Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MS4A8B	83661	broad.mit.edu	37	11	60470906	60470906	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60470906C>T	uc001npv.2	+	3	478	c.275C>T	c.(274-276)ACG>ATG	p.T92M	MS4A8B_uc009yne.1_Missense_Mutation_p.T92M	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	92	Helical; (Potential).					integral to membrane	receptor activity				0						ATCATGGCGACGGTTCTCGTA	0.552													6	146	---	---	---	---	capture	Missense_Mutation	SNP	60470906	60470906	MS4A8B	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9777	56
RYR3	6263	broad.mit.edu	37	15	34105755	34105755	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34105755A>G	uc001zhi.2	+	74	10547	c.10477A>G	c.(10477-10479)ATG>GTG	p.M3493V	RYR3_uc010bar.2_Missense_Mutation_p.M3488V	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3493					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTGTTTCAGGATGGCCCCTCT	0.527													6	120	---	---	---	---	capture	Missense_Mutation	SNP	34105755	34105755	RYR3	15	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	13662	56
THBS1	7057	broad.mit.edu	37	15	39874573	39874573	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:39874573C>T	uc001zkh.2	+	3	426	c.247C>T	c.(247-249)CGG>TGG	p.R83W		NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	83	TSP N-terminal.|Heparin-binding.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	GGATGCTGTGCGGGCAGAAAA	0.617													7	76	---	---	---	---	capture	Missense_Mutation	SNP	39874573	39874573	THBS1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15738	56
PAQR5	54852	broad.mit.edu	37	15	69652448	69652448	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:69652448T>C	uc002arz.2	+	3	407	c.29T>C	c.(28-30)TTT>TCT	p.F10S	PAQR5_uc002asa.2_Missense_Mutation_p.F10S	NM_017705	NP_060175	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	10	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding			ovary(2)	2						CCCAGGCTGTTTAGCATAGAC	0.542													4	119	---	---	---	---	capture	Missense_Mutation	SNP	69652448	69652448	PAQR5	15	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	11342	56
CLEC3A	10143	broad.mit.edu	37	16	78064695	78064695	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:78064695G>A	uc002ffh.3	+	3	632	c.551G>A	c.(550-552)CGC>CAC	p.R184H		NM_005752	NP_005743	O75596	CLC3A_HUMAN	C-type lectin domain family 3 member A	184	C-type lectin.				skeletal system development	extracellular region	sugar binding				0						GAGGCCTGTCGCAGCAGCAAG	0.493													6	79	---	---	---	---	capture	Missense_Mutation	SNP	78064695	78064695	CLEC3A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3475	56
HOXB5	3215	broad.mit.edu	37	17	46670992	46670992	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46670992T>C	uc002inr.2	-	1	112	c.53A>G	c.(52-54)GAC>GGC	p.D18G		NM_002147	NP_002138	P09067	HXB5_HUMAN	homeobox B5	18						nucleus	sequence-specific DNA binding				0						CAACTGATAGTCCGGGCCATT	0.507													4	82	---	---	---	---	capture	Missense_Mutation	SNP	46670992	46670992	HOXB5	17	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	7229	56
FUT3	2525	broad.mit.edu	37	19	5844280	5844280	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5844280C>T	uc002mdk.2	-	2	668	c.571G>A	c.(571-573)GAG>AAG	p.E191K	FUT3_uc002mdm.2_Missense_Mutation_p.E191K|FUT3_uc002mdj.2_Missense_Mutation_p.E191K|FUT3_uc002mdl.2_Missense_Mutation_p.E191K	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	191	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						GCCACCAGCTCGGTCTTGGCC	0.667													5	117	---	---	---	---	capture	Missense_Mutation	SNP	5844280	5844280	FUT3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6047	56
MUC16	94025	broad.mit.edu	37	19	9003616	9003616	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9003616G>A	uc002mkp.2	-	49	40228	c.40024C>T	c.(40024-40026)CGC>TGC	p.R13342C	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.R159C|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13344	Extracellular (Potential).|SEA 9.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAGCCAGGGCGACGCATGTCC	0.552													7	220	---	---	---	---	capture	Missense_Mutation	SNP	9003616	9003616	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9883	56
CCDC37	348807	broad.mit.edu	37	3	126133023	126133023	+	Splice_Site	SNP	G	A	A	rs150312379	byFrequency	TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126133023G>A	uc003eiu.1	+	4	324	c.225_splice	c.e4+1	p.S75_splice	CCDC37_uc010hsg.1_Splice_Site_p.S75_splice	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37											ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		GGCTCTCTCCGTGAGTATCCA	0.557													5	146	---	---	---	---	capture	Splice_Site	SNP	126133023	126133023	CCDC37	3	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	2783	56
PCDHA1	56147	broad.mit.edu	37	5	140167216	140167216	+	Silent	SNP	C	T	T			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167216C>T	uc003lhb.2	+	1	1341	c.1341C>T	c.(1339-1341)GAC>GAT	p.D447D	PCDHA1_uc003lha.2_Silent_p.D447D|PCDHA1_uc003lgz.2_Silent_p.D447D	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	447	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGGCCGACGTGAATGACA	0.667													6	200	---	---	---	---	capture	Silent	SNP	140167216	140167216	PCDHA1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11422	56
PPARGC1B	133522	broad.mit.edu	37	5	149210432	149210432	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149210432C>T	uc003lrc.2	+	4	610	c.568C>T	c.(568-570)CGG>TGG	p.R190W	PPARGC1B_uc003lrb.1_Missense_Mutation_p.R190W|PPARGC1B_uc003lrd.2_Intron|PPARGC1B_uc003lrf.2_Missense_Mutation_p.R169W|PPARGC1B_uc003lre.1_Missense_Mutation_p.R169W	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	190					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TAAAAGTCAACGGCCTTGTGT	0.562													6	165	---	---	---	---	capture	Missense_Mutation	SNP	149210432	149210432	PPARGC1B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	12202	56
TDRD6	221400	broad.mit.edu	37	6	46658843	46658843	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46658843C>T	uc003oyj.2	+	1	2978	c.2978C>T	c.(2977-2979)ACG>ATG	p.T993M	TDRD6_uc010jze.2_Missense_Mutation_p.T987M	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	993					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			GTTTATATAACGCATATTGAT	0.333													5	48	---	---	---	---	capture	Missense_Mutation	SNP	46658843	46658843	TDRD6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15619	56
RAMP3	10268	broad.mit.edu	37	7	45222997	45222997	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45222997G>A	uc003tnb.2	+	3	494	c.433G>A	c.(433-435)GAC>AAC	p.D145N	RAMP3_uc003tnc.2_Missense_Mutation_p.D113N	NM_005856	NP_005847	O60896	RAMP3_HUMAN	receptor activity modifying protein 3 precursor	145	Cytoplasmic (Potential).				intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane|lysosome	protein transporter activity				0					Pramlintide(DB01278)	CAAACGCACCGACACGCTGCT	0.627													6	191	---	---	---	---	capture	Missense_Mutation	SNP	45222997	45222997	RAMP3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12918	56
TLR4	7099	broad.mit.edu	37	9	120466768	120466768	+	Silent	SNP	C	G	G			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:120466768C>G	uc004bjz.2	+	1	309	c.18C>G	c.(16-18)CGC>CGG	p.R6R	TLR4_uc004bka.2_5'UTR|TLR4_uc004bkb.2_5'UTR	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	6					activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						CTGCCTCGCGCCTGGCTGGGA	0.602													3	91	---	---	---	---	capture	Silent	SNP	120466768	120466768	TLR4	9	C	G	G	G	1	0	0	0	0	0	0	0	1	327	26	4	4	15838	56
PRB2	653247	broad.mit.edu	37	12	11546320	11546322	+	In_Frame_Del	DEL	TTG	-	-			TCGA-06-0240-01	TCGA-06-0240-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11546320_11546322delTTG	uc010shk.1	-	3	725_727	c.690_692delCAA	c.(688-693)AACAAG>AAG	p.N230del		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTTGGGACTTGTTGTCTCCTT	0.601													7	686	---	---	---	---	capture_indel	In_Frame_Del	DEL	11546320	11546322	PRB2	12	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	12339	56
