Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CROCC	9696	broad.mit.edu	37	1	17266398	17266398	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17266398G>A	uc001azt.2	+	13	1687	c.1618G>A	c.(1618-1620)GGG>AGG	p.G540R	CROCC_uc009voy.1_Missense_Mutation_p.G243R|CROCC_uc009voz.1_Missense_Mutation_p.G303R|CROCC_uc001azu.2_5'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	540					cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGACATGCGTGGGCGCTATGA	0.647													10	234	---	---	---	---	capture	Missense_Mutation	SNP	17266398	17266398	CROCC	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	3858	50
CLIC4	25932	broad.mit.edu	37	1	25124266	25124266	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:25124266C>T	uc001bjo.2	+	2	391	c.106C>T	c.(106-108)CCC>TCC	p.P36S	CLIC4_uc001bjn.2_RNA|CLIC4_uc001bjp.1_Intron	NM_013943	NP_039234	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	36	Required for insertion into the membrane (Probable).				cellular response to calcium ion|establishment or maintenance of apical/basal cell polarity|keratinocyte differentiation|negative regulation of cell migration|regulation of cytoskeleton organization	actin cytoskeleton|apical part of cell|cell surface|cell-cell junction|centrosome|chloride channel complex|cytoplasmic vesicle membrane|cytosol|microvillus|midbody|mitochondrion|nuclear matrix|perinuclear region of cytoplasm|soluble fraction	voltage-gated chloride channel activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		AGGAAACTGCCCCTTTTCCCA	0.403													30	82	---	---	---	---	capture	Missense_Mutation	SNP	25124266	25124266	CLIC4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3493	50
BSDC1	55108	broad.mit.edu	37	1	32843632	32843632	+	Silent	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32843632G>A	uc001bvh.3	-	8	662	c.615C>T	c.(613-615)GAC>GAT	p.D205D	BSDC1_uc010ohg.1_Silent_p.D222D|BSDC1_uc010ohh.1_Silent_p.D149D|BSDC1_uc010ohi.1_Silent_p.D110D|BSDC1_uc001bvg.3_RNA|BSDC1_uc001bvj.2_Silent_p.D101D|BSDC1_uc001bvi.2_Silent_p.D222D	NM_018045	NP_060515	Q9NW68	BSDC1_HUMAN	BSD domain containing 1 isoform b	205							protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GCTTCAGGGCGTCCCTCCGGG	0.622													4	52	---	---	---	---	capture	Silent	SNP	32843632	32843632	BSDC1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1516	50
IL12RB2	3595	broad.mit.edu	37	1	67787302	67787302	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67787302G>A	uc001ddu.2	+	3	734	c.94G>A	c.(94-96)GAT>AAT	p.D32N	IL12RB2_uc010oqi.1_Missense_Mutation_p.D32N|IL12RB2_uc010oqj.1_Missense_Mutation_p.D32N|IL12RB2_uc010oqk.1_RNA|IL12RB2_uc010oql.1_Missense_Mutation_p.D32N|IL12RB2_uc010oqm.1_Missense_Mutation_p.D32N|IL12RB2_uc010oqn.1_RNA	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor	32	Extracellular (Potential).				positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						CAAGAGAGGCGATGTGACTGT	0.393													69	176	---	---	---	---	capture	Missense_Mutation	SNP	67787302	67787302	IL12RB2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7550	50
SYDE2	84144	broad.mit.edu	37	1	85624652	85624652	+	Silent	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85624652G>A	uc009wcm.2	-	7	3415	c.3366C>T	c.(3364-3366)ATC>ATT	p.I1122I		NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	1122					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		AATTTTCTCCGATTTTTCTAT	0.363													19	51	---	---	---	---	capture	Silent	SNP	85624652	85624652	SYDE2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	15324	50
GBP3	2635	broad.mit.edu	37	1	89481028	89481028	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89481028T>C	uc001dmt.2	-	3	465	c.260A>G	c.(259-261)AAA>AGA	p.K87R	GBP3_uc010oss.1_Missense_Mutation_p.K8R|GBP3_uc001dmu.2_5'UTR|GBP3_uc001dmv.2_RNA	NM_018284	NP_060754	Q9H0R5	GBP3_HUMAN	guanylate binding protein 3	87						integral to membrane	GTP binding|GTPase activity			ovary(1)|pancreas(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		TTCTGGCTTTTTGGGGTGAGG	0.483													26	232	---	---	---	---	capture	Missense_Mutation	SNP	89481028	89481028	GBP3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	6215	50
FAM46C	54855	broad.mit.edu	37	1	118166248	118166248	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118166248G>A	uc001ehe.2	+	2	957	c.758G>A	c.(757-759)CGG>CAG	p.R253Q		NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855	253											0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		CTTCTTGTGCGGGACTTCAGG	0.517										Multiple Myeloma(3;1.13e-06)			8	101	---	---	---	---	capture	Missense_Mutation	SNP	118166248	118166248	FAM46C	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5515	50
HRNR	388697	broad.mit.edu	37	1	152192393	152192393	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152192393C>T	uc001ezt.1	-	3	1788	c.1712G>A	c.(1711-1713)CGT>CAT	p.R571H		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	571					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATATGGGCCACGGCTTGAAGA	0.592													94	198	---	---	---	---	capture	Missense_Mutation	SNP	152192393	152192393	HRNR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7284	50
SPTA1	6708	broad.mit.edu	37	1	158639308	158639308	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158639308G>A	uc001fst.1	-	14	1922	c.1723C>T	c.(1723-1725)CGT>TGT	p.R575C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	575	Spectrin 6.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGCAATCTACGTCTAGTGGCA	0.448													99	198	---	---	---	---	capture	Missense_Mutation	SNP	158639308	158639308	SPTA1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15008	50
CCDC19	25790	broad.mit.edu	37	1	159846467	159846467	+	Missense_Mutation	SNP	G	A	A	rs141229765		TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159846467G>A	uc001fui.2	-	10	1249	c.1231C>T	c.(1231-1233)CGG>TGG	p.R411W	CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Missense_Mutation_p.R326W|CCDC19_uc001ful.2_Missense_Mutation_p.R326W|CCDC19_uc009wtc.1_Missense_Mutation_p.A410V	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1	411	Potential.					mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			ATCTTCTTCCGCGCATTTTCC	0.577													6	80	---	---	---	---	capture	Missense_Mutation	SNP	159846467	159846467	CCDC19	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	2769	50
ANGEL2	90806	broad.mit.edu	37	1	213178541	213178541	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:213178541G>A	uc001hjz.2	-	5	1123	c.968C>T	c.(967-969)ACG>ATG	p.T323M	ANGEL2_uc010pto.1_Missense_Mutation_p.T197M|ANGEL2_uc010ptp.1_Missense_Mutation_p.T197M|ANGEL2_uc001hka.2_Missense_Mutation_p.T154M|ANGEL2_uc010ptq.1_RNA	NM_144567	NP_653168	Q5VTE6	ANGE2_HUMAN	LOC90806 protein	323											0				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TGCCAATTGCGTCAGCTTAAT	0.453													13	181	---	---	---	---	capture	Missense_Mutation	SNP	213178541	213178541	ANGEL2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	606	50
USH2A	7399	broad.mit.edu	37	1	216143995	216143995	+	Missense_Mutation	SNP	G	A	A	rs151057466	by1000genomes	TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216143995G>A	uc001hku.1	-	36	7316	c.6929C>T	c.(6928-6930)ACG>ATG	p.T2310M		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2310	Fibronectin type-III 9.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACCTTTGGCCGTGCATGCTTG	0.408										HNSCC(13;0.011)			49	107	---	---	---	---	capture	Missense_Mutation	SNP	216143995	216143995	USH2A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16918	50
LYST	1130	broad.mit.edu	37	1	235940405	235940405	+	Silent	SNP	G	A	A	rs146990900		TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235940405G>A	uc001hxj.2	-	17	5593	c.5418C>T	c.(5416-5418)CAC>CAT	p.H1806H	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1806					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CACCAATTTCGTGCAGAATGC	0.348									Chediak-Higashi_syndrome				11	165	---	---	---	---	capture	Silent	SNP	235940405	235940405	LYST	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9043	50
PLXDC2	84898	broad.mit.edu	37	10	20466312	20466312	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:20466312C>G	uc001iqg.1	+	9	1672	c.1035C>G	c.(1033-1035)AAC>AAG	p.N345K	PLXDC2_uc001iqh.1_Missense_Mutation_p.N296K|PLXDC2_uc009xkc.1_RNA	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor	345	Extracellular (Potential).|PSI.					integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						TTGGCTTCAACTGCAGTTGGT	0.294													58	111	---	---	---	---	capture	Missense_Mutation	SNP	20466312	20466312	PLXDC2	10	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	12021	50
OR4X2	119764	broad.mit.edu	37	11	48266683	48266683	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48266683T>C	uc001ngs.1	+	1	28	c.28T>C	c.(28-30)TCT>CCT	p.S10P		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCTGGTACTTTCTCCCAACCA	0.423													21	221	---	---	---	---	capture	Missense_Mutation	SNP	48266683	48266683	OR4X2	11	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10989	50
LRRC55	219527	broad.mit.edu	37	11	56950158	56950158	+	Splice_Site	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56950158G>A	uc001njl.1	+	1	937	c.790_splice	c.e1+1	p.D264_splice		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55							integral to membrane					0						TGTACAGCAGGTAATAGAGGG	0.587													14	114	---	---	---	---	capture	Splice_Site	SNP	56950158	56950158	LRRC55	11	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	8926	50
APLNR	187	broad.mit.edu	37	11	57003536	57003536	+	Missense_Mutation	SNP	G	A	A	rs137997556		TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57003536G>A	uc001njo.2	-	1	1392	c.943C>T	c.(943-945)CGC>TGC	p.R315C	APLNR_uc001njn.3_RNA	NM_005161	NP_005152	P35414	APJ_HUMAN	apelin receptor	315	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			lung(5)|ovary(1)	6						TGGCGGAAGCGGGGGTCGAAA	0.587													27	32	---	---	---	---	capture	Missense_Mutation	SNP	57003536	57003536	APLNR	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	770	50
SMTNL1	219537	broad.mit.edu	37	11	57310651	57310651	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57310651C>T	uc009ymh.1	+	2	590	c.590C>T	c.(589-591)ACA>ATA	p.T197I		NM_001105565	NP_001099035	E9PPJ3	E9PPJ3_HUMAN	smoothelin-like 1	179										ovary(1)	1						CAGGAGGAGACAGGCCAGAGG	0.547													17	39	---	---	---	---	capture	Missense_Mutation	SNP	57310651	57310651	SMTNL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14707	50
CD248	57124	broad.mit.edu	37	11	66082764	66082764	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66082764C>T	uc001ohm.1	-	1	1752	c.1735G>A	c.(1735-1737)GCC>ACC	p.A579T		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	579	Pro-rich.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)	AGCTGGGTGGCCTGGGTTCTG	0.612													79	153	---	---	---	---	capture	Missense_Mutation	SNP	66082764	66082764	CD248	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2960	50
C12orf57	113246	broad.mit.edu	37	12	7054965	7054965	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7054965C>T	uc001qrz.2	+	3	343	c.261C>T	c.(259-261)TCC>TCT	p.S87S	PTPN6_uc001qsa.1_5'Flank|PTPN6_uc010sfr.1_5'Flank	NM_138425	NP_612434	Q99622	C10_HUMAN	C10 protein	87											0						TGGTCAAGTCCTACGAAGCCC	0.602													9	23	---	---	---	---	capture	Silent	SNP	7054965	7054965	C12orf57	12	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	1687	50
ACSM4	341392	broad.mit.edu	37	12	7469737	7469737	+	Missense_Mutation	SNP	G	A	A	rs139422294	by1000genomes	TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7469737G>A	uc001qsx.1	+	4	625	c.625G>A	c.(625-627)GCC>ACC	p.A209T		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	209					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						TTGCAGATTCGCCTCTGAAGA	0.483													13	38	---	---	---	---	capture	Missense_Mutation	SNP	7469737	7469737	ACSM4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	186	50
TM7SF3	51768	broad.mit.edu	37	12	27127064	27127064	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27127064G>A	uc010sjl.1	-	12	1785	c.1547C>T	c.(1546-1548)CCA>CTA	p.P516L		NM_016551	NP_057635	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3 precursor	516						integral to membrane|plasma membrane				upper_aerodigestive_tract(2)	2	Colorectal(261;0.0847)					TAACTTGTATGGGTGGGGAGG	0.493													15	166	---	---	---	---	capture	Missense_Mutation	SNP	27127064	27127064	TM7SF3	12	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	15860	50
DIP2B	57609	broad.mit.edu	37	12	51122397	51122397	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51122397C>T	uc001rwv.2	+	30	3733	c.3577C>T	c.(3577-3579)CGG>TGG	p.R1193W	DIP2B_uc009zlt.2_Missense_Mutation_p.R623W	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	1193						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						GTACTCTTCTCGGCAGATCGC	0.532													36	64	---	---	---	---	capture	Missense_Mutation	SNP	51122397	51122397	DIP2B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	4486	50
ACACB	32	broad.mit.edu	37	12	109680275	109680275	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109680275C>G	uc001tob.2	+	37	5175	c.5056C>G	c.(5056-5058)CCC>GCC	p.P1686A	ACACB_uc001toc.2_Missense_Mutation_p.P1686A|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Missense_Mutation_p.P352A	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	1686					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	CAAGCAAGGGCCCCAGCACGG	0.522													51	143	---	---	---	---	capture	Missense_Mutation	SNP	109680275	109680275	ACACB	12	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	107	50
KSR2	283455	broad.mit.edu	37	12	118298128	118298128	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118298128G>A	uc001two.2	-	2	257	c.202C>T	c.(202-204)CGA>TGA	p.R68*		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	97					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCGACGATTCGGAACCAGTGC	0.627													18	47	---	---	---	---	capture	Nonsense_Mutation	SNP	118298128	118298128	KSR2	12	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	8502	50
RBM25	58517	broad.mit.edu	37	14	73569957	73569957	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73569957C>T	uc001xno.2	+	10	1133	c.925C>T	c.(925-927)CGG>TGG	p.R309W	RBM25_uc010ttu.1_Missense_Mutation_p.R309W|RBM25_uc001xnp.2_Missense_Mutation_p.R104W	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	309	Necessary for nuclear speckle localization.|Glu-rich.|Arg-rich.				apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		tgagaaagaacggagagaaag	0.085													4	21	---	---	---	---	capture	Missense_Mutation	SNP	73569957	73569957	RBM25	14	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	13020	50
MKRN3	7681	broad.mit.edu	37	15	23811493	23811493	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23811493C>T	uc001ywh.3	+	1	1040	c.564C>T	c.(562-564)GAC>GAT	p.D188D	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.D188D	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	188						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		ACAATGCAGACCGTGGAGCTG	0.617													23	47	---	---	---	---	capture	Silent	SNP	23811493	23811493	MKRN3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	9520	50
GABRA5	2558	broad.mit.edu	37	15	27193227	27193227	+	Silent	SNP	T	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:27193227T>A	uc001zbd.1	+	12	1575	c.1236T>A	c.(1234-1236)ACT>ACA	p.T412T	GABRA5_uc001zbe.1_RNA	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	412	Cytoplasmic (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	AAGAGAAGACTTCTGAAAGCA	0.453													7	17	---	---	---	---	capture	Silent	SNP	27193227	27193227	GABRA5	15	T	A	A	A	1	0	0	0	0	0	0	0	1	717	56	4	4	6106	50
DNAJA4	55466	broad.mit.edu	37	15	78567950	78567950	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:78567950C>G	uc002bdj.1	+	5	874	c.757C>G	c.(757-759)CAG>GAG	p.Q253E	DNAJA4_uc002bdi.2_Missense_Mutation_p.Q282E|DNAJA4_uc002bdk.2_Missense_Mutation_p.Q226E|DNAJA4_uc002bdm.1_Missense_Mutation_p.Q37E	NM_001130182	NP_001123654	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	253					protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			skin(1)	1						TAGTGTCTTTCAGAGACGAGG	0.413													35	82	---	---	---	---	capture	Missense_Mutation	SNP	78567950	78567950	DNAJA4	15	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	4570	50
LRRC28	123355	broad.mit.edu	37	15	99901711	99901711	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99901711T>A	uc002bva.1	+	8	1021	c.866T>A	c.(865-867)CTG>CAG	p.L289Q	LRRC28_uc010urs.1_RNA|LRRC28_uc002bvb.1_Missense_Mutation_p.L135Q|LRRC28_uc010urt.1_Missense_Mutation_p.L103Q|LRRC28_uc002bvc.1_Missense_Mutation_p.L289Q|LRRC28_uc010uru.1_Missense_Mutation_p.L220Q|LRRC28_uc002bvd.1_Intron	NM_144598	NP_653199	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	289											0	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			CACAGCTTGCTGAAAGGTACG	0.458											OREG0023509	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	59	106	---	---	---	---	capture	Missense_Mutation	SNP	99901711	99901711	LRRC28	15	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	8898	50
RBBP6	5930	broad.mit.edu	37	16	24583037	24583037	+	Silent	SNP	T	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24583037T>C	uc002dmh.2	+	18	5690	c.4650T>C	c.(4648-4650)GAT>GAC	p.D1550D	RBBP6_uc002dmi.2_Silent_p.D1516D|RBBP6_uc010bxr.2_Silent_p.D710D|RBBP6_uc002dmk.2_Silent_p.D1383D	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	1550					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		CCACTTATGATACTAAACGGC	0.363													3	64	---	---	---	---	capture	Silent	SNP	24583037	24583037	RBBP6	16	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	12998	50
PITPNA	5306	broad.mit.edu	37	17	1456417	1456417	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1456417C>T	uc002fst.3	-	3	334	c.78G>A	c.(76-78)GTG>GTA	p.V26V	PITPNA_uc010cjt.2_5'UTR|PITPNA_uc010cju.2_5'UTR|PITPNA_uc010vqn.1_RNA	NM_006224	NP_006215	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha	26					axon guidance|lipid metabolic process|visual perception	cytoplasm	phosphatidylcholine transmembrane transporter activity|phosphatidylinositol transporter activity|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		TGGCCTCAGCCACAGAATACA	0.512													21	84	---	---	---	---	capture	Silent	SNP	1456417	1456417	PITPNA	17	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	11850	50
DVL2	1856	broad.mit.edu	37	17	7134114	7134114	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7134114A>C	uc002gez.1	-	2	479	c.197T>G	c.(196-198)GTG>GGG	p.V66G	DVL2_uc010vtr.1_Missense_Mutation_p.V66G|DVL2_uc010vts.1_5'Flank|DVL2_uc010clz.1_Missense_Mutation_p.V66G	NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	66	DIX.				canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity			lung(1)|kidney(1)	2						TTCCTTCACCACCCTGCCAAG	0.577													12	101	---	---	---	---	capture	Missense_Mutation	SNP	7134114	7134114	DVL2	17	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	4791	50
SLC47A1	55244	broad.mit.edu	37	17	19459334	19459334	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19459334G>A	uc002gvy.1	+	10	966	c.880G>A	c.(880-882)GCT>ACT	p.A294T	SLC47A1_uc010vyy.1_RNA|SLC47A1_uc002gvx.2_Missense_Mutation_p.A294T|SLC47A1_uc010vyz.1_Missense_Mutation_p.A271T|SLC47A1_uc010cqp.1_Intron|SLC47A1_uc010cqq.1_Missense_Mutation_p.A99T|SLC47A1_uc010vza.1_Missense_Mutation_p.A6T|SLC47A1_uc010vzb.1_Missense_Mutation_p.A28T|SLC47A1_uc010vzc.1_5'UTR|SNORA59B_uc002gvz.1_5'Flank	NM_018242	NP_060712	Q96FL8	S47A1_HUMAN	solute carrier family 47, member 1	294	Extracellular (Potential).					integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)					GGAGCTGGGCGCTCAGTCCAT	0.582													26	43	---	---	---	---	capture	Missense_Mutation	SNP	19459334	19459334	SLC47A1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14539	50
KSR1	8844	broad.mit.edu	37	17	25909866	25909866	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:25909866C>T	uc010crg.2	+	5	749	c.304C>T	c.(304-306)CCC>TCC	p.P102S	KSR1_uc002gzj.1_Intron	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras	237					Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CTCAGACTCCCCCACCCCCAG	0.706													12	17	---	---	---	---	capture	Missense_Mutation	SNP	25909866	25909866	KSR1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8501	50
NF1	4763	broad.mit.edu	37	17	29654793	29654793	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29654793G>A	uc002hgg.2	+	38	5878	c.5545G>A	c.(5545-5547)GAT>AAT	p.D1849N	NF1_uc002hgh.2_Missense_Mutation_p.D1828N|NF1_uc002hgi.1_Missense_Mutation_p.D861N|NF1_uc010cso.2_Missense_Mutation_p.D37N	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1849					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.D1849N(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCGGCCAAAAGATGTCCCTGG	0.468			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			37	93	---	---	---	---	capture	Missense_Mutation	SNP	29654793	29654793	NF1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	10263	50
CALCOCO2	10241	broad.mit.edu	37	17	46937756	46937756	+	Silent	SNP	A	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46937756A>G	uc002iof.2	+	11	1168	c.1089A>G	c.(1087-1089)TCA>TCG	p.S363S	CALCOCO2_uc010wlp.1_Silent_p.S384S|CALCOCO2_uc010wlq.1_Silent_p.S291S|CALCOCO2_uc010wlr.1_Silent_p.S387S|CALCOCO2_uc010wls.1_Silent_p.S321S	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	363					response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						TACCTACTTCAGATGAAGGAG	0.438													65	148	---	---	---	---	capture	Silent	SNP	46937756	46937756	CALCOCO2	17	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	2554	50
ACE	1636	broad.mit.edu	37	17	61560492	61560492	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61560492G>A	uc002jau.1	+	9	1467	c.1445G>A	c.(1444-1446)CGT>CAT	p.R482H	ACE_uc010wpi.1_Intron|ACE_uc010ddu.1_Missense_Mutation_p.R299H|ACE_uc002jav.1_5'Flank|ACE_uc010ddv.1_5'Flank|ACE_uc010wpj.1_5'Flank|ACE_uc002jaw.1_5'Flank|ACE_uc010wpk.1_5'Flank	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	482	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	TTTAGTGGGCGTACCCCCCCT	0.552													104	243	---	---	---	---	capture	Missense_Mutation	SNP	61560492	61560492	ACE	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	136	50
SLC38A10	124565	broad.mit.edu	37	17	79220094	79220094	+	Silent	SNP	G	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79220094G>C	uc002jzz.1	-	16	2997	c.2622C>G	c.(2620-2622)CTC>CTG	p.L874L	SLC38A10_uc002jzy.1_Silent_p.L792L	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	874					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			ATTCCTCTGCGAGGCGCTCCT	0.657													18	174	---	---	---	---	capture	Silent	SNP	79220094	79220094	SLC38A10	17	G	C	C	C	1	0	0	0	0	0	0	0	1	470	37	4	4	14494	50
NAPG	8774	broad.mit.edu	37	18	10548993	10548993	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:10548993G>A	uc002kon.2	+	11	922	c.695G>A	c.(694-696)TGT>TAT	p.C232Y	NAPG_uc010wzr.1_Missense_Mutation_p.C150Y|NAPG_uc002koo.2_Missense_Mutation_p.C145Y|NAPG_uc002kop.2_Missense_Mutation_p.C145Y	NM_003826	NP_003817	Q99747	SNAG_HUMAN	N-ethylmaleimide-sensitive factor attachment	232					cellular membrane fusion|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein complex assembly|protein stabilization	membrane|membrane fraction|mitochondrion	protein binding				0						AGTGAAGACTGTGCTGCCCTG	0.418													44	120	---	---	---	---	capture	Missense_Mutation	SNP	10548993	10548993	NAPG	18	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10072	50
MUC16	94025	broad.mit.edu	37	19	9048365	9048365	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9048365G>T	uc002mkp.2	-	5	33470	c.33266C>A	c.(33265-33267)ACT>AAT	p.T11089N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11091	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGGTGAAACAGTTGGAGTTGG	0.488													8	98	---	---	---	---	capture	Missense_Mutation	SNP	9048365	9048365	MUC16	19	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	9883	50
NFIX	4784	broad.mit.edu	37	19	13201118	13201118	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13201118G>A	uc010xmx.1	+	10	1485	c.1432G>A	c.(1432-1434)GCA>ACA	p.A478T	NFIX_uc002mwd.2_Silent_p.S420S|NFIX_uc002mwe.2_Silent_p.S412S|NFIX_uc002mwf.2_Silent_p.S382S|NFIX_uc002mwg.1_Silent_p.S419S			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;	470					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CACAGCATTCGCAACGACAGG	0.642													13	161	---	---	---	---	capture	Missense_Mutation	SNP	13201118	13201118	NFIX	19	G	A	A	A	1	0	0	0	0	1	0	0	0	483	38	1	1	10281	50
CCDC105	126402	broad.mit.edu	37	19	15132653	15132653	+	Silent	SNP	A	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15132653A>G	uc002nae.2	+	6	1272	c.1173A>G	c.(1171-1173)GAA>GAG	p.E391E		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	391					microtubule cytoskeleton organization	microtubule				ovary(1)	1						AGACCGCAGAAAAGCTGGACA	0.647													8	118	---	---	---	---	capture	Silent	SNP	15132653	15132653	CCDC105	19	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	2714	50
CLPTM1	1209	broad.mit.edu	37	19	45494188	45494188	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45494188C>T	uc002pai.2	+	11	1419	c.1404C>T	c.(1402-1404)ACC>ACT	p.T468T	CLPTM1_uc010xxf.1_Silent_p.T366T|CLPTM1_uc010xxg.1_Silent_p.T454T	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	468	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		AGTCCTCGACCAAAGTGTATG	0.607													16	36	---	---	---	---	capture	Silent	SNP	45494188	45494188	CLPTM1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3519	50
ERCC1	2067	broad.mit.edu	37	19	45923654	45923654	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45923654T>C	uc002pbs.1	-	4	499	c.353A>G	c.(352-354)AAT>AGT	p.N118S	ERCC1_uc002pbt.1_Missense_Mutation_p.N118S|ERCC1_uc002pbu.1_Missense_Mutation_p.N46S|ERCC1_uc002pbv.2_Missense_Mutation_p.N118S	NM_001983	NP_001974	P07992	ERCC1_HUMAN	excision repair cross-complementing 1 isofrom 2	118					mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding			ovary(2)	2		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		CCAGGGCACATTGCGCACGAA	0.562								NER					17	31	---	---	---	---	capture	Missense_Mutation	SNP	45923654	45923654	ERCC1	19	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	5167	50
PRR12	57479	broad.mit.edu	37	19	50099367	50099367	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50099367C>T	uc002poo.3	+	4	1775	c.1775C>T	c.(1774-1776)TCA>TTA	p.S592L		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		TACCTGAGCTCAGTCTTGGCC	0.657													40	73	---	---	---	---	capture	Missense_Mutation	SNP	50099367	50099367	PRR12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	12480	50
LENG8	114823	broad.mit.edu	37	19	54968952	54968952	+	Silent	SNP	C	A	A	rs142424676	by1000genomes	TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54968952C>A	uc002qfv.1	+	11	1791	c.1647C>A	c.(1645-1647)GTC>GTA	p.V549V	LENG8_uc002qfw.2_Silent_p.V586V			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	549							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		TGTGCATGGTCAAGTGCCACT	0.537													10	202	---	---	---	---	capture	Silent	SNP	54968952	54968952	LENG8	19	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	8644	50
ZNF552	79818	broad.mit.edu	37	19	58319417	58319417	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58319417C>T	uc002qqg.2	-	3	1385	c.1215G>A	c.(1213-1215)AAG>AAA	p.K405K	ZNF587_uc002qqb.2_Intron|ZNF552_uc010yhg.1_Silent_p.K401K	NM_024762	NP_079038	Q9H707	ZN552_HUMAN	zinc finger protein 552	405					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CTCATAAGCCCTTTCTTTTGT	0.398													54	131	---	---	---	---	capture	Silent	SNP	58319417	58319417	ZNF552	19	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	17863	50
APOB	338	broad.mit.edu	37	2	21249770	21249770	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21249770G>A	uc002red.2	-	15	2262	c.2134C>T	c.(2134-2136)CCA>TCA	p.P712S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	712					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ACACTGTCTGGGAAAAATCCT	0.413													53	99	---	---	---	---	capture	Missense_Mutation	SNP	21249770	21249770	APOB	2	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	778	50
MSH6	2956	broad.mit.edu	37	2	48026476	48026476	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48026476A>G	uc002rwd.3	+	4	1506	c.1354A>G	c.(1354-1356)ATG>GTG	p.M452V	MSH6_uc002rwc.2_Missense_Mutation_p.M452V|MSH6_uc010fbj.2_Missense_Mutation_p.M150V|MSH6_uc010yoi.1_Missense_Mutation_p.M322V|MSH6_uc010yoj.1_Missense_Mutation_p.M150V	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	452					determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCTGGTATTCATGAAAGGCAA	0.453			Mis|N|F|S		colorectal	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				8	93	---	---	---	---	capture	Missense_Mutation	SNP	48026476	48026476	MSH6	2	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	9784	50
SEMA4F	10505	broad.mit.edu	37	2	74900889	74900889	+	Silent	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74900889G>A	uc002sna.1	+	7	867	c.756G>A	c.(754-756)ACG>ACA	p.T252T	SEMA4F_uc010ysb.1_3'UTR|SEMA4F_uc010ffq.1_Silent_p.T219T|SEMA4F_uc010ffr.1_Intron|SEMA4F_uc002snb.1_5'UTR|SEMA4F_uc002snc.1_Intron	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	252	Sema.|Extracellular (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						TCTTCTTTACGGAGACTTCCC	0.567													67	163	---	---	---	---	capture	Silent	SNP	74900889	74900889	SEMA4F	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13928	50
SDPR	8436	broad.mit.edu	37	2	192711627	192711627	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192711627C>T	uc002utb.2	-	1	355	c.25G>A	c.(25-27)GAA>AAA	p.E9K		NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein	9						caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)	TGGAACTTTTCGGCCTGTGCA	0.612													9	121	---	---	---	---	capture	Missense_Mutation	SNP	192711627	192711627	SDPR	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13863	50
SIRPG	55423	broad.mit.edu	37	20	1615912	1615912	+	Splice_Site	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1615912C>T	uc002wfm.1	-	4	1146	c.1081_splice	c.e4+1	p.G361_splice	SIRPG_uc002wfn.1_Intron|SIRPG_uc002wfo.1_Intron|uc002wfp.1_Intron	NM_018556	NP_061026	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma isoform 1						blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding			ovary(1)	1						AGTAACCTCACCAGGGGTAGC	0.428													6	102	---	---	---	---	capture	Splice_Site	SNP	1615912	1615912	SIRPG	20	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	14229	50
TSHZ2	128553	broad.mit.edu	37	20	51872367	51872367	+	Silent	SNP	C	T	T	rs138612067		TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51872367C>T	uc002xwo.2	+	2	3326	c.2370C>T	c.(2368-2370)CAC>CAT	p.H790H		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	790					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CTCAGAAGCACGCTCTGTCTG	0.557													57	124	---	---	---	---	capture	Silent	SNP	51872367	51872367	TSHZ2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16507	50
ADRM1	11047	broad.mit.edu	37	20	60882680	60882680	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60882680C>T	uc002ycn.2	+	7	732	c.652C>T	c.(652-654)CCG>TCG	p.P218S	ADRM1_uc002yco.2_Missense_Mutation_p.P218S	NM_007002	NP_008933	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1 precursor	218	Ser-rich.				proteasome assembly|transcription elongation from RNA polymerase II promoter	cytoplasm|integral to plasma membrane|membrane fraction|nucleus|proteasome complex	endopeptidase activator activity|protease binding|proteasome binding				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			AGCGGTCACCCCGTCATCCAC	0.701													13	21	---	---	---	---	capture	Missense_Mutation	SNP	60882680	60882680	ADRM1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	345	50
OSBP2	23762	broad.mit.edu	37	22	31137177	31137177	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31137177G>A	uc003aiy.1	+	2	778	c.674G>A	c.(673-675)CGT>CAT	p.R225H	OSBP2_uc011ala.1_Missense_Mutation_p.R60H|OSBP2_uc010gwc.1_Missense_Mutation_p.R52H|OSBP2_uc003aix.1_Missense_Mutation_p.R225H|OSBP2_uc011alb.1_Missense_Mutation_p.R225H|OSBP2_uc003aiz.1_Missense_Mutation_p.R225H	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a	225	PH.				lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						CACACGTGCCGTGGAACCATC	0.542													13	84	---	---	---	---	capture	Missense_Mutation	SNP	31137177	31137177	OSBP2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11178	50
EP300	2033	broad.mit.edu	37	22	41564810	41564810	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41564810C>T	uc003azl.3	+	25	4506	c.4111C>T	c.(4111-4113)CTG>TTG	p.L1371L		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1371					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						TGGTGTTGACCTGTGCTTCTT	0.478			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				19	277	---	---	---	---	capture	Silent	SNP	41564810	41564810	EP300	22	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	5103	50
ACAA1	30	broad.mit.edu	37	3	38175476	38175476	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38175476C>T	uc003cht.2	-	3	497	c.290G>A	c.(289-291)GGG>GAG	p.G97E	ACAA1_uc003chu.2_Missense_Mutation_p.G97E|ACAA1_uc010hgy.2_Missense_Mutation_p.G97E|ACAA1_uc010hgz.2_Missense_Mutation_p.G97E|ACAA1_uc003chv.2_5'UTR	NM_001607	NP_001598	P09110	THIK_HUMAN	acetyl-Coenzyme A acyltransferase 1 isoform a	97					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy	peroxisomal matrix	acetyl-CoA C-acyltransferase activity|protein binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		CATGATTGCCCCGGCCCCAGG	0.522													5	88	---	---	---	---	capture	Missense_Mutation	SNP	38175476	38175476	ACAA1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	104	50
C3orf67	200844	broad.mit.edu	37	3	58870384	58870384	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58870384C>T	uc003dkt.1	-	7	636	c.227G>A	c.(226-228)CGA>CAA	p.R76Q	uc003dku.1_Intron|C3orf67_uc003dkv.1_5'UTR|C3orf67_uc003dkw.2_5'UTR	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	76											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		TTGACAGCTTCGTGGTATAAT	0.393													82	168	---	---	---	---	capture	Missense_Mutation	SNP	58870384	58870384	C3orf67	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2221	50
C3orf17	25871	broad.mit.edu	37	3	112738408	112738408	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:112738408C>T	uc003dzr.2	-	1	148	c.87G>A	c.(85-87)CAG>CAA	p.Q29Q	C3orf17_uc011bhz.1_5'UTR|C3orf17_uc010hqh.2_5'UTR|C3orf17_uc003dzt.2_5'UTR|C3orf17_uc003dzs.2_5'UTR|C3orf17_uc010hqg.2_5'UTR|C3orf17_uc011bia.1_5'UTR|C3orf17_uc003dzu.2_Silent_p.Q28Q|C3orf17_uc011bib.1_5'UTR|C3orf17_uc011bic.1_5'UTR|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	29						integral to membrane					0						CGCCGGGGTTCTGCACTGTCA	0.731													7	53	---	---	---	---	capture	Silent	SNP	112738408	112738408	C3orf17	3	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	2190	50
C3orf17	25871	broad.mit.edu	37	3	112738411	112738411	+	Silent	SNP	C	T	T	rs144842364	byFrequency	TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:112738411C>T	uc003dzr.2	-	1	145	c.84G>A	c.(82-84)GTG>GTA	p.V28V	C3orf17_uc011bhz.1_5'UTR|C3orf17_uc010hqh.2_5'UTR|C3orf17_uc003dzt.2_5'UTR|C3orf17_uc003dzs.2_5'UTR|C3orf17_uc010hqg.2_5'UTR|C3orf17_uc011bia.1_5'UTR|C3orf17_uc003dzu.2_Silent_p.V27V|C3orf17_uc011bib.1_5'UTR|C3orf17_uc011bic.1_5'UTR|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	28						integral to membrane					0						CGGGGTTCTGCACTGTCACTG	0.726													7	53	---	---	---	---	capture	Silent	SNP	112738411	112738411	C3orf17	3	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	2190	50
C3orf17	25871	broad.mit.edu	37	3	112738459	112738459	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:112738459C>T	uc003dzr.2	-	1	97	c.36G>A	c.(34-36)TGG>TGA	p.W12*	C3orf17_uc011bhz.1_5'UTR|C3orf17_uc010hqh.2_5'UTR|C3orf17_uc003dzt.2_5'UTR|C3orf17_uc003dzs.2_5'UTR|C3orf17_uc010hqg.2_5'UTR|C3orf17_uc011bia.1_5'UTR|C3orf17_uc003dzu.2_Nonsense_Mutation_p.W11*|C3orf17_uc011bib.1_5'UTR|C3orf17_uc011bic.1_5'UTR|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	12						integral to membrane					0						TCACACGGTTCCACGGCTCCA	0.701													10	46	---	---	---	---	capture	Nonsense_Mutation	SNP	112738459	112738459	C3orf17	3	C	T	T	T	1	0	0	0	0	0	1	0	0	390	30	5	2	2190	50
IFT80	57560	broad.mit.edu	37	3	160075296	160075296	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:160075296C>T	uc011boy.1	-	7	1053	c.620G>A	c.(619-621)GGT>GAT	p.G207D	IFT80_uc003fda.2_RNA|IFT80_uc003fdb.1_Missense_Mutation_p.G70D|IFT80_uc003fdd.1_Translation_Start_Site|IFT80_uc003fde.1_Missense_Mutation_p.G70D	NM_020800	NP_065851	Q9P2H3	IFT80_HUMAN	WD repeat domain 56	207	WD 4.					cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ACAGTCTTCACCAGCAGATAA	0.264													7	86	---	---	---	---	capture	Missense_Mutation	SNP	160075296	160075296	IFT80	3	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	7489	50
GPR125	166647	broad.mit.edu	37	4	22414939	22414939	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:22414939C>T	uc003gqm.1	-	14	2363	c.2098G>A	c.(2098-2100)GTT>ATT	p.V700I	GPR125_uc010ieo.1_Missense_Mutation_p.V556I	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	700	Extracellular (Potential).|GPS.				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				CGGGCTGCAACAGCATCTGCT	0.443													75	149	---	---	---	---	capture	Missense_Mutation	SNP	22414939	22414939	GPR125	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6573	50
PHOX2B	8929	broad.mit.edu	37	4	41748308	41748308	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:41748308C>T	uc003gwf.3	-	3	821	c.461G>A	c.(460-462)CGC>CAC	p.R154H		NM_003924	NP_003915	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	154	Homeobox.				positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			autonomic_ganglia(7)|lung(2)|ovary(2)|central_nervous_system(1)	12						CTCCTGCTTGCGAAACTTGGC	0.617			Mis|F		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				5	22	---	---	---	---	capture	Missense_Mutation	SNP	41748308	41748308	PHOX2B	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11762	50
PDGFRA	5156	broad.mit.edu	37	4	55131142	55131142	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55131142G>A	uc003han.3	+	5	1016	c.685G>A	c.(685-687)GAA>AAA	p.E229K	PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_3'UTR|PDGFRA_uc010igq.1_Missense_Mutation_p.E123K|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	229	Ig-like C2-type 3.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TAAGTCAGGGGAAACGATTGT	0.413			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			95	834	---	---	---	---	capture	Missense_Mutation	SNP	55131142	55131142	PDGFRA	4	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11564	50
SGMS2	166929	broad.mit.edu	37	4	108820833	108820833	+	Silent	SNP	C	T	T	rs150340532		TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:108820833C>T	uc003hyl.3	+	4	1113	c.558C>T	c.(556-558)TTC>TTT	p.F186F	uc003hym.1_Intron|SGMS2_uc003hyn.2_Silent_p.F186F|SGMS2_uc003hyo.2_Silent_p.F186F	NM_001136258	NP_001129730	Q8NHU3	SMS2_HUMAN	sphingomyelin synthase 2	186					sphingomyelin biosynthetic process	integral to Golgi membrane|integral to plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			lung(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)	Choline(DB00122)	GAATGCATTTCCAGTGTGCTC	0.398													33	190	---	---	---	---	capture	Silent	SNP	108820833	108820833	SGMS2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	14108	50
AP1AR	55435	broad.mit.edu	37	4	113189433	113189433	+	Silent	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113189433G>A	uc003iaj.3	+	10	1130	c.777G>A	c.(775-777)GAG>GAA	p.E259E	AP1AR_uc003iak.3_Silent_p.E226E	NM_018569	NP_061039	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated	259					protein transport	early endosome|Golgi apparatus|late endosome|transport vesicle					0						ATGGGCTGGAGTGGGAAAATG	0.403													12	129	---	---	---	---	capture	Silent	SNP	113189433	113189433	AP1AR	4	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	723	50
MAP3K1	4214	broad.mit.edu	37	5	56160697	56160697	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56160697C>T	uc003jqw.3	+	4	1472	c.971C>T	c.(970-972)CCT>CTT	p.P324L		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	324					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAGATAGGGCCTAACTCTTTC	0.468													5	112	---	---	---	---	capture	Missense_Mutation	SNP	56160697	56160697	MAP3K1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	9157	50
PAM	5066	broad.mit.edu	37	5	102284128	102284128	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:102284128G>C	uc003knw.2	+	8	995	c.622G>C	c.(622-624)GTT>CTT	p.V208L	PAM_uc003kns.2_Missense_Mutation_p.V208L|PAM_uc003knt.2_Missense_Mutation_p.V208L|PAM_uc003knu.2_Missense_Mutation_p.V208L|PAM_uc003knv.2_Missense_Mutation_p.V208L|PAM_uc011cuz.1_Missense_Mutation_p.V111L	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	208	Peptidylglycine alpha-hydroxylating monooxygenase (By similarity).|Intragranular (Potential).				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TGTTGACACTGTTATCCCAGC	0.303													84	169	---	---	---	---	capture	Missense_Mutation	SNP	102284128	102284128	PAM	5	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	11316	50
KIF4B	285643	broad.mit.edu	37	5	154396823	154396823	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154396823C>A	uc010jih.1	+	1	3564	c.3404C>A	c.(3403-3405)ACC>AAC	p.T1135N		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1135	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GTTGAACAGACCCAGGATTCC	0.537													34	70	---	---	---	---	capture	Missense_Mutation	SNP	154396823	154396823	KIF4B	5	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	8226	50
GRM6	2916	broad.mit.edu	37	5	178416095	178416095	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178416095C>T	uc003mjr.2	-	6	1374	c.1195G>A	c.(1195-1197)GGC>AGC	p.G399S	GRM6_uc010jla.1_Intron|GRM6_uc003mjs.1_Missense_Mutation_p.G19S	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	399	Extracellular (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TGCACCTTGCCCTCCTGCTCG	0.667													11	41	---	---	---	---	capture	Missense_Mutation	SNP	178416095	178416095	GRM6	5	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6734	50
DSP	1832	broad.mit.edu	37	6	7581804	7581804	+	Splice_Site	SNP	T	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7581804T>A	uc003mxp.1	+	23	5658	c.5379_splice	c.e23+2	p.E1793_splice	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCTTTAGAGGTATTCACAAAT	0.373													12	131	---	---	---	---	capture	Splice_Site	SNP	7581804	7581804	DSP	6	T	A	A	A	1	0	0	0	0	0	0	1	0	741	57	5	4	4736	50
BTBD9	114781	broad.mit.edu	37	6	38224188	38224188	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38224188C>A	uc003ooa.3	-	10	2135	c.1559G>T	c.(1558-1560)TGC>TTC	p.C520F	BTBD9_uc003ony.3_Missense_Mutation_p.C452F|BTBD9_uc010jwv.2_Missense_Mutation_p.C481F|BTBD9_uc010jww.2_RNA|BTBD9_uc010jwx.2_Missense_Mutation_p.C520F	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a	520					cell adhesion						0						AACTTACTTGCAGGAGACTTT	0.408													24	52	---	---	---	---	capture	Missense_Mutation	SNP	38224188	38224188	BTBD9	6	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	1536	50
ABCA13	154664	broad.mit.edu	37	7	48312026	48312026	+	Silent	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48312026C>T	uc003toq.2	+	17	2788	c.2763C>T	c.(2761-2763)TAC>TAT	p.Y921Y	ABCA13_uc010kyr.2_Silent_p.Y424Y	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	921					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ACACAGTCTACGCTATCAGGA	0.378													16	186	---	---	---	---	capture	Silent	SNP	48312026	48312026	ABCA13	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	31	50
WBSCR17	64409	broad.mit.edu	37	7	70880884	70880884	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:70880884A>G	uc003tvy.2	+	4	599	c.599A>G	c.(598-600)AAG>AGG	p.K200R	WBSCR17_uc003tvz.2_5'UTR	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	200	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GAGGAGCTGAAGGTCCCCCTA	0.498													6	110	---	---	---	---	capture	Missense_Mutation	SNP	70880884	70880884	WBSCR17	7	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	17145	50
PCLO	27445	broad.mit.edu	37	7	82581587	82581587	+	Silent	SNP	A	G	G			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82581587A>G	uc003uhx.2	-	5	8971	c.8682T>C	c.(8680-8682)GAT>GAC	p.D2894D	PCLO_uc003uhv.2_Silent_p.D2894D|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2825					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTACTTCCCCATCAGTGATTC	0.438													88	304	---	---	---	---	capture	Silent	SNP	82581587	82581587	PCLO	7	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	11486	50
ZCWPW1	55063	broad.mit.edu	37	7	100017491	100017491	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100017491G>C	uc003uut.2	-	4	292	c.44C>G	c.(43-45)CCA>CGA	p.P15R	ZCWPW1_uc011kjq.1_5'Flank|ZCWPW1_uc003uur.2_5'Flank|ZCWPW1_uc003uus.2_5'UTR|ZCWPW1_uc011kjr.1_Missense_Mutation_p.P14R|ZCWPW1_uc003uuu.1_Missense_Mutation_p.P14R|ZCWPW1_uc011kjs.1_5'Flank|ZCWPW1_uc011kjt.1_Missense_Mutation_p.P14R|ZCWPW1_uc011kju.1_Missense_Mutation_p.P14R	NM_017984	NP_060454	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	15							zinc ion binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GATTCTCTTTGGTCCCTTTCC	0.413													10	177	---	---	---	---	capture	Missense_Mutation	SNP	100017491	100017491	ZCWPW1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	17477	50
FOXP2	93986	broad.mit.edu	37	7	114304409	114304409	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:114304409G>A	uc003vhb.2	+	16	2295	c.1921G>A	c.(1921-1923)GTC>ATC	p.V641I	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.V666I|FOXP2_uc003vha.2_Missense_Mutation_p.V549I|FOXP2_uc011kmu.1_Missense_Mutation_p.V658I|FOXP2_uc011kmv.1_Missense_Mutation_p.V640I|FOXP2_uc010ljz.1_Missense_Mutation_p.V456I	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	641					camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						ACTGCAGGCCGTCCACGAAGA	0.483													24	107	---	---	---	---	capture	Missense_Mutation	SNP	114304409	114304409	FOXP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5971	50
TES	26136	broad.mit.edu	37	7	115889085	115889085	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:115889085G>A	uc003vho.2	+	3	306	c.125G>A	c.(124-126)CGT>CAT	p.R42H	TES_uc011kmx.1_Missense_Mutation_p.R42H|TES_uc011kmy.1_Intron|TES_uc010lka.1_Missense_Mutation_p.R33H|TES_uc003vhp.2_Missense_Mutation_p.R33H	NM_015641	NP_056456	Q9UGI8	TES_HUMAN	testin isoform 1	42	Cys-rich.				negative regulation of cell proliferation	cytoplasm|focal adhesion|nucleus|protein complex	zinc ion binding				0	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			AAAATATGTCGTAACTGCAAG	0.313													4	75	---	---	---	---	capture	Missense_Mutation	SNP	115889085	115889085	TES	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15650	50
WDR91	29062	broad.mit.edu	37	7	134878049	134878049	+	Silent	SNP	G	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134878049G>T	uc003vsp.2	-	11	1655	c.1593C>A	c.(1591-1593)GGC>GGA	p.G531G	WDR91_uc010lmq.2_Silent_p.G120G|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	531	WD 3.									breast(2)|ovary(1)|skin(1)	4						TGCCCTTGCTGCCGATGTCTG	0.622													23	98	---	---	---	---	capture	Silent	SNP	134878049	134878049	WDR91	7	G	T	T	T	1	0	0	0	0	0	0	0	1	587	46	4	4	17219	50
HTR5A	3361	broad.mit.edu	37	7	154863097	154863097	+	Missense_Mutation	SNP	C	T	T	rs150537072	byFrequency	TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:154863097C>T	uc003wlu.1	+	1	552	c.488C>T	c.(487-489)GCG>GTG	p.A163V	uc011kvt.1_5'UTR|uc003wlt.2_5'UTR	NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	163	Helical; Name=4; (By similarity).					integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		GTCATGATCGCGCTCACCTGG	0.627													17	72	---	---	---	---	capture	Missense_Mutation	SNP	154863097	154863097	HTR5A	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7375	50
PTK2B	2185	broad.mit.edu	37	8	27310672	27310672	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27310672G>A	uc003xfn.1	+	33	3398	c.2590G>A	c.(2590-2592)GCA>ACA	p.A864T	PTK2B_uc003xfo.1_Missense_Mutation_p.A864T|PTK2B_uc003xfp.1_Missense_Mutation_p.A864T|PTK2B_uc003xfq.1_Missense_Mutation_p.A822T	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a	864	Interaction with TGFB1I1 (By similarity).|Pro-rich.				apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)		GAGGCTGGGCGCACAGGTATG	0.498													10	98	---	---	---	---	capture	Missense_Mutation	SNP	27310672	27310672	PTK2B	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12658	50
TEX15	56154	broad.mit.edu	37	8	30705979	30705979	+	Silent	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30705979G>A	uc003xil.2	-	1	555	c.555C>T	c.(553-555)TCC>TCT	p.S185S		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	185										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AAGCATTACCGGACTCCTGTT	0.413													43	101	---	---	---	---	capture	Silent	SNP	30705979	30705979	TEX15	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15664	50
RRAGA	10670	broad.mit.edu	37	9	19050150	19050150	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19050150T>A	uc003znj.2	+	1	779	c.493T>A	c.(493-495)TGG>AGG	p.W165R		NM_006570	NP_006561	Q7L523	RRAGA_HUMAN	Ras-related GTP binding A	165					apoptosis|cellular protein localization|cellular response to amino acid stimulus|positive regulation of cytolysis|positive regulation of TOR signaling cascade|virus-host interaction	Golgi apparatus|lysosome|nucleus	GTP binding|phosphoprotein binding|protein heterodimerization activity|protein homodimerization activity				0						AACGTCCATCTGGGATGAGAC	0.522													4	28	---	---	---	---	capture	Missense_Mutation	SNP	19050150	19050150	RRAGA	9	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	13564	50
CCL19	6363	broad.mit.edu	37	9	34690006	34690006	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34690006C>T	uc003zvn.2	-	3	335	c.197G>A	c.(196-198)AGG>AAG	p.R66K	CCL19_uc010mkf.2_Intron	NM_006274	NP_006265	Q99731	CCL19_HUMAN	small inducible cytokine A19 precursor	66					activation of JUN kinase activity|cell communication|cell maturation|establishment of T cell polarity|immune response|immunological synapse formation|inflammatory response|interleukin-12 secretion|myeloid dendritic cell chemotaxis|negative regulation of leukocyte apoptosis|positive regulation of Cdc42 GTPase activity|positive regulation of dendritic cell antigen processing and presentation|positive regulation of ERK1 and ERK2 cascade|positive regulation of glycoprotein biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of neutrophil chemotaxis|positive regulation of NF-kappaB import into nucleus|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of protein kinase B signaling cascade|positive regulation of receptor-mediated endocytosis|positive regulation of T cell proliferation|positive regulation of T-helper 1 cell differentiation|positive regulation of tumor necrosis factor production|regulation of cell projection assembly|release of sequestered calcium ion into cytosol|response to nitric oxide|response to prostaglandin E stimulus|response to virus|T cell costimulation	extracellular space	CCR10 chemokine receptor binding|CCR7 chemokine receptor binding|chemokine activity				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		CTGGCGGCCCCTCAGTGTGGT	0.622													31	51	---	---	---	---	capture	Missense_Mutation	SNP	34690006	34690006	CCL19	9	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	2863	50
PAX5	5079	broad.mit.edu	37	9	36846902	36846902	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:36846902T>C	uc003zzo.1	-	9	1485	c.1037A>G	c.(1036-1038)TAC>TGC	p.Y346C	PAX5_uc011lpt.1_Missense_Mutation_p.Y142C|PAX5_uc011lpu.1_RNA|PAX5_uc011lpv.1_Intron|PAX5_uc011lpw.1_Intron|PAX5_uc011lpx.1_Missense_Mutation_p.Y246C|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Intron|PAX5_uc011lpz.1_Missense_Mutation_p.Y303C|PAX5_uc011lqa.1_Missense_Mutation_p.Y238C|PAX5_uc010mlq.1_RNA|PAX5_uc011lqb.1_RNA|PAX5_uc010mlo.1_Missense_Mutation_p.Y312C|PAX5_uc010mlp.1_Intron|PAX5_uc011lqc.1_Intron|PAX5_uc010mlr.1_Missense_Mutation_p.T269A	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5	346					cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(11)|p.Y346C(1)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		AGGGTGGCTGTAGGGACTCCC	0.597			T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								14	61	---	---	---	---	capture	Missense_Mutation	SNP	36846902	36846902	PAX5	9	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	11385	50
RAD23B	5887	broad.mit.edu	37	9	110084309	110084309	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:110084309C>T	uc004bde.2	+	7	1094	c.727C>T	c.(727-729)CAA>TAA	p.Q243*	RAD23B_uc011lwa.1_Nonsense_Mutation_p.Q243*|RAD23B_uc011lwb.1_Nonsense_Mutation_p.Q222*	NM_002874	NP_002865	P54727	RD23B_HUMAN	UV excision repair protein RAD23 homolog B	243					nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|regulation of proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleoplasm|proteasome complex|XPC complex	damaged DNA binding|polyubiquitin binding|single-stranded DNA binding			ovary(1)	1						TGACCCCCCTCAAGCAGCTAG	0.458								Direct_reversal_of_damage|NER					7	45	---	---	---	---	capture	Nonsense_Mutation	SNP	110084309	110084309	RAD23B	9	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	12878	50
C9orf91	203197	broad.mit.edu	37	9	117396107	117396107	+	Silent	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117396107G>A	uc004bjd.3	+	6	751	c.534G>A	c.(532-534)CGG>CGA	p.R178R	C9orf91_uc004bje.3_Silent_p.R157R|C9orf91_uc004bjf.3_Silent_p.R77R	NM_153045	NP_694590	Q5VZI3	CI091_HUMAN	hypothetical protein LOC203197	178						integral to membrane				pancreas(1)	1						TGAGACACCGGGTGCTGCTGG	0.567													29	65	---	---	---	---	capture	Silent	SNP	117396107	117396107	C9orf91	9	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	2481	50
SEC16A	9919	broad.mit.edu	37	9	139358176	139358176	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139358176G>A	uc004chx.2	-	10	4772	c.4463C>T	c.(4462-4464)ACG>ATG	p.T1488M	SEC16A_uc004chv.3_Missense_Mutation_p.T878M|SEC16A_uc004chw.2_Missense_Mutation_p.T1488M|SEC16A_uc010nbn.2_Missense_Mutation_p.T1488M	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	1310					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CTGCTCAGACGTGTGCTGCAG	0.647													42	81	---	---	---	---	capture	Missense_Mutation	SNP	139358176	139358176	SEC16A	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13879	50
RERE	473	broad.mit.edu	37	1	8716284	8716285	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8716284_8716285delTC	uc001ape.2	-	3	882_883	c.72_73delGA	c.(70-75)GAGAAAfs	p.E24fs	RERE_uc001apf.2_Frame_Shift_Del_p.E24fs|RERE_uc001aph.1_Frame_Shift_Del_p.E24fs	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	24_25					multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TTGTCTCTTTTCtctctctctc	0.342													7	533	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	8716284	8716285	RERE	1	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	13126	50
HERC2	8924	broad.mit.edu	37	15	28518115	28518115	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28518115delC	uc001zbj.2	-	8	942	c.836delG	c.(835-837)GGAfs	p.G279fs	HERC2_uc001zbl.1_5'UTR	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	279					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGGGATGCTTCCTGGCCCTTT	0.592													7	137	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	28518115	28518115	HERC2	15	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	6984	50
DLGAP1	9229	broad.mit.edu	37	18	3534543	3534543	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0214-01	TCGA-06-0214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:3534543delG	uc002kmf.2	-	7	2195	c.2128delC	c.(2128-2130)CTGfs	p.L710fs	DLGAP1_uc010wyz.1_Frame_Shift_Del_p.L710fs|DLGAP1_uc002kme.1_Frame_Shift_Del_p.L408fs|DLGAP1_uc010dkn.2_Frame_Shift_Del_p.L418fs|DLGAP1_uc010wyw.1_Frame_Shift_Del_p.L416fs|DLGAP1_uc010wyx.1_Frame_Shift_Del_p.L432fs|DLGAP1_uc010wyy.1_Frame_Shift_Del_p.L394fs|DLGAP1_uc002kmg.2_Frame_Shift_Del_p.L408fs	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	710					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				GAATTTTCCAGATTATCATGG	0.498													8	113	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	3534543	3534543	DLGAP1	18	G	-	-	-	1	0	1	0	1	0	0	0	0	425	33	5	5	4517	50
