Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
COL8A2	1296	broad.mit.edu	37	1	36565672	36565672	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36565672C>T	uc001bzv.1	-	1	179	c.172G>A	c.(172-174)GAG>AAG	p.E58K	COL8A2_uc001bzw.1_Intron	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	58	Nonhelical region (NC2).				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCTTTGCCCTCACGGAAGGGC	0.662											OREG0013361	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	75	---	---	---	---	capture	Missense_Mutation	SNP	36565672	36565672	COL8A2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	3671	49
CYP4A11	1579	broad.mit.edu	37	1	47406941	47406941	+	Silent	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47406941G>A	uc001cqp.3	-	1	216	c.165C>T	c.(163-165)CCC>CCT	p.P55P	CYP4A11_uc001cqq.2_Silent_p.P55P|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	55					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	GCCAGTGGGAGGGAGGGCACG	0.597													60	99	---	---	---	---	capture	Silent	SNP	47406941	47406941	CYP4A11	1	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	4143	49
LHX8	431707	broad.mit.edu	37	1	75614357	75614357	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75614357G>A	uc001dgo.2	+	8	1464	c.800G>A	c.(799-801)CGT>CAT	p.R267H	LHX8_uc001dgq.2_Missense_Mutation_p.R206H	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8	267	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TTGAGCAGACGTGTGATACAG	0.269													26	50	---	---	---	---	capture	Missense_Mutation	SNP	75614357	75614357	LHX8	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8696	49
MCOLN2	255231	broad.mit.edu	37	1	85422200	85422200	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85422200C>T	uc001dkm.2	-	4	720	c.479G>A	c.(478-480)GGC>GAC	p.G160D	MCOLN2_uc001dkn.2_RNA	NM_153259	NP_694991	Q8IZK6	MCLN2_HUMAN	mucolipin 2	160						integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		GACTTTTAAGCCAATTCTATT	0.373													82	149	---	---	---	---	capture	Missense_Mutation	SNP	85422200	85422200	MCOLN2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9309	49
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254													4	90	---	---	---	---	capture	Missense_Mutation	SNP	145367767	145367767	NBPF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10100	49
ACP6	51205	broad.mit.edu	37	1	147131584	147131584	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147131584C>T	uc001epr.2	-	3	870	c.406G>A	c.(406-408)GGA>AGA	p.G136R	ACP6_uc009wjj.1_Missense_Mutation_p.G93R	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor	136					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					AGTCTCTCTCCCAAGGCAAAC	0.483													15	59	---	---	---	---	capture	Missense_Mutation	SNP	147131584	147131584	ACP6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	165	49
FLG	2312	broad.mit.edu	37	1	152275520	152275520	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152275520C>A	uc001ezu.1	-	3	11878	c.11842G>T	c.(11842-11844)GGC>TGC	p.G3948C		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3948	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGGACTGCCACGTGACTGT	0.438									Ichthyosis				53	117	---	---	---	---	capture	Missense_Mutation	SNP	152275520	152275520	FLG	1	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	5867	49
SH2D1B	117157	broad.mit.edu	37	1	162368720	162368720	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:162368720G>A	uc001gbz.1	-	3	478	c.356C>T	c.(355-357)ACA>ATA	p.T119I	SH2D1B_uc001gca.1_Intron	NM_053282	NP_444512	O14796	SH21B_HUMAN	SH2 domain containing 1B	119										pancreas(1)	1	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TACCACAAATGTTTCCAACTC	0.393													31	84	---	---	---	---	capture	Missense_Mutation	SNP	162368720	162368720	SH2D1B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14124	49
MYOC	4653	broad.mit.edu	37	1	171621317	171621317	+	Silent	SNP	G	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:171621317G>T	uc001ghu.2	-	1	457	c.435C>A	c.(433-435)CTC>CTA	p.L145L	MYOC_uc010pmk.1_Silent_p.L87L	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	145	Potential.				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TGTCTCGGAGGAGGTTGCTGT	0.577													56	254	---	---	---	---	capture	Silent	SNP	171621317	171621317	MYOC	1	G	T	T	T	1	0	0	0	0	0	0	0	1	522	41	4	4	9996	49
RBBP5	5929	broad.mit.edu	37	1	205065948	205065948	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205065948G>A	uc001hbu.1	-	12	1388	c.1258C>T	c.(1258-1260)CCG>TCG	p.P420S	RBBP5_uc010prd.1_Missense_Mutation_p.P455S|RBBP5_uc001hbv.1_Missense_Mutation_p.P420S|RBBP5_uc010pre.1_Missense_Mutation_p.P287S	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	420					histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			ACTGCATCCGGTGGGGGGCCG	0.498													66	169	---	---	---	---	capture	Missense_Mutation	SNP	205065948	205065948	RBBP5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	12997	49
SYT14	255928	broad.mit.edu	37	1	210267700	210267700	+	Missense_Mutation	SNP	C	T	T	rs77686387	by1000genomes	TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:210267700C>T	uc009xcv.2	+	5	548	c.476C>T	c.(475-477)CCG>CTG	p.P159L	SYT14_uc001hhs.3_Missense_Mutation_p.P204L|SYT14_uc001hht.3_Missense_Mutation_p.P159L|SYT14_uc001hhu.3_RNA|SYT14_uc010psn.1_Missense_Mutation_p.P204L|SYT14_uc010pso.1_Missense_Mutation_p.P121L	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4	159	Cytoplasmic (Potential).					integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		AGAACACCCCCGCTGGATGAA	0.428													19	34	---	---	---	---	capture	Missense_Mutation	SNP	210267700	210267700	SYT14	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15358	49
MPP7	143098	broad.mit.edu	37	10	28420514	28420514	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:28420514C>T	uc001iua.1	-	8	826	c.422G>A	c.(421-423)CGT>CAT	p.R141H	MPP7_uc009xkz.1_RNA|MPP7_uc001iub.1_Missense_Mutation_p.R141H|MPP7_uc009xla.2_Missense_Mutation_p.R141H|MPP7_uc010qdv.1_RNA	NM_173496	NP_775767	Q5T2T1	MPP7_HUMAN	palmitoylated membrane protein 7	141	PDZ.				establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1						TTTGACCAGACGGATTATTTT	0.423													54	149	---	---	---	---	capture	Missense_Mutation	SNP	28420514	28420514	MPP7	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9651	49
ZNF239	8187	broad.mit.edu	37	10	44052995	44052995	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:44052995G>T	uc001jaw.3	-	2	1186	c.533C>A	c.(532-534)CCC>CAC	p.P178H	ZNF239_uc001jax.3_Missense_Mutation_p.P178H|ZNF239_uc009xmj.2_Missense_Mutation_p.P178H|ZNF239_uc009xmk.2_Missense_Mutation_p.P178H	NM_005674	NP_005665	Q16600	ZN239_HUMAN	zinc finger protein 239	178					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|RNA binding|zinc ion binding				0						ATGGTCACAGGGTTTCTCCTC	0.428													9	132	---	---	---	---	capture	Missense_Mutation	SNP	44052995	44052995	ZNF239	10	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	17671	49
PTEN	5728	broad.mit.edu	37	10	89720852	89720852	+	Nonsense_Mutation	SNP	C	T	T	rs121909231		TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720852C>T	uc001kfb.2	+	9	2034	c.1003C>T	c.(1003-1005)CGA>TGA	p.R335*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	335	C2 tensin-type.			KANKDKANR->AAGADAANA: Reduces growth suppression activity and promotes anchorage-independent growth. Reduces binding to phospholipid membranes in vitro; phosphatase activity towards PtdIns(3,4,5)P3 is not affected.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R335*(21)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.R335fs*8(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.R335fs*4(1)|p.R335fs*7(1)|p.W274_F341del(1)|p.R335R(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAAAGCCAACCGATACTTTTC	0.333		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			35	58	---	---	---	---	capture	Nonsense_Mutation	SNP	89720852	89720852	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	12633	49
KNDC1	85442	broad.mit.edu	37	10	135038289	135038289	+	Silent	SNP	C	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135038289C>G	uc001llz.1	+	30	5146	c.5145C>G	c.(5143-5145)TCC>TCG	p.S1715S		NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	1715	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCGACATTTCCACACTCGCCG	0.582													24	35	---	---	---	---	capture	Silent	SNP	135038289	135038289	KNDC1	10	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	8346	49
OR5L2	26338	broad.mit.edu	37	11	55594994	55594994	+	Silent	SNP	A	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55594994A>G	uc001nhy.1	+	1	300	c.300A>G	c.(298-300)CAA>CAG	p.Q100Q		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	100	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				GCATGGTGCAATTCTACTTGT	0.473										HNSCC(27;0.073)			87	202	---	---	---	---	capture	Silent	SNP	55594994	55594994	OR5L2	11	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	11075	49
GLYATL1	92292	broad.mit.edu	37	11	58723492	58723492	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58723492C>T	uc001nnf.2	+	8	1277	c.901C>T	c.(901-903)CCA>TCA	p.P301S	uc001nng.1_Intron|GLYATL1_uc001nnh.1_Missense_Mutation_p.P332S|GLYATL1_uc001nni.1_Missense_Mutation_p.P301S|GLYATL1_uc001nnj.1_Missense_Mutation_p.P301S			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;	301						mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	GAATCTAGTTCCATTTTAGAC	0.388													28	84	---	---	---	---	capture	Missense_Mutation	SNP	58723492	58723492	GLYATL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6416	49
FAT3	120114	broad.mit.edu	37	11	92532317	92532317	+	Silent	SNP	A	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92532317A>G	uc001pdj.3	+	9	6155	c.6138A>G	c.(6136-6138)GAA>GAG	p.E2046E		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2046	Extracellular (Potential).|Cadherin 18.				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACCGTGAAGAACAAGAGTTAT	0.463										TCGA Ovarian(4;0.039)			4	82	---	---	---	---	capture	Silent	SNP	92532317	92532317	FAT3	11	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	5637	49
TTC12	54970	broad.mit.edu	37	11	113233171	113233171	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113233171G>A	uc001pnu.2	+	19	1768	c.1663G>A	c.(1663-1665)GTT>ATT	p.V555I	TTC12_uc001pnv.2_Missense_Mutation_p.V561I|TTC12_uc001pnw.2_RNA|TTC12_uc001pnx.2_Missense_Mutation_p.V405I	NM_017868	NP_060338	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	555							binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		TCTGAAAATTGTTGAGGAGGC	0.428													25	82	---	---	---	---	capture	Missense_Mutation	SNP	113233171	113233171	TTC12	11	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16561	49
SRPR	6734	broad.mit.edu	37	11	126137085	126137085	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:126137085C>G	uc001qdh.2	-	4	562	c.511G>C	c.(511-513)GGG>CGG	p.G171R	SRPR_uc010sbm.1_Missense_Mutation_p.G143R|FOXRED1_uc001qdi.2_5'Flank|FOXRED1_uc010sbn.1_5'Flank|FOXRED1_uc010sbo.1_5'Flank|FOXRED1_uc010sbp.1_5'Flank|FOXRED1_uc010sbq.1_5'Flank|FOXRED1_uc001qdj.2_5'Flank|FOXRED1_uc010sbr.1_5'Flank	NM_003139	NP_003130	P08240	SRPR_HUMAN	signal recognition particle receptor	171					SRP-dependent cotranslational protein targeting to membrane	integral to membrane|signal recognition particle receptor complex	GTP binding|GTPase activity|receptor activity|signal recognition particle binding				0	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		TTCTTGGCCCCCTTTTTTTTG	0.438													112	290	---	---	---	---	capture	Missense_Mutation	SNP	126137085	126137085	SRPR	11	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	15054	49
ACAD8	27034	broad.mit.edu	37	11	134129623	134129623	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:134129623G>T	uc001qhk.2	+	6	750	c.689G>T	c.(688-690)GGC>GTC	p.G230V	ACAD8_uc009zdc.2_3'UTR|ACAD8_uc010sco.1_Missense_Mutation_p.G132V|ACAD8_uc010scp.1_RNA|ACAD8_uc010scq.1_Missense_Mutation_p.G153V|ACAD8_uc001qhl.2_Missense_Mutation_p.G103V|ACAD8_uc010scr.1_Missense_Mutation_p.G192V|ACAD8_uc009zde.1_Missense_Mutation_p.G103V	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	230					branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)		CTCAGCTTTGGCAAGAAGGAG	0.517													4	125	---	---	---	---	capture	Missense_Mutation	SNP	134129623	134129623	ACAD8	11	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	110	49
CD163L1	283316	broad.mit.edu	37	12	7586265	7586265	+	Silent	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7586265C>T	uc001qsy.2	-	3	176	c.150G>A	c.(148-150)CTG>CTA	p.L50L	CD163L1_uc010sge.1_Silent_p.L50L	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	50	SRCR 1.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						CTCCATTGACCAGCCTCAACT	0.473													38	102	---	---	---	---	capture	Silent	SNP	7586265	7586265	CD163L1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	2939	49
PIK3C2G	5288	broad.mit.edu	37	12	18435035	18435035	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18435035C>T	uc001rdt.2	+	2	136	c.20C>T	c.(19-21)ACG>ATG	p.T7M	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.T7M|PIK3C2G_uc010sic.1_Translation_Start_Site	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	7					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity	p.T7M(1)		lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				TCTTGGCAAACGGATCCAAAT	0.353													8	14	---	---	---	---	capture	Missense_Mutation	SNP	18435035	18435035	PIK3C2G	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11814	49
KRT7	3855	broad.mit.edu	37	12	52642505	52642505	+	Silent	SNP	C	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52642505C>A	uc001saa.1	+	9	1498	c.1371C>A	c.(1369-1371)ATC>ATA	p.I457I	KRT86_uc010snq.1_5'Flank	NM_005556	NP_005547	P08729	K2C7_HUMAN	keratin 7	457	Tail.				cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.105)		CTTATTCCATCCGGACCGCAT	0.647													27	57	---	---	---	---	capture	Silent	SNP	52642505	52642505	KRT7	12	C	A	A	A	1	0	0	0	0	0	0	0	1	382	30	4	4	8403	49
KRT2	3849	broad.mit.edu	37	12	53039092	53039092	+	Missense_Mutation	SNP	C	T	T	rs142557360		TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53039092C>T	uc001sat.2	-	9	1664	c.1631G>A	c.(1630-1632)CGA>CAA	p.R544Q		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	544	Tail.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)		GCCAGACTGTCGGCCTCCAGA	0.572													50	105	---	---	---	---	capture	Missense_Mutation	SNP	53039092	53039092	KRT2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8377	49
DCN	1634	broad.mit.edu	37	12	91552214	91552214	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91552214G>A	uc001tbs.2	-	3	491	c.397C>T	c.(397-399)CGA>TGA	p.R133*	DCN_uc001tbo.2_Intron|DCN_uc001tbp.2_Intron|DCN_uc001tbq.2_Intron|DCN_uc001tbr.2_Intron|DCN_uc001tbt.2_Nonsense_Mutation_p.R133*|DCN_uc001tbu.2_Nonsense_Mutation_p.R133*	NM_133503	NP_598010	P07585	PGS2_HUMAN	decorin isoform a preproprotein	133	LRR 3.				organ morphogenesis	extracellular space		p.R133*(1)		central_nervous_system(2)|ovary(1)|lung(1)	4						AGATAAAGTCGTTCCAACTTC	0.408													65	149	---	---	---	---	capture	Nonsense_Mutation	SNP	91552214	91552214	DCN	12	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	4256	49
POLR3B	55703	broad.mit.edu	37	12	106824234	106824234	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:106824234G>A	uc001tlp.2	+	14	1669	c.1447G>A	c.(1447-1449)GAC>AAC	p.D483N	POLR3B_uc001tlq.2_Missense_Mutation_p.D425N	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	483					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						GTGTCCTTCGGACACTCCTGA	0.522													45	112	---	---	---	---	capture	Missense_Mutation	SNP	106824234	106824234	POLR3B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12131	49
RIMBP2	23504	broad.mit.edu	37	12	130921520	130921520	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130921520G>A	uc001uil.2	-	10	2086	c.1922C>T	c.(1921-1923)CCG>CTG	p.P641L	RIMBP2_uc001uim.2_Missense_Mutation_p.P549L|RIMBP2_uc001uin.1_Missense_Mutation_p.P300L	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	641	Pro-rich.					cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCCCACGGGCGGCTCCAGCAT	0.711													4	18	---	---	---	---	capture	Missense_Mutation	SNP	130921520	130921520	RIMBP2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13255	49
PARP4	143	broad.mit.edu	37	13	25016086	25016086	+	Silent	SNP	A	G	G	rs113538547		TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25016086A>G	uc001upl.2	-	30	3670	c.3564T>C	c.(3562-3564)TTT>TTC	p.F1188F		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1188					cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		GAATATCAGGAAAAGGCGACT	0.413													3	38	---	---	---	---	capture	Silent	SNP	25016086	25016086	PARP4	13	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	11366	49
RB1	5925	broad.mit.edu	37	13	49030485	49030485	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49030485G>C	uc001vcb.2	+	19	2126	c.1960G>C	c.(1960-1962)GTG>CTG	p.V654L		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	654	Pocket; binds T and E1A.|Domain B.		V -> E (in RB).		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)|p.V654fs*4(1)|p.V654fs*6(1)|p.V654L(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTATAAAAAAGGTTAGTAGAT	0.229		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			12	19	---	---	---	---	capture	Missense_Mutation	SNP	49030485	49030485	RB1	13	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	12993	49
RIN3	79890	broad.mit.edu	37	14	93118565	93118565	+	Missense_Mutation	SNP	G	A	A	rs145578489	byFrequency	TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:93118565G>A	uc001yap.2	+	6	1323	c.1171G>A	c.(1171-1173)GTT>ATT	p.V391I	RIN3_uc010auk.2_Missense_Mutation_p.V53I|RIN3_uc001yaq.2_Missense_Mutation_p.V316I|RIN3_uc001yar.1_Missense_Mutation_p.V53I|RIN3_uc001yas.1_Missense_Mutation_p.V53I	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	391	Pro-rich.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				CAGACGCCGCGTTTCCGAGAG	0.667													25	71	---	---	---	---	capture	Missense_Mutation	SNP	93118565	93118565	RIN3	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13265	49
RCOR1	23186	broad.mit.edu	37	14	103174815	103174815	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:103174815C>G	uc001ymb.2	+	6	665	c.665C>G	c.(664-666)TCT>TGT	p.S222C		NM_015156	NP_055971	Q9UKL0	RCOR1_HUMAN	REST corepressor 1	222	Interaction with HDAC1.|SANT 1.				blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1						CCAGATAAATCTATAGCAAGT	0.299													5	351	---	---	---	---	capture	Missense_Mutation	SNP	103174815	103174815	RCOR1	14	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	13077	49
JAG2	3714	broad.mit.edu	37	14	105617967	105617967	+	Silent	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105617967G>A	uc001yqg.2	-	8	1553	c.1149C>T	c.(1147-1149)GCC>GCT	p.A383A	JAG2_uc001yqf.2_5'Flank|JAG2_uc001yqh.2_Silent_p.A383A	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	383	EGF-like 4.|Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		ACTCACCAAGGGCACAGGTGG	0.652													6	7	---	---	---	---	capture	Silent	SNP	105617967	105617967	JAG2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7858	49
TMC3	342125	broad.mit.edu	37	15	81624852	81624852	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81624852G>A	uc002bgo.1	-	22	3211	c.3211C>T	c.(3211-3213)CCG>TCG	p.P1071S	TMC3_uc010blr.1_RNA	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	1071	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2						ACGGACCTCGGGAACCTGCCC	0.612													7	20	---	---	---	---	capture	Missense_Mutation	SNP	81624852	81624852	TMC3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15871	49
NPRL3	8131	broad.mit.edu	37	16	167362	167362	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:167362C>G	uc002cfr.2	-	5	430	c.331G>C	c.(331-333)GAT>CAT	p.D111H	NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_RNA|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc010uuc.1_Missense_Mutation_p.D33H|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN	conserved gene telomeric to alpha globin cluster	111							protein binding			ovary(1)	1						GGGGAAGGATCTGTTTTGGAG	0.393													5	19	---	---	---	---	capture	Missense_Mutation	SNP	167362	167362	NPRL3	16	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	10505	49
CX3CL1	6376	broad.mit.edu	37	16	57416501	57416501	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57416501G>A	uc002eli.2	+	3	818	c.751G>A	c.(751-753)GGA>AGA	p.G251R		NM_002996	NP_002987	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1 precursor	251	Mucin-like stalk.|Extracellular (Potential).				cell adhesion|cytokine-mediated signaling pathway|defense response|immune response|leukocyte adhesive activation|positive regulation of calcium-independent cell-cell adhesion|positive regulation of inflammatory response	cell surface|extracellular space|integral to membrane|plasma membrane	chemokine activity				0						GTGGGGTCAGGGACAGAGCCC	0.692													11	70	---	---	---	---	capture	Missense_Mutation	SNP	57416501	57416501	CX3CL1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4034	49
SCN4A	6329	broad.mit.edu	37	17	62018566	62018566	+	Silent	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62018566C>T	uc002jds.1	-	24	5153	c.5076G>A	c.(5074-5076)GGG>GGA	p.G1692G		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1692					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	CGTCCATTTCCCCAGAGTCAC	0.577													40	93	---	---	---	---	capture	Silent	SNP	62018566	62018566	SCN4A	17	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	13813	49
ITGB4	3691	broad.mit.edu	37	17	73745120	73745120	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73745120G>A	uc002jpg.2	+	27	3497	c.3310G>A	c.(3310-3312)GAC>AAC	p.D1104N	ITGB4_uc002jph.2_Missense_Mutation_p.D1104N|ITGB4_uc002jpi.3_Missense_Mutation_p.D1104N|ITGB4_uc002jpj.2_Missense_Mutation_p.D1104N	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	1104	Cytoplasmic (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CATCATCAGGGACCCAGGTAG	0.552													9	30	---	---	---	---	capture	Missense_Mutation	SNP	73745120	73745120	ITGB4	17	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	7820	49
PRKCSH	5589	broad.mit.edu	37	19	11559895	11559895	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11559895T>C	uc002mrt.2	+	16	1681	c.1345T>C	c.(1345-1347)TGG>CGG	p.W449R	PRKCSH_uc002mru.2_Missense_Mutation_p.W446R|PRKCSH_uc010xlz.1_Missense_Mutation_p.W456R|PRKCSH_uc010dya.2_Missense_Mutation_p.W231R|PRKCSH_uc010dyb.2_Missense_Mutation_p.W446R	NM_002743	NP_002734	P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H isoform 1	449	PRKCSH.				innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding				0						TCACAGCACCTGGGGCTCATG	0.662													3	108	---	---	---	---	capture	Missense_Mutation	SNP	11559895	11559895	PRKCSH	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	12412	49
LRP3	4037	broad.mit.edu	37	19	33695616	33695616	+	Silent	SNP	A	C	C			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33695616A>C	uc010edh.2	+	4	426	c.333A>C	c.(331-333)CCA>CCC	p.P111P	LRP3_uc010xrp.1_5'UTR|LRP3_uc002nuk.3_5'UTR	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	111	Extracellular (Potential).|CUB 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CAGCAGCCCCACCCCGCCAGG	0.662													7	89	---	---	---	---	capture	Silent	SNP	33695616	33695616	LRP3	19	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	8874	49
B3GNT8	374907	broad.mit.edu	37	19	41932546	41932546	+	Silent	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41932546C>T	uc002oqs.2	-	3	592	c.138G>A	c.(136-138)ACG>ACA	p.T46T	CYP2F1_uc010xvw.1_Intron|B3GNT8_uc002oqt.1_Intron	NM_198540	NP_940942	Q7Z7M8	B3GN8_HUMAN	UDP-GlcNAc:betaGal	46	Lumenal (Potential).				poly-N-acetyllactosamine biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity|protein N-acetylglucosaminyltransferase activity				0						GGTTGGCTGGCGTGGGGCTTG	0.662													6	14	---	---	---	---	capture	Silent	SNP	41932546	41932546	B3GNT8	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1252	49
TTC15	51112	broad.mit.edu	37	2	3392024	3392024	+	Silent	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3392024C>T	uc002qxm.1	+	2	836	c.630C>T	c.(628-630)TTC>TTT	p.F210F	TTC15_uc002qxn.1_Silent_p.F210F|TTC15_uc010ewm.1_Silent_p.F210F|TTC15_uc002qxl.1_Silent_p.F210F	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15	210							binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)		GCACGTTCTTCGGAGACACGG	0.587													7	68	---	---	---	---	capture	Silent	SNP	3392024	3392024	TTC15	2	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	16564	49
GREB1	9687	broad.mit.edu	37	2	11706613	11706613	+	Silent	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:11706613C>T	uc002rbk.1	+	4	585	c.285C>T	c.(283-285)TGC>TGT	p.C95C	GREB1_uc002rbl.2_Silent_p.C95C|GREB1_uc002rbm.2_5'UTR|GREB1_uc002rbn.1_Silent_p.C95C	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	95						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TAGGGTTTTGCCAGGCCGGGA	0.642													4	108	---	---	---	---	capture	Silent	SNP	11706613	11706613	GREB1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	6693	49
BUB1	699	broad.mit.edu	37	2	111408233	111408233	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:111408233C>T	uc002tgc.2	-	18	2205	c.2093G>A	c.(2092-2094)TGC>TAC	p.C698Y	BUB1_uc010yxh.1_Missense_Mutation_p.C678Y|BUB1_uc010fkb.2_Missense_Mutation_p.C698Y	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	698					apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		TGTGAGTCTGCAAGCCTCAAC	0.532													13	26	---	---	---	---	capture	Missense_Mutation	SNP	111408233	111408233	BUB1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	1558	49
SCN9A	6335	broad.mit.edu	37	2	167055444	167055444	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167055444C>G	uc010fpl.2	-	27	6013	c.5672G>C	c.(5671-5673)CGT>CCT	p.R1891P	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1902	IQ.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	TAAGCGGTAACGTCTATAAGC	0.363													47	117	---	---	---	---	capture	Missense_Mutation	SNP	167055444	167055444	SCN9A	2	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	13818	49
COL3A1	1281	broad.mit.edu	37	2	189868848	189868848	+	Silent	SNP	G	A	A	rs113870310		TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189868848G>A	uc002uqj.1	+	39	2919	c.2802G>A	c.(2800-2802)TCG>TCA	p.S934S		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	934	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	p.S934S(1)		central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	AGAAGGGATCGCCTGGTGCCC	0.488													15	40	---	---	---	---	capture	Silent	SNP	189868848	189868848	COL3A1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3653	49
NBEAL1	65065	broad.mit.edu	37	2	204037528	204037528	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:204037528A>G	uc002uzt.3	+	40	6521	c.6188A>G	c.(6187-6189)AAA>AGA	p.K2063R	NBEAL1_uc002uzs.3_Missense_Mutation_p.K773R	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	2063	BEACH.						binding			ovary(1)|skin(1)	2						GATCTTTCCAAACCAATTGGG	0.328													71	130	---	---	---	---	capture	Missense_Mutation	SNP	204037528	204037528	NBEAL1	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	10095	49
SIRPA	140885	broad.mit.edu	37	20	1895993	1895993	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1895993A>G	uc002wfq.2	+	3	688	c.328A>G	c.(328-330)AAC>GAC	p.N110D	SIRPA_uc010zps.1_Missense_Mutation_p.N90D|SIRPA_uc002wfr.2_Missense_Mutation_p.N110D|SIRPA_uc002wfs.2_Missense_Mutation_p.N110D|SIRPA_uc002wft.2_Missense_Mutation_p.N110D	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	110	Ig-like V-type.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CCGCATCGGTAACATCACCCC	0.502													42	48	---	---	---	---	capture	Missense_Mutation	SNP	1895993	1895993	SIRPA	20	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	14225	49
FGD5	152273	broad.mit.edu	37	3	14960268	14960268	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14960268G>A	uc003bzc.2	+	13	3607	c.3497G>A	c.(3496-3498)CGC>CAC	p.R1166H	FGD5_uc011avk.1_Missense_Mutation_p.R1166H|FGD5_uc003bzd.2_Missense_Mutation_p.R244H	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1166	PH 1.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CAGGTCAGCCGCCCTGTGATG	0.602													28	43	---	---	---	---	capture	Missense_Mutation	SNP	14960268	14960268	FGD5	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5782	49
OR5AC2	81050	broad.mit.edu	37	3	97806681	97806681	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97806681G>A	uc011bgs.1	+	1	665	c.665G>A	c.(664-666)CGT>CAT	p.R222H		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TCTTATACTCGTGTGCTCTTT	0.373													21	32	---	---	---	---	capture	Missense_Mutation	SNP	97806681	97806681	OR5AC2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11045	49
DTX3L	151636	broad.mit.edu	37	3	122289489	122289489	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122289489A>G	uc003efk.2	+	4	2212	c.2123A>G	c.(2122-2124)CAC>CGC	p.H708R	DTX3L_uc010hrj.2_Missense_Mutation_p.H196R	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	708					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		GATATTCACCACAAAACATCC	0.423													27	80	---	---	---	---	capture	Missense_Mutation	SNP	122289489	122289489	DTX3L	3	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	4751	49
PDGFRA	5156	broad.mit.edu	37	4	55156661	55156661	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55156661C>T	uc003han.3	+	22	3393	c.3062C>T	c.(3061-3063)CCT>CTT	p.P1021L	PDGFRA_uc003haa.2_Missense_Mutation_p.P781L	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	1021	Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TACATCATTCCTCTGCCTGAC	0.562			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			5	116	---	---	---	---	capture	Missense_Mutation	SNP	55156661	55156661	PDGFRA	4	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	11564	49
FSTL5	56884	broad.mit.edu	37	4	162697175	162697175	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:162697175T>C	uc003iqh.2	-	5	897	c.461A>G	c.(460-462)GAT>GGT	p.D154G	FSTL5_uc003iqi.2_Missense_Mutation_p.D153G|FSTL5_uc010iqv.2_Missense_Mutation_p.D153G	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	154						extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		ATTTTGTAAATCTAATAGCAT	0.279													20	31	---	---	---	---	capture	Missense_Mutation	SNP	162697175	162697175	FSTL5	4	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	6022	49
CHSY3	337876	broad.mit.edu	37	5	129243856	129243856	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:129243856C>G	uc003kvd.2	+	2	889	c.889C>G	c.(889-891)CTT>GTT	p.L297V		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	297	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TATTGAAGAGCTTGGAAAGCT	0.473													30	77	---	---	---	---	capture	Missense_Mutation	SNP	129243856	129243856	CHSY3	5	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	3378	49
SLIT3	6586	broad.mit.edu	37	5	168175347	168175347	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168175347G>A	uc003mab.2	-	20	2650	c.2230C>T	c.(2230-2232)CGC>TGC	p.R744C	SLIT3_uc010jjg.2_Missense_Mutation_p.R744C	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	744	LRRNT 4.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGGAGGGCGCGGAGCCCCTTG	0.632													74	142	---	---	---	---	capture	Missense_Mutation	SNP	168175347	168175347	SLIT3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14633	49
PSORS1C1	170679	broad.mit.edu	37	6	31106528	31106528	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31106528T>C	uc003nsl.1	+	5	413	c.139T>C	c.(139-141)TGC>CGC	p.C47R	PSORS1C1_uc010jsj.1_Intron|PSORS1C1_uc003nsn.1_Intron|PSORS1C2_uc003nso.3_Intron	NM_014068	NP_054787	Q9UIG5	PS1C1_HUMAN	SEEK1 protein	47										ovary(1)	1						TGACCGACTTTGCCACATGGA	0.557													73	156	---	---	---	---	capture	Missense_Mutation	SNP	31106528	31106528	PSORS1C1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	12609	49
MRAP2	112609	broad.mit.edu	37	6	84799086	84799086	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84799086C>A	uc003pkg.3	+	4	694	c.504C>A	c.(502-504)AAC>AAA	p.N168K	MRAP2_uc010kbo.2_Missense_Mutation_p.N82K	NM_138409	NP_612418	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	168					positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding			skin(2)	2						ACATCCCCAACTTTGTGAACA	0.502													35	103	---	---	---	---	capture	Missense_Mutation	SNP	84799086	84799086	MRAP2	6	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	9666	49
ULBP1	80329	broad.mit.edu	37	6	150291168	150291168	+	Silent	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:150291168C>T	uc003qnp.2	+	4	685	c.642C>T	c.(640-642)GCC>GCT	p.A214A		NM_025218	NP_079494	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1 precursor	214					antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|endoplasmic reticulum|MHC class I protein complex	MHC class I receptor activity			pancreas(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		CCTCTCTGGCCCCAGGCACAA	0.562													7	25	---	---	---	---	capture	Silent	SNP	150291168	150291168	ULBP1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	16854	49
PACRG	135138	broad.mit.edu	37	6	163235289	163235289	+	Silent	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163235289G>A	uc003qua.2	+	3	491	c.267G>A	c.(265-267)TCG>TCA	p.S89S	PACRG_uc003qub.2_Silent_p.S89S|PACRG_uc003quc.2_Silent_p.S89S	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1	89											0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		AGCATGATTCGAAAGGAAACA	0.517													92	170	---	---	---	---	capture	Silent	SNP	163235289	163235289	PACRG	6	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11274	49
NPSR1	387129	broad.mit.edu	37	7	34698051	34698051	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:34698051C>A	uc003teg.1	+	1	155	c.27C>A	c.(25-27)AGC>AGA	p.S9R	AAA1_uc010kwo.1_Intron|AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron|AAA1_uc003teb.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Missense_Mutation_p.S9R|NPSR1_uc010kwt.1_5'UTR|NPSR1_uc010kwu.1_5'UTR|NPSR1_uc010kwv.1_Missense_Mutation_p.S9R|NPSR1_uc003tei.1_Missense_Mutation_p.S9R|NPSR1_uc010kww.1_Missense_Mutation_p.S9R|NPSR1_uc011kar.1_Missense_Mutation_p.S9R	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma	9	Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	CAGAGGGCAGCTTCGATTCCA	0.572													31	124	---	---	---	---	capture	Missense_Mutation	SNP	34698051	34698051	NPSR1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	10507	49
WBSCR17	64409	broad.mit.edu	37	7	70597924	70597924	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:70597924G>A	uc003tvy.2	+	1	136	c.136G>A	c.(136-138)GCC>ACC	p.A46T		NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	46	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCGGCCGCGCGCCGAGGTGGC	0.677													15	53	---	---	---	---	capture	Missense_Mutation	SNP	70597924	70597924	WBSCR17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17145	49
SRCRB4D	136853	broad.mit.edu	37	7	76033702	76033702	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76033702C>T	uc003ufb.2	-	2	403	c.55G>A	c.(55-57)GGG>AGG	p.G19R	ZP3_uc003ufc.3_Intron	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	19						extracellular region|membrane	scavenger receptor activity			pancreas(1)	1						AACCTCCACCCCCAGCGCTTC	0.597													39	119	---	---	---	---	capture	Missense_Mutation	SNP	76033702	76033702	SRCRB4D	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15029	49
RELN	5649	broad.mit.edu	37	7	103417022	103417022	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103417022G>A	uc003vca.2	-	4	686	c.526C>T	c.(526-528)CAG>TAG	p.Q176*	RELN_uc010liz.2_Nonsense_Mutation_p.Q176*	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	176	Reelin.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCACACAACTGCTGGGCTAAA	0.403													43	162	---	---	---	---	capture	Nonsense_Mutation	SNP	103417022	103417022	RELN	7	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	13115	49
CTTNBP2	83992	broad.mit.edu	37	7	117432019	117432019	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117432019G>T	uc003vjf.2	-	4	1323	c.1231C>A	c.(1231-1233)CAA>AAA	p.Q411K		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	411	Pro-rich.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCTGGTGTTTGAGCGGTGGGA	0.522													84	366	---	---	---	---	capture	Missense_Mutation	SNP	117432019	117432019	CTTNBP2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	4006	49
GALT	2592	broad.mit.edu	37	9	34648454	34648454	+	Splice_Site	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34648454G>A	uc003zve.2	+	7	754	c.687_splice	c.e7+1	p.K229_splice	GALT_uc003zvf.2_Splice_Site_p.K120_splice|GALT_uc003zvg.2_Splice_Site_p.K101_splice|GALT_uc003zvh.2_Splice_Site_p.K181_splice|GALT_uc011lop.1_Splice_Site_p.K181_splice|IL11RA_uc003zvi.2_5'Flank	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase						galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		ACTCAGGAAGGTGGGAGAGAG	0.453									Galactosemia				11	112	---	---	---	---	capture	Splice_Site	SNP	34648454	34648454	GALT	9	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	6170	49
TDRD7	23424	broad.mit.edu	37	9	100245441	100245441	+	Nonsense_Mutation	SNP	C	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100245441C>G	uc004axj.2	+	15	2948	c.2723C>G	c.(2722-2724)TCA>TGA	p.S908*	TDRD7_uc011lux.1_Nonsense_Mutation_p.S834*|TDRD7_uc010msp.1_Nonsense_Mutation_p.S160*|TDRD7_uc011luy.1_Nonsense_Mutation_p.S228*	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	908	Interacts with CDK17 (By similarity).|Interacts with CABLES1 (By similarity).				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				GTCCACTTATCAAAGCCAGGG	0.498													32	83	---	---	---	---	capture	Nonsense_Mutation	SNP	100245441	100245441	TDRD7	9	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	15620	49
TNFSF15	9966	broad.mit.edu	37	9	117552981	117552981	+	Silent	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117552981G>A	uc004bjh.2	-	4	623	c.507C>T	c.(505-507)GGC>GGT	p.G169G	TNFSF15_uc004bjg.2_Silent_p.G110G	NM_005118	NP_005109	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily,	169	Extracellular (Potential).				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|cytokine metabolic process|immune response	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding				0						TGTTTGGTCGGCCTGCTTGTC	0.527													13	31	---	---	---	---	capture	Silent	SNP	117552981	117552981	TNFSF15	9	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	16191	49
CACNA1F	778	broad.mit.edu	37	X	49077514	49077514	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49077514G>T	uc004dnb.2	-	18	2409	c.2347C>A	c.(2347-2349)CCA>ACA	p.P783T	CACNA1F_uc010nip.2_Missense_Mutation_p.P772T	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	783	Cytoplasmic (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	TTCTCCTGTGGGAGATCCTTC	0.498													4	58	---	---	---	---	capture	Missense_Mutation	SNP	49077514	49077514	CACNA1F	23	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	2519	49
TAF1	6872	broad.mit.edu	37	X	70587386	70587386	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70587386G>A	uc004dzu.3	+	2	269	c.218G>A	c.(217-219)GGG>GAG	p.G73E	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.G73E	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	73	Protein kinase 1.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity	p.G73E(1)		ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				GGGGCTTTGGGGCTGGGCAGC	0.522													15	47	---	---	---	---	capture	Missense_Mutation	SNP	70587386	70587386	TAF1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15401	49
ARMCX2	9823	broad.mit.edu	37	X	100910782	100910782	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100910782T>G	uc004eid.2	-	3	2148	c.1793A>C	c.(1792-1794)TAC>TCC	p.Y598S	ARMCX2_uc004eie.3_Missense_Mutation_p.Y598S|ARMCX2_uc004eif.3_Missense_Mutation_p.Y598S|ARMCX2_uc004eig.3_Missense_Mutation_p.Y598S|ARMCX2_uc010nnt.2_Missense_Mutation_p.Y598S	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	598						integral to membrane	binding			ovary(6)	6						AGTGCATAAGTAAAAAAGGGA	0.328													72	169	---	---	---	---	capture	Missense_Mutation	SNP	100910782	100910782	ARMCX2	23	T	G	G	G	1	0	0	0	0	1	0	0	0	741	57	4	4	953	49
RNF128	79589	broad.mit.edu	37	X	106038858	106038858	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:106038858A>G	uc004eml.2	+	7	1452	c.1202A>G	c.(1201-1203)GAT>GGT	p.D401G	RNF128_uc004emk.2_Missense_Mutation_p.D375G	NM_194463	NP_919445	Q8TEB7	RN128_HUMAN	ring finger protein 128 isoform 1	401						endomembrane system|integral to membrane|perinuclear region of cytoplasm	zinc ion binding			ovary(1)|central_nervous_system(1)	2						GTGGCAGTGGATGTTATTCCT	0.358													101	187	---	---	---	---	capture	Missense_Mutation	SNP	106038858	106038858	RNF128	23	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	13328	49
LAMP2	3920	broad.mit.edu	37	X	119580241	119580241	+	Silent	SNP	G	T	T			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119580241G>T	uc004est.3	-	6	963	c.783C>A	c.(781-783)TCC>TCA	p.S261S	LAMP2_uc004ess.3_Silent_p.S261S|LAMP2_uc011mtz.1_Silent_p.S150S|LAMP2_uc011mua.1_Silent_p.S214S|LAMP2_uc010nqp.1_Silent_p.S261S	NM_002294	NP_002285	P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2 isoform	261	Lumenal (Potential).|Second lumenal domain.				platelet activation|platelet degranulation	endosome membrane|integral to membrane|late endosome|lysosomal membrane|membrane fraction|plasma membrane|platelet dense granule membrane				ovary(1)	1						AGCTGCCTGTGGAGTGAGTTG	0.423													32	68	---	---	---	---	capture	Silent	SNP	119580241	119580241	LAMP2	23	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	8538	49
GRIA3	2892	broad.mit.edu	37	X	122528885	122528885	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122528885G>A	uc004etq.3	+	7	1110	c.817G>A	c.(817-819)GTC>ATC	p.V273I	GRIA3_uc004etr.3_Missense_Mutation_p.V273I|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.V257I	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	273	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	TTTCCAGATTGTCAACAATGA	0.438													67	152	---	---	---	---	capture	Missense_Mutation	SNP	122528885	122528885	GRIA3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	6702	49
THOC2	57187	broad.mit.edu	37	X	122761607	122761607	+	Silent	SNP	G	A	A			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122761607G>A	uc004etu.2	-	23	2726	c.2694C>T	c.(2692-2694)AGC>AGT	p.S898S	THOC2_uc011muh.1_Silent_p.S823S	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	898	Potential.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						CTCGTTCATAGCTGGTGTGTG	0.388													45	98	---	---	---	---	capture	Silent	SNP	122761607	122761607	THOC2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	15750	49
COL24A1	255631	broad.mit.edu	37	1	86289377	86289379	+	In_Frame_Del	DEL	TTG	-	-			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86289377_86289379delTTG	uc001dlj.2	-	44	3766_3768	c.3724_3726delCAA	c.(3724-3726)CAAdel	p.Q1242del	COL24A1_uc001dli.2_In_Frame_Del_p.Q378del|COL24A1_uc010osd.1_In_Frame_Del_p.Q542del|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	1242	Collagen-like 13.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTGGGGGTCCTTGTTGTCCAGTG	0.340													120	245	---	---	---	---	capture_indel	In_Frame_Del	DEL	86289377	86289379	COL24A1	1	TTG	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	3648	49
TCF7L2	6934	broad.mit.edu	37	10	114925317	114925317	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:114925317delA	uc001lae.3	+	14	1902	c.1395delA	c.(1393-1395)AGAfs	p.R465fs	TCF7L2_uc001lac.3_Frame_Shift_Del_p.R459fs|TCF7L2_uc010qrk.1_Frame_Shift_Del_p.E435fs|TCF7L2_uc010qrl.1_Frame_Shift_Del_p.R442fs|TCF7L2_uc010qrm.1_Frame_Shift_Del_p.E441fs|TCF7L2_uc010qrn.1_Frame_Shift_Del_p.E384fs|TCF7L2_uc001lad.3_Frame_Shift_Del_p.E431fs|TCF7L2_uc001lag.3_Frame_Shift_Del_p.E465fs|TCF7L2_uc001laf.3_Frame_Shift_Del_p.R442fs|TCF7L2_uc010qro.1_Frame_Shift_Del_p.E418fs|TCF7L2_uc001lah.2_3'UTR|TCF7L2_uc010qrp.1_3'UTR|TCF7L2_uc010qrq.1_3'UTR|TCF7L2_uc010qrr.1_Frame_Shift_Del_p.R397fs|TCF7L2_uc010qrs.1_Frame_Shift_Del_p.R353fs|TCF7L2_uc010qrt.1_Frame_Shift_Del_p.R353fs|TCF7L2_uc010qru.1_Frame_Shift_Del_p.E357fs|TCF7L2_uc010qrv.1_3'UTR|TCF7L2_uc010qrw.1_3'UTR|TCF7L2_uc010qrx.1_3'UTR	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1	482	Promoter-specific activation domain.				anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding	p.R465C(1)		large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TTTCTAGGAGAAAAAAAAAGT	0.522													7	315	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	114925317	114925317	TCF7L2	10	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	15583	49
ATRX	546	broad.mit.edu	37	X	76872167	76872167	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0213-01	TCGA-06-0213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76872167delA	uc004ecp.3	-	22	5712	c.5480delT	c.(5479-5481)TTGfs	p.L1827fs	ATRX_uc004ecq.3_Frame_Shift_Del_p.L1789fs|ATRX_uc004eco.3_Frame_Shift_Del_p.L1612fs	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1827					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TTTTGGAGGCAAGAATTTTGT	0.318			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						47	107	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	76872167	76872167	ATRX	23	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	1199	49
