)TGCfs	p.C142fs		NM_174903	NP_777563	Q2KHN1	RN151_HUMAN	ring finger protein 151	142	TRAF-type.				cell differentiation|spermatogenesis	cytoplasm|nucleus	ubiquitin-protein ligase activity|zinc ion binding				0						CAGCAGCGCTGCCCCCTGGGCT	0.728													3	6	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	2018613	2018614	RNF151	16	-	C	C	C	1	0	1	1	0	0	0	0	0	598	46	5	5	13344	45
GPR75	10936	broad.mit.edu	37	2	54080319	54080320	+	In_Frame_Ins	INS	-	TGCACTAAG	TGCACTAAG			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:54080319_54080320insTGCACTAAG	uc002rxo.3	-	2	1845_1846	c.1574_1575insCTTAGTGCA	c.(1573-1575)CAG>CACTTAGTGCAG	p.524_525insHLV	ASB3_uc002rxi.3_Intron	NM_006794	NP_006785	O95800	GPR75_HUMAN	G protein-coupled receptor 75	524_525	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|skin(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGTCATATTCCTGCACTAAGTC	0.411													22	162	---	---	---	---	capture_indel	In_Frame_Ins	INS	54080319	54080320	GPR75	2	-	TGCACTAAG	TGCACTAAG	TGCACTAAG	1	0	1	1	0	0	0	0	0	311	24	5	5	6641	45
DNAH8	1769	broad.mit.edu	37	6	38709656	38709656	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38709656delT	uc003ooe.1	+	6	1235	c.635delT	c.(634-636)CTGfs	p.L212fs		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CACTCCAAACTGCTAAAGGTA	0.343													17	95	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	38709656	38709656	DNAH8	6	T	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	4563	45
AMZ1	155185	broad.mit.edu	37	7	2740173	2740174	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2740173_2740174insA	uc003smr.1	+	2	449_450	c.88_89insA	c.(88-90)CAGfs	p.Q30fs	AMZ1_uc003sms.1_Frame_Shift_Ins_p.Q30fs|AMZ1_uc011jwa.1_5'Flank	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	30							metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		AGCCCTGCAGCAGCTGTATGTG	0.668													141	305	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	2740173	2740174	AMZ1	7	-	A	A	A	1	0	1	1	0	0	0	0	0	325	25	5	5	593	45
PODXL	5420	broad.mit.edu	37	7	131195806	131195807	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0195-01	TCGA-06-0195-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131195806_131195807insG	uc003vqw.3	-	2	744_745	c.486_487insC	c.(484-489)AGCAGCfs	p.S162fs	PODXL_uc003vqx.3_Frame_Shift_Ins_p.S162fs	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	162_163	Thr-rich.|Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					ACACTGTGGCTGCTTTTCCCCC	0.535													9	799	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	131195806	131195807	PODXL	7	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	12083	45
