Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AGRN	375790	broad.mit.edu	37	1	978952	978952	+	Silent	SNP	C	T	T	rs142440782		TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:978952C>T	uc001ack.1	+	9	1688	c.1638C>T	c.(1636-1638)TGC>TGT	p.C546C		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	546	Kazal-like 6.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GAGCCCTGTGCGAGGCCGAGA	0.692													64	87	---	---	---	---	capture	Silent	SNP	978952	978952	AGRN	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	397	54
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16918653C>T	uc009vos.1	-	6	853	c.-35_splice	c.e6+1		NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418													8	135	---	---	---	---	capture	Splice_Site	SNP	16918653	16918653	NBPF1	1	C	T	T	T	1	0	0	0	0	0	0	1	0	260	20	5	2	10099	54
GALE	2582	broad.mit.edu	37	1	24125491	24125491	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24125491C>G	uc009vqo.1	-	2	217	c.7G>C	c.(7-9)GAG>CAG	p.E3Q	GALE_uc001bhv.1_Missense_Mutation_p.E3Q|GALE_uc001bhw.1_Missense_Mutation_p.E3Q|GALE_uc001bhx.1_Missense_Mutation_p.E3Q|GALE_uc009vqp.1_Missense_Mutation_p.E3Q|GALE_uc001bhy.1_Missense_Mutation_p.E3Q|GALE_uc001bhz.1_Intron|GALE_uc001bia.2_5'Flank|GALE_uc009vqq.1_Missense_Mutation_p.E3Q	NM_001127621	NP_001121093	Q14376	GALE_HUMAN	UDP-galactose-4-epimerase	3					galactose catabolic process	cytosol	coenzyme binding|protein homodimerization activity|UDP-glucose 4-epimerase activity				0		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		AGCACCTTCTCTGCCATGGCA	0.592													7	96	---	---	---	---	capture	Missense_Mutation	SNP	24125491	24125491	GALE	1	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	6142	54
USH2A	7399	broad.mit.edu	37	1	215933077	215933077	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215933077C>T	uc001hku.1	-	57	11543	c.11156G>A	c.(11155-11157)CGT>CAT	p.R3719H		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3719	Fibronectin type-III 22.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTTCCATTACGACTCAATTG	0.408										HNSCC(13;0.011)			76	96	---	---	---	---	capture	Missense_Mutation	SNP	215933077	215933077	USH2A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16918	54
OBSCN	84033	broad.mit.edu	37	1	228494689	228494689	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228494689C>T	uc009xez.1	+	45	12058	c.12014C>T	c.(12013-12015)GCG>GTG	p.A4005V	OBSCN_uc001hsn.2_Missense_Mutation_p.A4005V	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	4005	Ig-like 41.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CTGAGCCGGGCGGGTGCGAGC	0.657													20	18	---	---	---	---	capture	Missense_Mutation	SNP	228494689	228494689	OBSCN	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10717	54
RYR2	6262	broad.mit.edu	37	1	237813234	237813234	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237813234G>A	uc001hyl.1	+	50	7690	c.7570G>A	c.(7570-7572)GTC>ATC	p.V2524I		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2524	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGCACAGCCGTCTTGCCATT	0.463													89	181	---	---	---	---	capture	Missense_Mutation	SNP	237813234	237813234	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13661	54
RAG1	5896	broad.mit.edu	37	11	36596275	36596275	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36596275G>A	uc001mwu.3	+	2	1545	c.1421G>A	c.(1420-1422)CGT>CAT	p.R474H	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	474			R -> H (in OS/T(-)B(-)NK(+) SCID; atypical).		histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				TTGGCCATCCGTGTCAACACC	0.557									Familial_Hemophagocytic_Lymphohistiocytosis				46	89	---	---	---	---	capture	Missense_Mutation	SNP	36596275	36596275	RAG1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12898	54
GAB2	9846	broad.mit.edu	37	11	77937662	77937662	+	Silent	SNP	T	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77937662T>G	uc001ozh.2	-	4	1056	c.1056A>C	c.(1054-1056)CCA>CCC	p.P352P	GAB2_uc001ozg.2_Silent_p.P314P	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a	352	SH3-binding.				osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GGGGGCGGGGTGGGGGAGCTA	0.582													9	88	---	---	---	---	capture	Silent	SNP	77937662	77937662	GAB2	11	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	6091	54
KCNJ5	3762	broad.mit.edu	37	11	128781583	128781583	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128781583G>A	uc001qet.2	+	2	729	c.415G>A	c.(415-417)GCT>ACT	p.A139T	KCNJ5_uc009zck.2_Missense_Mutation_p.A139T|KCNJ5_uc001qew.2_Missense_Mutation_p.A139T	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	139					synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)	CTTCGTGTCCGCTTTCCTGTT	0.507													101	82	---	---	---	---	capture	Missense_Mutation	SNP	128781583	128781583	KCNJ5	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7976	54
NBEA	26960	broad.mit.edu	37	13	36202290	36202290	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:36202290G>A	uc001uvb.2	+	49	7728	c.7522G>A	c.(7522-7524)GGA>AGA	p.G2508R	NBEA_uc010abi.2_Missense_Mutation_p.G1164R|NBEA_uc010tee.1_Missense_Mutation_p.G301R|NBEA_uc010tef.1_Missense_Mutation_p.G301R|NBEA_uc010teg.1_Missense_Mutation_p.G301R|NBEA_uc001uvd.2_Missense_Mutation_p.G65R	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2508	BEACH.					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TAAGCAGCGAGGACCAGAAGC	0.438													14	30	---	---	---	---	capture	Missense_Mutation	SNP	36202290	36202290	NBEA	13	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	10094	54
ZWILCH	55055	broad.mit.edu	37	15	66806421	66806421	+	Silent	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:66806421G>A	uc002aqb.2	+	3	447	c.201G>A	c.(199-201)GTG>GTA	p.V67V	RPL4_uc002apx.2_Intron|ZWILCH_uc010bhu.1_Intron|ZWILCH_uc002aqa.2_5'UTR|ZWILCH_uc010bhv.2_5'UTR	NM_017975	NP_060445	Q9H900	ZWILC_HUMAN	Zwilch	67					cell division|mitotic cell cycle checkpoint|mitotic prometaphase	condensed chromosome kinetochore|cytosol	protein binding			ovary(1)	1						TGGAAAAAGTGGTAAGTACTG	0.358													3	55	---	---	---	---	capture	Silent	SNP	66806421	66806421	ZWILCH	15	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	18124	54
YPEL3	83719	broad.mit.edu	37	16	30106203	30106203	+	Silent	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30106203G>A	uc002dwm.2	-	4	363	c.177C>T	c.(175-177)TGC>TGT	p.C59C	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TBX6_uc010veh.1_5'Flank|TBX6_uc002dwk.1_5'Flank|YPEL3_uc002dwl.2_Silent_p.C97C|YPEL3_uc002dwn.1_Silent_p.C97C|uc002dwo.1_5'Flank	NM_001145524	NP_001138996	P61236	YPEL3_HUMAN	yippee-like 3 isoform 2	59						nucleolus					0						CGGCTGGCCCGCAGCCCACGT	0.632													51	33	---	---	---	---	capture	Silent	SNP	30106203	30106203	YPEL3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	17372	54
GPR114	221188	broad.mit.edu	37	16	57597817	57597817	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57597817C>T	uc002elx.3	+	5	440	c.355C>T	c.(355-357)CGG>TGG	p.R119W	GPR114_uc010vhr.1_Missense_Mutation_p.R119W|GPR114_uc002ely.2_Missense_Mutation_p.R119W	NM_153837	NP_722579	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114 precursor	119	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)	1						CGAGCTGACCCGGGACGCCTG	0.632													12	188	---	---	---	---	capture	Missense_Mutation	SNP	57597817	57597817	GPR114	16	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	6565	54
TP53	7157	broad.mit.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578265A>G	uc002gim.2	-	6	778	c.584T>C	c.(583-585)ATC>ACC	p.I195T	TP53_uc002gig.1_Missense_Mutation_p.I195T|TP53_uc002gih.2_Missense_Mutation_p.I195T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I63T|TP53_uc010cng.1_Missense_Mutation_p.I63T|TP53_uc002gii.1_Missense_Mutation_p.I63T|TP53_uc010cnh.1_Missense_Mutation_p.I195T|TP53_uc010cni.1_Missense_Mutation_p.I195T|TP53_uc002gij.2_Missense_Mutation_p.I195T|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.I102T|TP53_uc002gio.2_Missense_Mutation_p.I63T|TP53_uc010vug.1_Missense_Mutation_p.I156T	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	195	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|I -> N (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.I195T(61)|p.I195F(16)|p.I195N(12)|p.0?(7)|p.I195S(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*14(3)|p.I195fs*52(3)|p.K164_P219del(1)|p.I195L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.I195fs*12(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCCACTCGGATAAGATGCTG	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			41	51	---	---	---	---	capture	Missense_Mutation	SNP	7578265	7578265	TP53	17	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	16264	54
LIG3	3980	broad.mit.edu	37	17	33323604	33323604	+	Silent	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33323604C>T	uc002hik.1	+	11	1863	c.1755C>T	c.(1753-1755)TTC>TTT	p.F585F	LIG3_uc002hij.2_Silent_p.F585F	NM_013975	NP_039269	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent isoform alpha	585					base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding			skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9		Ovarian(249;0.17)			Bleomycin(DB00290)	AAGCAGCCTTCCAGGATGCTA	0.428								Other_BER_factors					89	144	---	---	---	---	capture	Silent	SNP	33323604	33323604	LIG3	17	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	8702	54
XYLT2	64132	broad.mit.edu	37	17	48437602	48437602	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48437602G>A	uc002iqo.2	+	11	2657	c.2548G>A	c.(2548-2550)GAC>AAC	p.D850N	XYLT2_uc010dbo.2_RNA	NM_022167	NP_071450	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	850	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			pancreas(1)	1	Breast(11;7.18e-19)					TCTGTCCCCCGACCCCAAATC	0.647													25	32	---	---	---	---	capture	Missense_Mutation	SNP	48437602	48437602	XYLT2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17345	54
CTAGE1	64693	broad.mit.edu	37	18	19997860	19997860	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19997860G>A	uc002ktv.1	-	1	19	c.-85C>T	c.(-87--83)TACGG>TATGG			NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					AGGCTCCTCCGTAGCGCCAAG	0.587													11	2	---	---	---	---	capture	Translation_Start_Site	SNP	19997860	19997860	CTAGE1	18	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	3957	54
DCC	1630	broad.mit.edu	37	18	50734089	50734089	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:50734089T>C	uc002lfe.1	+	11	2350	c.1763T>C	c.(1762-1764)CTG>CCG	p.L588P	DCC_uc010xdr.1_Missense_Mutation_p.L436P|DCC_uc010dpf.1_Missense_Mutation_p.L243P	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	588	Extracellular (Potential).|Fibronectin type-III 2.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTGGAAGGCCTGAAAAAATTC	0.383													3	102	---	---	---	---	capture	Missense_Mutation	SNP	50734089	50734089	DCC	18	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4241	54
SALL3	27164	broad.mit.edu	37	18	76753975	76753975	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:76753975T>G	uc002lmt.2	+	2	1984	c.1984T>G	c.(1984-1986)TCG>GCG	p.S662A	SALL3_uc010dra.2_Missense_Mutation_p.S269A	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	662					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GTCGGAAACCTCGAAGCTGCA	0.637													17	5	---	---	---	---	capture	Missense_Mutation	SNP	76753975	76753975	SALL3	18	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	13704	54
CCDC94	55702	broad.mit.edu	37	19	4268683	4268683	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4268683G>A	uc002lzv.3	+	8	995	c.962G>A	c.(961-963)GGC>GAC	p.G321D		NM_018074	NP_060544	Q9BW85	CCD94_HUMAN	coiled-coil domain containing 94	321											0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0348)|STAD - Stomach adenocarcinoma(1328;0.183)		GACAGCAACGGCAGCAACTGA	0.642													3	38	---	---	---	---	capture	Missense_Mutation	SNP	4268683	4268683	CCDC94	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	2846	54
ZNF844	284391	broad.mit.edu	37	19	12187394	12187394	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12187394T>C	uc002mtb.2	+	4	1602	c.1459T>C	c.(1459-1461)TTT>CTT	p.F487L	ZNF844_uc010dym.1_Missense_Mutation_p.F330L	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	487					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCCTTCATTTTTTCCACTTCC	0.448													3	115	---	---	---	---	capture	Missense_Mutation	SNP	12187394	12187394	ZNF844	19	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	18066	54
CYP4F2	8529	broad.mit.edu	37	19	15989717	15989717	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15989717G>A	uc002nbs.1	-	13	1477	c.1427C>T	c.(1426-1428)GCG>GTG	p.A476V	CYP4F2_uc010xot.1_Missense_Mutation_p.A327V	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	476					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						CTTCATCTCCGCCATCGCGAA	0.672													36	57	---	---	---	---	capture	Missense_Mutation	SNP	15989717	15989717	CYP4F2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4148	54
FFAR3	2865	broad.mit.edu	37	19	35850542	35850542	+	Silent	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35850542C>T	uc002nzd.2	+	2	825	c.750C>T	c.(748-750)ATC>ATT	p.I250I	FFAR3_uc010xsu.1_Intron	NM_005304	NP_005295	O14843	FFAR3_HUMAN	free fatty acid receptor 3	250	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding				0	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TGGGCTATATCTGCGGTGAAA	0.612													107	431	---	---	---	---	capture	Silent	SNP	35850542	35850542	FFAR3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	408	32	2	2	5775	54
CYP2B6	1555	broad.mit.edu	37	19	41515926	41515926	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41515926A>T	uc002opr.1	+	6	857	c.850A>T	c.(850-852)AGC>TGC	p.S284C	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Intron	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	284					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	CAGTGAATTCAGCCACCAGAA	0.562													25	63	---	---	---	---	capture	Missense_Mutation	SNP	41515926	41515926	CYP2B6	19	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	4124	54
FOXD4L1	200350	broad.mit.edu	37	2	114257073	114257073	+	Silent	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:114257073C>T	uc002tjw.3	+	1	413	c.240C>T	c.(238-240)AGC>AGT	p.S80S		NM_012184	NP_036316	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	80					axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						GCGGCCCGAGCGACCCCTCAG	0.697													4	175	---	---	---	---	capture	Silent	SNP	114257073	114257073	FOXD4L1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	5944	54
SLC17A9	63910	broad.mit.edu	37	20	61596986	61596986	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61596986G>A	uc002yea.3	+	10	1154	c.970G>A	c.(970-972)GTC>ATC	p.V324I	SLC17A9_uc002ydz.3_Missense_Mutation_p.V318I|SLC17A9_uc011aap.1_Missense_Mutation_p.V344I	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	324	Helical; (Potential).				exocytosis|transmembrane transport	integral to membrane	transporter activity	p.V324I(1)		ovary(1)|skin(1)	2						CCTCTCCAGCGTCTTTGCTCT	0.652													226	346	---	---	---	---	capture	Missense_Mutation	SNP	61596986	61596986	SLC17A9	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14317	54
EEF1A2	1917	broad.mit.edu	37	20	62122078	62122078	+	Silent	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62122078C>T	uc002yfd.1	-	5	884	c.783G>A	c.(781-783)ACG>ACA	p.T261T	EEF1A2_uc002yfe.1_Silent_p.T261T|EEF1A2_uc010gkg.1_Silent_p.T261T	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	261						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			CCACGGGCACCGTGCCAATGC	0.647													38	49	---	---	---	---	capture	Silent	SNP	62122078	62122078	EEF1A2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4879	54
ADAMTS5	11096	broad.mit.edu	37	21	28338490	28338490	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:28338490A>C	uc002ymg.2	-	1	950	c.221T>G	c.(220-222)GTG>GGG	p.V74G		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	74					proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						GATGTTCTGCACCAGCCCCTT	0.726													14	119	---	---	---	---	capture	Missense_Mutation	SNP	28338490	28338490	ADAMTS5	21	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	269	54
DSCR6	53820	broad.mit.edu	37	21	38380466	38380466	+	Silent	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:38380466G>A	uc002yvv.2	+	2	324	c.114G>A	c.(112-114)CCG>CCA	p.P38P	DSCR6_uc011aec.1_Translation_Start_Site|DSCR6_uc010gnd.2_Translation_Start_Site	NM_018962	NP_061835	P57055	DSCR6_HUMAN	Down syndrome critical region protein 6	38						nucleus				breast(1)	1		Myeloproliferative disorder(46;0.0632)				GCCCCGCGCCGTGGCGACCTT	0.577													51	55	---	---	---	---	capture	Silent	SNP	38380466	38380466	DSCR6	21	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4728	54
SIK1	150094	broad.mit.edu	37	21	44841555	44841555	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:44841555G>T	uc002zdf.2	-	5	589	c.462C>A	c.(460-462)AAC>AAA	p.N154K		NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1	154	Protein kinase.				anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						CCAGCAGGAGGTTCTCGGTCT	0.617													32	34	---	---	---	---	capture	Missense_Mutation	SNP	44841555	44841555	SIK1	21	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	14210	54
FANCD2	2177	broad.mit.edu	37	3	10084272	10084272	+	Silent	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10084272G>A	uc003buw.2	+	11	891	c.813G>A	c.(811-813)TCG>TCA	p.S271S	FANCD2_uc003bux.1_Silent_p.S271S|FANCD2_uc003buy.1_Silent_p.S271S	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	271	Interaction with FANCE.|Interaction with BRCA2.				DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		ATAAGTTGTCGTCTATTAGAT	0.373			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				119	161	---	---	---	---	capture	Silent	SNP	10084272	10084272	FANCD2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5611	54
PLS1	5357	broad.mit.edu	37	3	142405148	142405148	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142405148T>G	uc010huv.2	+	9	1070	c.911T>G	c.(910-912)CTG>CGG	p.L304R	PLS1_uc003euz.2_Missense_Mutation_p.L304R|PLS1_uc003eva.2_Missense_Mutation_p.L304R	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1	304	Actin-binding 1.|CH 2.					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						TATTTTCATCTGCTTAATCAG	0.348													54	77	---	---	---	---	capture	Missense_Mutation	SNP	142405148	142405148	PLS1	3	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	12010	54
CRYGS	1427	broad.mit.edu	37	3	186256595	186256595	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186256595G>T	uc003fqe.2	-	3	479	c.427C>A	c.(427-429)CCC>ACC	p.P143T	CRYGS_uc003fqf.2_Missense_Mutation_p.P143T	NM_017541	NP_060011	P22914	CRBS_HUMAN	crystallin, gamma S	143	Beta/gamma crystallin 'Greek key' 4.						structural constituent of eye lens				0	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)		CGGTAGTTGGGTAGCTCATAG	0.547													72	107	---	---	---	---	capture	Missense_Mutation	SNP	186256595	186256595	CRYGS	3	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	3884	54
CCDC158	339965	broad.mit.edu	37	4	77252544	77252544	+	Silent	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77252544C>T	uc003hkb.3	-	20	3036	c.2883G>A	c.(2881-2883)TCG>TCA	p.S961S		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	961	Ser-rich.									skin(3)|ovary(2)|pancreas(1)	6						AGTCCCTCAACGAGTTGTTGC	0.363													95	139	---	---	---	---	capture	Silent	SNP	77252544	77252544	CCDC158	4	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2764	54
HPSE	10855	broad.mit.edu	37	4	84223361	84223361	+	Missense_Mutation	SNP	C	T	T	rs138550346		TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:84223361C>T	uc003hoj.3	-	10	1366	c.1267G>A	c.(1267-1269)GTG>ATG	p.V423M	HPSE_uc010ika.2_Missense_Mutation_p.V365M|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_RNA|HPSE_uc011ccs.1_Missense_Mutation_p.V166M|HPSE_uc011cct.1_Missense_Mutation_p.V349M|HPSE_uc003hok.3_Missense_Mutation_p.V423M	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	423					carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	GAACCTTGCACGCTTGCCATT	0.408													59	84	---	---	---	---	capture	Missense_Mutation	SNP	84223361	84223361	HPSE	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7269	54
ASB5	140458	broad.mit.edu	37	4	177136841	177136841	+	Silent	SNP	A	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:177136841A>G	uc003iuq.1	-	7	916	c.900T>C	c.(898-900)TGT>TGC	p.C300C	ASB5_uc003iup.1_Silent_p.C247C	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	300	SOCS box.				intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		AGCTTCGGATACAGAGTCGGC	0.363													31	48	---	---	---	---	capture	Silent	SNP	177136841	177136841	ASB5	4	A	G	G	G	1	0	0	0	0	0	0	0	1	180	14	3	3	1017	54
PLEKHG4B	153478	broad.mit.edu	37	5	182428	182428	+	Missense_Mutation	SNP	G	A	A	rs111247576	byFrequency	TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:182428G>A	uc003jak.2	+	18	3856	c.3806G>A	c.(3805-3807)CGC>CAC	p.R1269H		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	1269					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGCCGCACACGCCAGGCCTGA	0.632													9	23	---	---	---	---	capture	Missense_Mutation	SNP	182428	182428	PLEKHG4B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11975	54
IL31RA	133396	broad.mit.edu	37	5	55204208	55204208	+	Silent	SNP	C	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:55204208C>A	uc003jql.2	+	11	1535	c.1470C>A	c.(1468-1470)ATC>ATA	p.I490I	IL31RA_uc003jqk.2_Silent_p.I490I|IL31RA_uc011cqj.1_Silent_p.I348I|IL31RA_uc003jqm.2_Silent_p.I458I|IL31RA_uc003jqn.2_Silent_p.I490I|IL31RA_uc010iwa.1_Silent_p.I458I|IL31RA_uc003jqo.2_Silent_p.I348I	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	458	Extracellular (Potential).|Fibronectin type-III 5.				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				ACTACACCATCTTTTACCAAG	0.443													37	69	---	---	---	---	capture	Silent	SNP	55204208	55204208	IL31RA	5	C	A	A	A	1	0	0	0	0	0	0	0	1	408	32	4	4	7614	54
HSD17B4	3295	broad.mit.edu	37	5	118810095	118810095	+	Splice_Site	SNP	G	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:118810095G>C	uc003ksj.2	+	4	344	c.221_splice	c.e4-1	p.D74_splice	HSD17B4_uc011cwg.1_Splice_Site_p.D50_splice|HSD17B4_uc011cwh.1_Splice_Site_p.D56_splice|HSD17B4_uc011cwi.1_Splice_Site_p.D99_splice|HSD17B4_uc003ksk.3_Splice_Site|HSD17B4_uc011cwj.1_5'Flank|HSD17B4_uc010jcn.1_5'Flank	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	CTTTCCCTCAGATTCAGTGGA	0.428													63	64	---	---	---	---	capture	Splice_Site	SNP	118810095	118810095	HSD17B4	5	G	C	C	C	1	0	0	0	0	0	0	1	0	429	33	5	4	7311	54
ADAMTS19	171019	broad.mit.edu	37	5	128796140	128796140	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:128796140A>C	uc003kvb.1	+	1	38	c.38A>C	c.(37-39)TAC>TCC	p.Y13S	ADAMTS19_uc003kvc.1_5'Flank	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	13					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGCCTCCTTTACCAGCTGGGG	0.622													5	108	---	---	---	---	capture	Missense_Mutation	SNP	128796140	128796140	ADAMTS19	5	A	C	C	C	1	0	0	0	0	1	0	0	0	182	14	4	4	264	54
PCDHA10	56139	broad.mit.edu	37	5	140237348	140237348	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140237348C>T	uc003lhx.2	+	1	1715	c.1715C>T	c.(1714-1716)GCG>GTG	p.A572V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Missense_Mutation_p.A572V	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	572	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGCAGCGCGGGCGGTGCA	0.682													4	31	---	---	---	---	capture	Missense_Mutation	SNP	140237348	140237348	PCDHA10	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11423	54
PCDHAC1	56135	broad.mit.edu	37	5	140307832	140307832	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140307832T>C	uc003lih.2	+	1	1531	c.1355T>C	c.(1354-1356)CTT>CCT	p.L452P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.L452P	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	452	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCAGGAACTTTTCGTTGCT	0.527													93	94	---	---	---	---	capture	Missense_Mutation	SNP	140307832	140307832	PCDHAC1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11435	54
KIF4B	285643	broad.mit.edu	37	5	154395374	154395374	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154395374G>A	uc010jih.1	+	1	2115	c.1955G>A	c.(1954-1956)CGT>CAT	p.R652H		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	652	Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGTTAATGCGTCAAATGAAA	0.408													72	90	---	---	---	---	capture	Missense_Mutation	SNP	154395374	154395374	KIF4B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8226	54
TRIM52	84851	broad.mit.edu	37	5	180687305	180687305	+	Silent	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180687305G>A	uc003mnp.2	-	1	815	c.510C>T	c.(508-510)CAC>CAT	p.H170H	uc003mnq.2_5'Flank	NM_032765	NP_116154	Q96A61	TRI52_HUMAN	tripartite motif-containing 52	170						intracellular	zinc ion binding				0	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		AAGGAGGCGGGTGGATGTCAG	0.537													9	254	---	---	---	---	capture	Silent	SNP	180687305	180687305	TRIM52	5	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	16410	54
DNAH8	1769	broad.mit.edu	37	6	38885721	38885721	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38885721C>A	uc003ooe.1	+	68	10278	c.9678C>A	c.(9676-9678)TTC>TTA	p.F3226L	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CAACAGGATTCCTGTGGAGCC	0.333													48	44	---	---	---	---	capture	Missense_Mutation	SNP	38885721	38885721	DNAH8	6	C	A	A	A	1	0	0	0	0	1	0	0	0	389	30	4	4	4563	54
RSPO3	84870	broad.mit.edu	37	6	127469869	127469869	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:127469869G>C	uc003qar.2	+	2	464	c.174G>C	c.(172-174)AAG>AAC	p.K58N	RSPO3_uc003qas.1_Missense_Mutation_p.K58N	NM_032784	NP_116173	Q9BXY4	RSPO3_HUMAN	R-spondin 3 precursor	58	FU 1.					extracellular region	heparin binding				0				GBM - Glioblastoma multiforme(226;0.0555)		TGTCATGTAAGCCCAGACTAT	0.423													5	184	---	---	---	---	capture	Missense_Mutation	SNP	127469869	127469869	RSPO3	6	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	13603	54
DNAH11	8701	broad.mit.edu	37	7	21639469	21639469	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21639469T>C	uc003svc.2	+	15	2763	c.2732T>C	c.(2731-2733)ATT>ACT	p.I911T		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	911	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GTAGAATTCATTGACGACATT	0.373									Kartagener_syndrome				20	44	---	---	---	---	capture	Missense_Mutation	SNP	21639469	21639469	DNAH11	7	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	4557	54
EGFR	1956	broad.mit.edu	37	7	55210075	55210075	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55210075T>G	uc003tqk.2	+	2	431	c.185T>G	c.(184-186)CTT>CGT	p.L62R	EGFR_uc003tqh.2_Missense_Mutation_p.L62R|EGFR_uc003tqi.2_Missense_Mutation_p.L62R|EGFR_uc003tqj.2_Missense_Mutation_p.L62R|EGFR_uc010kzg.1_Missense_Mutation_p.L62R|EGFR_uc011kco.1_Missense_Mutation_p.L9R	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	62	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.L62R(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GAGGTGGTCCTTGGGAATTTG	0.408		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			783	141	---	---	---	---	capture	Missense_Mutation	SNP	55210075	55210075	EGFR	7	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	4922	54
JHDM1D	80853	broad.mit.edu	37	7	139790907	139790907	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139790907C>T	uc003vvm.2	-	20	2817	c.2813G>A	c.(2812-2814)CGT>CAT	p.R938H	JHDM1D_uc010lng.2_RNA	NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	938					midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					CACAAAGAAACGTGCATGGCC	0.502													29	104	---	---	---	---	capture	Missense_Mutation	SNP	139790907	139790907	JHDM1D	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7871	54
MLL3	58508	broad.mit.edu	37	7	151849845	151849845	+	Silent	SNP	T	C	C			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151849845T>C	uc003wla.2	-	49	12690	c.12471A>G	c.(12469-12471)TTA>TTG	p.L4157L	MLL3_uc003wkz.2_Silent_p.L3275L|MLL3_uc003wkx.2_Silent_p.L315L|MLL3_uc003wky.2_Silent_p.L1721L	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	4157					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AAGAGCTCACTAATCTGGGAG	0.498			N		medulloblastoma								13	336	---	---	---	---	capture	Silent	SNP	151849845	151849845	MLL3	7	T	C	C	C	1	0	0	0	0	0	0	0	1	686	53	3	3	9534	54
RP1L1	94137	broad.mit.edu	37	8	10469370	10469370	+	Silent	SNP	C	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10469370C>T	uc003wtc.2	-	4	2467	c.2238G>A	c.(2236-2238)TCG>TCA	p.S746S		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	746					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		AAACAAAATCCGAGTGGACTG	0.652													42	73	---	---	---	---	capture	Silent	SNP	10469370	10469370	RP1L1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13425	54
NOV	4856	broad.mit.edu	37	8	120435276	120435276	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120435276G>T	uc003yoq.2	+	5	1199	c.978G>T	c.(976-978)ATG>ATT	p.M326I		NM_002514	NP_002505	P48745	NOV_HUMAN	nephroblastoma overexpressed precursor	326	CTCK.				regulation of cell growth		growth factor activity|insulin-like growth factor binding			ovary(2)|skin(2)|kidney(1)	5	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGCCAGTGATGGTCATTGGGA	0.537													9	291	---	---	---	---	capture	Missense_Mutation	SNP	120435276	120435276	NOV	8	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	10460	54
DCAF8L2	347442	broad.mit.edu	37	X	27766165	27766165	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27766165G>T	uc011mjy.1	+	1	1240	c.1153G>T	c.(1153-1155)GGT>TGT	p.G385C		NM_001136533	NP_001130005			DDB1 and CUL4 associated factor 8-like 2											central_nervous_system(1)|pancreas(1)	2						ATTTGCAGTGGGTGGACAAGA	0.398													8	73	---	---	---	---	capture	Missense_Mutation	SNP	27766165	27766165	DCAF8L2	23	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	4237	54
SYTL5	94122	broad.mit.edu	37	X	37931389	37931389	+	Missense_Mutation	SNP	G	A	A	rs151098113	byFrequency	TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37931389G>A	uc004ddu.2	+	5	953	c.419G>A	c.(418-420)CGA>CAA	p.R140Q	SYTL5_uc004ddv.2_Missense_Mutation_p.R140Q|SYTL5_uc004ddx.2_Missense_Mutation_p.R140Q	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	140					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						GATGTTGTCCGACAGTCCATT	0.378													73	60	---	---	---	---	capture	Missense_Mutation	SNP	37931389	37931389	SYTL5	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15374	54
MAOA	4128	broad.mit.edu	37	X	43571152	43571152	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:43571152C>A	uc004dfy.2	+	4	521	c.340C>A	c.(340-342)CCA>ACA	p.P114T	MAOA_uc011mkw.1_5'UTR	NM_000240	NP_000231	P21397	AOFA_HUMAN	monoamine oxidase A	114	Cytoplasmic.				behavior|neurotransmitter biosynthetic process|neurotransmitter catabolic process|neurotransmitter secretion|xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	primary amine oxidase activity|protein binding			breast(2)|ovary(1)	3					Almotriptan(DB00918)|Carbidopa(DB00190)|Clonazepam(DB01068)|Dopamine(DB00988)|Fluvoxamine(DB00176)|Ginkgo biloba(DB01381)|Imipramine(DB00458)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Linezolid(DB00601)|Lorazepam(DB00186)|Moclobemide(DB01171)|Nicotine(DB00184)|Norepinephrine(DB00368)|Phenelzine(DB00780)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Rasagiline(DB01367)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)	CGCCTTTCCACCAGTATGGAA	0.368													4	188	---	---	---	---	capture	Missense_Mutation	SNP	43571152	43571152	MAOA	23	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	9139	54
SLC38A5	92745	broad.mit.edu	37	X	48317931	48317931	+	Silent	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48317931G>A	uc010nid.2	-	16	1486	c.1308C>T	c.(1306-1308)CCC>CCT	p.P436P	SLC38A5_uc004djk.3_Silent_p.P385P	NM_033518	NP_277053	Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	436	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to membrane|plasma membrane				ovary(3)	3						CCTGGATCTTGGGCCAGGATA	0.582													9	11	---	---	---	---	capture	Silent	SNP	48317931	48317931	SLC38A5	23	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14499	54
TGIF2LX	90316	broad.mit.edu	37	X	89177186	89177186	+	Silent	SNP	G	A	A			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:89177186G>A	uc004efe.2	+	2	151	c.102G>A	c.(100-102)TCG>TCA	p.S34S		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	34						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						CAATCATGTCGAGAAATAACG	0.577													52	69	---	---	---	---	capture	Silent	SNP	89177186	89177186	TGIF2LX	23	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	15712	54
INF2	64423	broad.mit.edu	37	14	105174270	105174271	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105174270_105174271insG	uc001ypb.2	+	8	1809_1810	c.1666_1667insG	c.(1666-1668)CGGfs	p.R556fs	INF2_uc010tyi.1_Frame_Shift_Ins_p.R556fs|INF2_uc001ypc.2_Frame_Shift_Ins_p.R556fs|INF2_uc010awz.1_RNA	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1	556	FH2.				actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CAGCCATCGGCGGGTGAACCCA	0.663													7	168	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	105174270	105174271	INF2	14	-	G	G	G	1	0	1	1	0	0	0	0	0	347	27	5	5	7657	54
NOL11	25926	broad.mit.edu	37	17	65733682	65733682	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65733682delC	uc002jgd.1	+	12	1280	c.1277delC	c.(1276-1278)ACAfs	p.T426fs	NOL11_uc010wql.1_Frame_Shift_Del_p.T244fs|NOL11_uc010deu.1_Frame_Shift_Del_p.T21fs	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	426						nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTGAAGCAGACACCTGACTTT	0.408													113	146	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	65733682	65733682	NOL11	17	C	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	10428	54
QKI	9444	broad.mit.edu	37	6	163984752	163984755	+	Splice_Site	DEL	GTAA	-	-			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163984752_163984755delGTAA	uc003qui.2	+	6	1485	c.934_splice	c.e6+1	p.G312_splice	QKI_uc003que.2_Frame_Shift_Del_p.G312fs|QKI_uc003quf.2_Splice_Site_p.E312_splice|QKI_uc003qug.2_Splice_Site_p.G312_splice|QKI_uc003quh.2_Splice_Site_p.E304_splice|QKI_uc003quj.2_Splice_Site_p.G304_splice	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		GGTGTATTAGGTAAGTTCTTCTCC	0.387													79	121	---	---	---	---	capture_indel	Splice_Site	DEL	163984752	163984755	QKI	6	GTAA	-	-	-	1	0	1	0	1	0	0	1	0	572	44	5	5	12768	54
MAMLD1	10046	broad.mit.edu	37	X	149639325	149639327	+	In_Frame_Del	DEL	CAG	-	-			TCGA-06-0237-01	TCGA-06-0237-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149639325_149639327delCAG	uc004fee.1	+	3	1556_1558	c.1480_1482delCAG	c.(1480-1482)CAGdel	p.Q502del	MAMLD1_uc011mxt.1_In_Frame_Del_p.Q464del|MAMLD1_uc011mxu.1_In_Frame_Del_p.Q477del|MAMLD1_uc011mxv.1_In_Frame_Del_p.Q477del|MAMLD1_uc011mxw.1_In_Frame_Del_p.Q429del	NM_005491	NP_005482	Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	502	Poly-Gln.				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCcagcaacagcagcagcagc	0.433													8	159	---	---	---	---	capture_indel	In_Frame_Del	DEL	149639325	149639327	MAMLD1	23	CAG	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	9122	54
