Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KPRP	448834	broad.mit.edu	37	1	152732806	152732806	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152732806C>T	uc001fal.1	+	2	800	c.742C>T	c.(742-744)CGC>TGC	p.R248C		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	248						cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAACAGCACCGCTCTCGGAG	0.612													35	93	---	---	---	---	capture	Missense_Mutation	SNP	152732806	152732806	KPRP	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8356	55
OR10Z1	128368	broad.mit.edu	37	1	158577000	158577000	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158577000G>A	uc010pio.1	+	1	772	c.772G>A	c.(772-774)GTG>ATG	p.V258M		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)					TGCTTCCTTCGTGTACCTGAG	0.493													123	228	---	---	---	---	capture	Missense_Mutation	SNP	158577000	158577000	OR10Z1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10827	55
SPTA1	6708	broad.mit.edu	37	1	158650498	158650498	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158650498C>G	uc001fst.1	-	5	752	c.553G>C	c.(553-555)GAG>CAG	p.E185Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	185	Spectrin 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCACCTAGCTCCACTGATGTC	0.448													62	108	---	---	---	---	capture	Missense_Mutation	SNP	158650498	158650498	SPTA1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	15008	55
ZNF496	84838	broad.mit.edu	37	1	247464286	247464286	+	Silent	SNP	C	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247464286C>T	uc001ico.2	-	9	1764	c.1299G>A	c.(1297-1299)AAG>AAA	p.K433K	ZNF496_uc009xgv.2_Silent_p.K469K|ZNF496_uc001icp.2_Silent_p.K433K	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	433					positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			ACTCGTGCGGCTTCTCCTGCT	0.617													42	53	---	---	---	---	capture	Silent	SNP	247464286	247464286	ZNF496	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	17824	55
OR2T34	127068	broad.mit.edu	37	1	248737752	248737752	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248737752C>A	uc001iep.1	-	1	307	c.307G>T	c.(307-309)GGG>TGG	p.G103W		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	103	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCTGGATCCCACAGCCTGAC	0.562													48	61	---	---	---	---	capture	Missense_Mutation	SNP	248737752	248737752	OR2T34	1	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	10929	55
OR5P2	120065	broad.mit.edu	37	11	7818165	7818165	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7818165C>T	uc001mfp.1	-	1	325	c.325G>A	c.(325-327)GTC>ATC	p.V109I		NM_153444	NP_703145	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.V109I(1)		ovary(2)|skin(2)|central_nervous_system(1)	5				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCCAGAAGGACGCATTCGACT	0.483													76	103	---	---	---	---	capture	Missense_Mutation	SNP	7818165	7818165	OR5P2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11082	55
TMEM41B	440026	broad.mit.edu	37	11	9305021	9305021	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:9305021A>G	uc001mhm.2	-	7	1134	c.826T>C	c.(826-828)TCT>CCT	p.S276P	TMEM41B_uc001mhn.1_Missense_Mutation_p.S276P	NM_015012	NP_055827	Q5BJD5	TM41B_HUMAN	transmembrane protein 41B isoform 1	276	Helical; (Potential).					integral to membrane					0				all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)		GGCAGAATAGAAAGAACAGCC	0.358													6	55	---	---	---	---	capture	Missense_Mutation	SNP	9305021	9305021	TMEM41B	11	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	16048	55
CASP1	834	broad.mit.edu	37	11	104900443	104900443	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:104900443G>A	uc010rve.1	-	6	828	c.811C>T	c.(811-813)CCA>TCA	p.P271S	CASP1_uc001pig.2_Missense_Mutation_p.P178S|CASP1_uc001pik.2_Missense_Mutation_p.P234S|CASP1_uc010rvf.1_Missense_Mutation_p.P178S|CASP1_uc010rvg.1_Missense_Mutation_p.P250S|CASP1_uc010rvh.1_Missense_Mutation_p.P178S|CASP1_uc010rvi.1_Intron|CASP1_uc001pim.3_Missense_Mutation_p.P271S|CASP1_uc009yxi.2_Missense_Mutation_p.P250S|CASP1_uc010rvj.1_Missense_Mutation_p.P271S|CASP1_uc009yxj.2_Missense_Mutation_p.P116S|CASP1_uc010rvk.1_Missense_Mutation_p.P232S	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor	271					cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	TTCAAACTTGGGCAGTTCTTG	0.448													20	76	---	---	---	---	capture	Missense_Mutation	SNP	104900443	104900443	CASP1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	2644	55
MARS	4141	broad.mit.edu	37	12	57910320	57910320	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57910320G>A	uc001sog.2	+	21	2682	c.2659G>A	c.(2659-2661)GAG>AAG	p.E887K	MARS_uc001sof.1_RNA|MARS_uc001soh.1_3'UTR	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	887	WHEP-TRS.				methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GGCTGTAGCTGAGGGGAAACC	0.433													51	562	---	---	---	---	capture	Missense_Mutation	SNP	57910320	57910320	MARS	12	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	9229	55
DDIT3	1649	broad.mit.edu	37	12	57911096	57911096	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57911096C>A	uc001soi.2	-	3	274	c.94G>T	c.(94-96)GAT>TAT	p.D32Y	MARS_uc001sof.1_RNA|DDIT3_uc009zps.2_Missense_Mutation_p.D55Y|DDIT3_uc009zpt.2_Missense_Mutation_p.D55Y	NM_004083	NP_004074	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	32					cell cycle arrest|cell redox homeostasis|mRNA transcription from RNA polymerase II promoter|negative regulation of determination of dorsal identity|regulation of DNA-dependent transcription in response to stress|response to DNA damage stimulus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription factor binding	p.D32Y(1)	FUS/DDIT3(623)|EWSR1/DDIT3(43)	soft_tissue(666)|large_intestine(1)|central_nervous_system(1)|lung(1)|skin(1)|ovary(1)	671						CCATTTTCATCTGAAGACAGG	0.493			T	FUS	liposarcoma								227	489	---	---	---	---	capture	Missense_Mutation	SNP	57911096	57911096	DDIT3	12	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	4289	55
PIP4K2C	79837	broad.mit.edu	37	12	57994645	57994645	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57994645G>T	uc001sou.2	+	8	996	c.865G>T	c.(865-867)GAC>TAC	p.D289Y	PIP4K2C_uc001sot.2_Missense_Mutation_p.D289Y|PIP4K2C_uc010srs.1_Missense_Mutation_p.D271Y|PIP4K2C_uc010srt.1_Missense_Mutation_p.D241Y	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	289	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					AGGCATCCACGACATCATTCG	0.552													72	857	---	---	---	---	capture	Missense_Mutation	SNP	57994645	57994645	PIP4K2C	12	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	11841	55
PIP4K2C	79837	broad.mit.edu	37	12	57994848	57994848	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57994848C>G	uc001sou.2	+	8	1199	c.1068C>G	c.(1066-1068)ATC>ATG	p.I356M	PIP4K2C_uc001sot.2_Missense_Mutation_p.I356M|PIP4K2C_uc010srs.1_Missense_Mutation_p.I338M|PIP4K2C_uc010srt.1_Missense_Mutation_p.I308M	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	356	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					TCTATGCCATCCGGAGTGCTG	0.562													59	841	---	---	---	---	capture	Missense_Mutation	SNP	57994848	57994848	PIP4K2C	12	C	G	G	G	1	0	0	0	0	1	0	0	0	382	30	4	4	11841	55
TSPAN31	6302	broad.mit.edu	37	12	58140433	58140433	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58140433G>A	uc001spt.2	+	4	528	c.374G>A	c.(373-375)AGA>AAA	p.R125K	TSPAN31_uc009zqb.2_Intron|TSPAN31_uc010ssa.1_Missense_Mutation_p.R47K	NM_005981	NP_005972	Q12999	TSN31_HUMAN	sarcoma amplified sequence	125	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction					0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			GAACTGGAAAGAAGTTTTGAT	0.448													27	869	---	---	---	---	capture	Missense_Mutation	SNP	58140433	58140433	TSPAN31	12	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	16529	55
TPTE2	93492	broad.mit.edu	37	13	20066995	20066995	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20066995A>T	uc001umd.2	-	4	325	c.114T>A	c.(112-114)AGT>AGA	p.S38R	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.S38R|TPTE2_uc001ume.2_Missense_Mutation_p.S38R|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	38						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CTCACCTTTTACTGATAGGTG	0.388													45	93	---	---	---	---	capture	Missense_Mutation	SNP	20066995	20066995	TPTE2	13	A	T	T	T	1	0	0	0	0	1	0	0	0	180	14	4	4	16314	55
PCNX	22990	broad.mit.edu	37	14	71495452	71495452	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:71495452A>C	uc001xmo.2	+	16	3948	c.3502A>C	c.(3502-3504)ATC>CTC	p.I1168L	PCNX_uc010are.1_Missense_Mutation_p.I1057L|PCNX_uc010arf.1_Missense_Mutation_p.I28L	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1168	Helical; (Potential).					integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TTACAGTTTTATCTGTAGCAT	0.308													46	75	---	---	---	---	capture	Missense_Mutation	SNP	71495452	71495452	PCNX	14	A	C	C	C	1	0	0	0	0	1	0	0	0	208	16	4	4	11494	55
TJP1	7082	broad.mit.edu	37	15	30003151	30003151	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:30003151T>C	uc001zcr.2	-	24	4731	c.4256A>G	c.(4255-4257)TAT>TGT	p.Y1419C	TJP1_uc010azl.2_Missense_Mutation_p.Y1407C|TJP1_uc001zcq.2_Missense_Mutation_p.Y1343C|TJP1_uc001zcs.2_Missense_Mutation_p.Y1339C	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	1419					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GATGGGTTCATAGCGTTTCTC	0.512													18	132	---	---	---	---	capture	Missense_Mutation	SNP	30003151	30003151	TJP1	15	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	15814	55
ARNT2	9915	broad.mit.edu	37	15	80883952	80883952	+	Silent	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:80883952G>A	uc002bfr.2	+	18	2128	c.1962G>A	c.(1960-1962)TCG>TCA	p.S654S	ARNT2_uc010unm.1_Silent_p.S643S|ARNT2_uc002bfs.2_Silent_p.S643S	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator	654					central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			GGCGGCCCTCGGAAGTCTGGT	0.567													15	119	---	---	---	---	capture	Silent	SNP	80883952	80883952	ARNT2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	959	55
RSL1D1	26156	broad.mit.edu	37	16	11931690	11931690	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:11931690G>T	uc002dbp.1	-	9	1500	c.1427C>A	c.(1426-1428)ACC>AAC	p.T476N	RSL1D1_uc010buv.1_Missense_Mutation_p.T475N|RSL1D1_uc010uyw.1_Missense_Mutation_p.T256N	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	476					regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						TTTTTTGGGGGTGTGGGAAGC	0.353													136	249	---	---	---	---	capture	Missense_Mutation	SNP	11931690	11931690	RSL1D1	16	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	13592	55
SMG1	23049	broad.mit.edu	37	16	18875133	18875133	+	Silent	SNP	A	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:18875133A>T	uc002dfm.2	-	25	3897	c.3534T>A	c.(3532-3534)TCT>TCA	p.S1178S	SMG1_uc010bwb.2_Silent_p.S1038S	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1178	FAT.|Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						CCTCAGGGGAAGAGTCAGTCG	0.388													18	41	---	---	---	---	capture	Silent	SNP	18875133	18875133	SMG1	16	A	T	T	T	1	0	0	0	0	0	0	0	1	28	3	4	4	14687	55
ZNF317	57693	broad.mit.edu	37	19	9271619	9271619	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9271619T>A	uc002mku.2	+	7	1573	c.1298T>A	c.(1297-1299)CTT>CAT	p.L433H	ZNF317_uc002mkv.2_Missense_Mutation_p.L292H|ZNF317_uc002mkw.2_Missense_Mutation_p.L401H|ZNF317_uc002mkx.2_Missense_Mutation_p.L348H|ZNF317_uc002mky.2_Missense_Mutation_p.L316H	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	433	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGTCCATCCTTAAGACTCAC	0.537													34	53	---	---	---	---	capture	Missense_Mutation	SNP	9271619	9271619	ZNF317	19	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	17715	55
NOTCH3	4854	broad.mit.edu	37	19	15298114	15298114	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15298114C>T	uc002nan.2	-	11	1718	c.1642G>A	c.(1642-1644)GAC>AAC	p.D548N	NOTCH3_uc002nao.1_Missense_Mutation_p.D548N	NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	548	Extracellular (Potential).|EGF-like 14; calcium-binding (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGGGAGCAGTCGTCCACGTTG	0.657													24	52	---	---	---	---	capture	Missense_Mutation	SNP	15298114	15298114	NOTCH3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10457	55
FCGBP	8857	broad.mit.edu	37	19	40419695	40419695	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40419695C>T	uc002omp.3	-	6	3307	c.3299G>A	c.(3298-3300)GGC>GAC	p.G1100D		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	1100						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCAGACTGGCCTGGCAGCAG	0.647													13	120	---	---	---	---	capture	Missense_Mutation	SNP	40419695	40419695	FCGBP	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5724	55
NLRP2	55655	broad.mit.edu	37	19	55494507	55494507	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55494507C>T	uc002qij.2	+	6	1527	c.1441C>T	c.(1441-1443)CGT>TGT	p.R481C	NLRP2_uc010yfp.1_Missense_Mutation_p.R458C|NLRP2_uc010esn.2_Missense_Mutation_p.R457C|NLRP2_uc010eso.2_Missense_Mutation_p.R478C|NLRP2_uc010esp.2_Missense_Mutation_p.R459C	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	481	NACHT.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GTCCGACCTCCGTCTGTTCCT	0.632													30	75	---	---	---	---	capture	Missense_Mutation	SNP	55494507	55494507	NLRP2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10384	55
TEKT4	150483	broad.mit.edu	37	2	95537569	95537569	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:95537569G>A	uc002stw.1	+	1	338	c.245G>A	c.(244-246)CGC>CAC	p.R82H	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	82					cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						CTGGCGCAGCGCACGCAGCAA	0.692													10	12	---	---	---	---	capture	Missense_Mutation	SNP	95537569	95537569	TEKT4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15640	55
IWS1	55677	broad.mit.edu	37	2	128238721	128238721	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128238721G>A	uc002ton.2	-	14	2662	c.2359C>T	c.(2359-2361)CGA>TGA	p.R787*		NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	787					transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TTATCCAGTCGACTGATACCC	0.388													59	77	---	---	---	---	capture	Nonsense_Mutation	SNP	128238721	128238721	IWS1	2	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	7854	55
GGT1	2678	broad.mit.edu	37	22	25023517	25023517	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:25023517G>A	uc003aan.1	+	12	1626	c.1139G>A	c.(1138-1140)GGC>GAC	p.G380D	GGT1_uc003aas.1_Missense_Mutation_p.G380D|GGT1_uc003aat.1_Missense_Mutation_p.G380D|GGT1_uc003aau.1_Missense_Mutation_p.G380D|GGT1_uc003aav.1_Missense_Mutation_p.G380D|GGT1_uc003aaw.1_Missense_Mutation_p.G380D|GGT1_uc003aax.1_Missense_Mutation_p.G380D|GGT1_uc003aay.1_Missense_Mutation_p.G36D	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	380	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	GATGACGGGGGCACTGCTCAC	0.632													4	37	---	---	---	---	capture	Missense_Mutation	SNP	25023517	25023517	GGT1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6300	55
PCDH7	5099	broad.mit.edu	37	4	30725870	30725870	+	Silent	SNP	A	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:30725870A>G	uc003gsk.1	+	1	3834	c.2826A>G	c.(2824-2826)AAA>AAG	p.K942K	PCDH7_uc011bxw.1_Silent_p.K895K|PCDH7_uc011bxx.1_Silent_p.K942K	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	942	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						AAAACAAAAAATCTAAGCAGC	0.413													44	66	---	---	---	---	capture	Silent	SNP	30725870	30725870	PCDH7	4	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	11419	55
PTCD2	79810	broad.mit.edu	37	5	71627105	71627105	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71627105A>G	uc003kcb.2	+	4	381	c.371A>G	c.(370-372)AAT>AGT	p.N124S	PTCD2_uc011csf.1_5'UTR|PTCD2_uc003kcc.2_5'UTR|PTCD2_uc011csg.1_Intron|PTCD2_uc011csh.1_Intron|PTCD2_uc003kcd.2_RNA	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	124											0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		GAGAACAAAAATTTCACTTTG	0.393													12	342	---	---	---	---	capture	Missense_Mutation	SNP	71627105	71627105	PTCD2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	12623	55
SV2C	22987	broad.mit.edu	37	5	75428120	75428120	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:75428120A>G	uc003kei.1	+	2	679	c.545A>G	c.(544-546)GAC>GGC	p.D182G		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	182	Extracellular (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GCTGAGACAGACCTCTGCATC	0.502													9	132	---	---	---	---	capture	Missense_Mutation	SNP	75428120	75428120	SV2C	5	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	15307	55
PCDHA1	56147	broad.mit.edu	37	5	140167621	140167621	+	Silent	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167621G>A	uc003lhb.2	+	1	1746	c.1746G>A	c.(1744-1746)CCG>CCA	p.P582P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Silent_p.P582P	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	582	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGGTGCCGCGATTGGTGG	0.657													42	76	---	---	---	---	capture	Silent	SNP	140167621	140167621	PCDHA1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11422	55
PCDHGA2	56113	broad.mit.edu	37	5	140720885	140720885	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140720885G>A	uc003ljk.1	+	1	2532	c.2347G>A	c.(2347-2349)GAG>AAG	p.E783K	PCDHGA1_uc003lji.1_Intron|PCDHGA3_uc003ljm.1_5'Flank|PCDHGA3_uc010jfx.1_5'Flank|PCDHGA2_uc011dao.1_Missense_Mutation_p.E783K|PCDHGA3_uc011dap.1_5'Flank	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	783	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATCAGCCAGGAGAGCTGTGA	0.488													58	129	---	---	---	---	capture	Missense_Mutation	SNP	140720885	140720885	PCDHGA2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11457	55
ODZ2	57451	broad.mit.edu	37	5	167627098	167627098	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167627098C>G	uc010jjd.2	+	17	3365	c.3365C>G	c.(3364-3366)GCG>GGG	p.A1122G	ODZ2_uc003lzr.3_Missense_Mutation_p.A899G|ODZ2_uc003lzt.3_Missense_Mutation_p.A495G|ODZ2_uc010jje.2_Missense_Mutation_p.A393G	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AAGACAGATGCGTATGGCCAA	0.453													17	26	---	---	---	---	capture	Missense_Mutation	SNP	167627098	167627098	ODZ2	5	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	10740	55
DAXX	1616	broad.mit.edu	37	6	33287338	33287338	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33287338A>G	uc003oec.2	-	6	1963	c.1759T>C	c.(1759-1761)TCC>CCC	p.S587P	ZBTB22_uc003oeb.2_5'Flank|ZBTB22_uc010juu.2_5'Flank|DAXX_uc011drd.1_Missense_Mutation_p.S512P|DAXX_uc011dre.1_Missense_Mutation_p.S599P|DAXX_uc003oed.2_Missense_Mutation_p.S587P	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN	death-domain associated protein isoform a	587	Interaction with MAP3K5.				activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding			pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						CTGGAAGAGGAAATGTCCGTC	0.527			Mis|F|N		Pancreatic neuroendocrine tumors								67	88	---	---	---	---	capture	Missense_Mutation	SNP	33287338	33287338	DAXX	6	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	4202	55
TFPI2	7980	broad.mit.edu	37	7	93516588	93516588	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93516588G>A	uc003umy.1	-	4	691	c.616C>T	c.(616-618)CGT>TGT	p.R206C	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_Silent_p.N180N|TFPI2_uc003una.1_Missense_Mutation_p.R195C|TFPI2_uc003unb.1_Missense_Mutation_p.R212C|TFPI2_uc010lfg.1_Missense_Mutation_p.R82C	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	206	BPTI/Kunitz inhibitor 3.				blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			GCACATGCACGTTTGCAATCC	0.323													46	131	---	---	---	---	capture	Missense_Mutation	SNP	93516588	93516588	TFPI2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15694	55
ASZ1	136991	broad.mit.edu	37	7	117024817	117024817	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117024817A>G	uc003vjb.2	-	6	713	c.650T>C	c.(649-651)ATG>ACG	p.M217T	ASZ1_uc011kno.1_Missense_Mutation_p.M217T|ASZ1_uc011knp.1_Missense_Mutation_p.M9T	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper	217	ANK 6.				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CTCACTTGGCATCTTTCCATC	0.353													54	191	---	---	---	---	capture	Missense_Mutation	SNP	117024817	117024817	ASZ1	7	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	1060	55
KEL	3792	broad.mit.edu	37	7	142658531	142658531	+	Missense_Mutation	SNP	G	A	A	rs150577967		TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142658531G>A	uc003wcb.2	-	3	349	c.139C>T	c.(139-141)CGG>TGG	p.R47W		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	47	Cytoplasmic (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GTCAGCACCCGCCTGGCCACT	0.547													8	16	---	---	---	---	capture	Missense_Mutation	SNP	142658531	142658531	KEL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8064	55
MLL3	58508	broad.mit.edu	37	7	151927093	151927093	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151927093C>A	uc003wla.2	-	18	3110	c.2891G>T	c.(2890-2892)GGC>GTC	p.G964V	MLL3_uc003wkz.2_Missense_Mutation_p.G25V	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	964	PHD-type 4.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GCCAAAACTGCCACAAACTAC	0.348			N		medulloblastoma								27	432	---	---	---	---	capture	Missense_Mutation	SNP	151927093	151927093	MLL3	7	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	9534	55
TLE4	7091	broad.mit.edu	37	9	82324566	82324566	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:82324566G>A	uc004ald.2	+	15	2216	c.1367G>A	c.(1366-1368)CGT>CAT	p.R456H	TLE4_uc004alc.2_Missense_Mutation_p.R431H|TLE4_uc010mpr.2_Missense_Mutation_p.R310H|TLE4_uc004ale.2_Missense_Mutation_p.R68H|TLE4_uc011lsq.1_Missense_Mutation_p.R399H|TLE4_uc010mps.2_Missense_Mutation_p.R355H|TLE4_uc004alf.2_Missense_Mutation_p.R370H	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5						CATCACATGCGTGTGCCAGCA	0.438													4	79	---	---	---	---	capture	Missense_Mutation	SNP	82324566	82324566	TLE4	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15826	55
FLJ46321	389763	broad.mit.edu	37	9	84605747	84605747	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:84605747G>A	uc004amn.2	+	4	409	c.362G>A	c.(361-363)CGT>CAT	p.R121H		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	121						integral to membrane					0						AACCACTTTCGTCGACTGTTA	0.537													15	25	---	---	---	---	capture	Missense_Mutation	SNP	84605747	84605747	FLJ46321	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5876	55
ZNF618	114991	broad.mit.edu	37	9	116779034	116779034	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116779034C>A	uc004bid.2	+	10	913	c.814C>A	c.(814-816)CAG>AAG	p.Q272K	ZNF618_uc004bib.1_Missense_Mutation_p.Q240K|ZNF618_uc004bic.2_Missense_Mutation_p.Q260K|ZNF618_uc011lxi.1_Missense_Mutation_p.Q240K|ZNF618_uc011lxj.1_Missense_Mutation_p.Q240K	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	272	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACTCCCTACCAGGAGCATGT	0.572													4	31	---	---	---	---	capture	Missense_Mutation	SNP	116779034	116779034	ZNF618	9	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	17920	55
MAP3K15	389840	broad.mit.edu	37	X	19431486	19431486	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:19431486G>T	uc004czk.1	-	11	1651	c.14C>A	c.(13-15)ACC>AAC	p.T5N	MAP3K15_uc004czj.1_5'UTR	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase	Error:Variant_position_missing_in_Q6ZN16_after_alignment							ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					ATTTCTGTGGGTGAGACATGC	0.398													118	58	---	---	---	---	capture	Missense_Mutation	SNP	19431486	19431486	MAP3K15	23	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	9163	55
ACAP3	116983	broad.mit.edu	37	1	1229020	1229020	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1229020delA	uc001aeb.2	-	24	2503	c.2429delT	c.(2428-2430)CTGfs	p.L810fs	ACAP3_uc001ady.2_Frame_Shift_Del_p.L540fs|ACAP3_uc001aea.2_Frame_Shift_Del_p.L735fs	NM_030649	NP_085152	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH	810					filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding				0						GCTGCCCGCCAGGGCGCCCGG	0.721													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	1229020	1229020	ACAP3	1	A	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	120	55
CHD8	57680	broad.mit.edu	37	14	21884031	21884031	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21884031delT	uc001was.1	-	6	1009	c.915delA	c.(913-915)AAAfs	p.K305fs	CHD8_uc001war.1_Frame_Shift_Del_p.K201fs	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	584					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CCTCTGTATATTTTTTTCGCT	0.398													10	294	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	21884031	21884031	CHD8	14	T	-	-	-	1	0	1	0	1	0	0	0	0	673	52	5	5	3297	55
TP53	7157	broad.mit.edu	37	17	7577558	7577566	+	In_Frame_Del	DEL	GGAACTGTT	-	-	rs28934573		TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577558_7577566delGGAACTGTT	uc002gim.2	-	7	909_917	c.715_723delAACAGTTCC	c.(715-723)AACAGTTCCdel	p.NSS239del	TP53_uc002gig.1_In_Frame_Del_p.NSS239del|TP53_uc002gih.2_In_Frame_Del_p.NSS239del|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_In_Frame_Del_p.NSS107del|TP53_uc010cng.1_In_Frame_Del_p.NSS107del|TP53_uc002gii.1_In_Frame_Del_p.NSS107del|TP53_uc010cnh.1_In_Frame_Del_p.NSS239del|TP53_uc010cni.1_In_Frame_Del_p.NSS239del|TP53_uc002gij.2_In_Frame_Del_p.NSS239del|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_In_Frame_Del_p.NSS146del|TP53_uc002gio.2_In_Frame_Del_p.NSS107del	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	239_241	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		S -> A (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> C (in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.S241F(73)|p.N239D(31)|p.S241C(24)|p.N239S(19)|p.C242fs*5(15)|p.S240G(14)|p.N239fs*25(12)|p.S240R(8)|p.S241fs*6(8)|p.0?(7)|p.S241Y(7)|p.N239Y(6)|p.S241A(6)|p.S240I(6)|p.N239K(6)|p.S241del(5)|p.S241T(5)|p.N239T(4)|p.N239_C242delNSSC(3)|p.S240C(3)|p.S241S(3)|p.S241P(3)|p.N239_S240insX(2)|p.N239fs*8(2)|p.S240S(2)|p.S240T(2)|p.S240fs*7(2)|p.N239_S240delNS(2)|p.S241fs*22(2)|p.C242fs*20(1)|p.C242fs*23(1)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.S240>CSC(1)|p.C238_M246delCNSSCMGGM(1)|p.S240P(1)|p.S241_C242insX(1)|p.M237_N239delMCN(1)|p.S240fs*23(1)|p.N239fs*26(1)|p.C238fs*21(1)|p.N239N(1)|p.H233fs*6(1)|p.S241fs*7(1)|p.S240fs*26(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.S241fs*23(1)|p.S241_G245delSCMGG(1)|p.N239fs*0(1)|p.C238_N239insX(1)|p.N239_C242del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGCCCATGCAGGAACTGTTACACATGTAG	0.574		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			19	27	---	---	---	---	capture_indel	In_Frame_Del	DEL	7577558	7577566	TP53	17	GGAACTGTT	-	-	-	1	0	1	0	1	0	0	0	0	444	35	5	5	16264	55
UQCRQ	27089	broad.mit.edu	37	5	132202700	132202701	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:132202700_132202701insG	uc003kya.1	+	2	201_202	c.127_128insG	c.(127-129)CGGfs	p.R43fs	GDF9_uc003kxz.1_5'Flank|GDF9_uc011cxj.1_5'Flank	NM_014402	NP_055217	O14949	QCR8_HUMAN	ubiquinol-cytochrome c reductase, complex III	43					respiratory electron transport chain	mitochondrial inner membrane|respiratory chain	ubiquinol-cytochrome-c reductase activity				0		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCGCCGCATTCGGGAGTCTTTC	0.629													30	66	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	132202700	132202701	UQCRQ	5	-	G	G	G	1	0	1	1	0	0	0	0	0	399	31	5	5	16906	55
UBE2CBP	90025	broad.mit.edu	37	6	83728822	83728822	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0238-01	TCGA-06-0238-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:83728822delC	uc003pjp.2	-	8	988	c.880delG	c.(880-882)GAAfs	p.E294fs	UBE2CBP_uc011dyx.1_RNA|UBE2CBP_uc003pjq.2_Frame_Shift_Del_p.E84fs	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN	ubiquitin-conjugating enzyme E2C binding	294						cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)		CTCAAAGATTCAATCACCAAA	0.353													46	68	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	83728822	83728822	UBE2CBP	6	C	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	16729	55
