Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MEGF6	1953	broad.mit.edu	37	1	3407152	3407152	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3407152C>T	uc001akl.2	-	37	4793	c.4566G>A	c.(4564-4566)GCG>GCA	p.A1522A	MEGF6_uc001akk.2_Silent_p.A1210A	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor	1522						extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GCAGTGTGCCCGCTGGGGAAA	0.672													31	20	---	---	---	---	capture	Silent	SNP	3407152	3407152	MEGF6	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9375	57
PER3	8863	broad.mit.edu	37	1	7845640	7845640	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7845640G>A	uc001aoo.2	+	2	443	c.268G>A	c.(268-270)GTT>ATT	p.V90I	PER3_uc009vmg.1_Missense_Mutation_p.V90I|PER3_uc009vmh.1_Missense_Mutation_p.V90I|PER3_uc001aop.2_Missense_Mutation_p.V90I|PER3_uc010nzw.1_5'UTR|PER3_uc001aon.2_Missense_Mutation_p.V90I	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	90					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TGTCCACAGCGTTCAAGGTAA	0.483													4	81	---	---	---	---	capture	Missense_Mutation	SNP	7845640	7845640	PER3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11634	57
SLC2A7	155184	broad.mit.edu	37	1	9064868	9064868	+	Silent	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:9064868G>A	uc009vmo.1	-	11	1263	c.1263C>T	c.(1261-1263)GAC>GAT	p.D421D		NM_207420	NP_997303	Q6PXP3	GTR7_HUMAN	intestinal facilitative glucose transporter 7	421	Helical; (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity				0	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GCACTGCCCCGTCCACCATGA	0.652													4	83	---	---	---	---	capture	Silent	SNP	9064868	9064868	SLC2A7	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14442	57
CSF3R	1441	broad.mit.edu	37	1	36932400	36932400	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36932400G>A	uc001caw.1	-	17	2247	c.2069C>T	c.(2068-2070)ACG>ATG	p.T690M	MRPS15_uc001cas.2_5'Flank|CSF3R_uc001cat.1_Missense_Mutation_p.T252M|CSF3R_uc009vvc.1_Missense_Mutation_p.T219M|CSF3R_uc001cau.1_Missense_Mutation_p.T90M|CSF3R_uc001cav.1_Missense_Mutation_p.T690M|CSF3R_uc001cax.1_Missense_Mutation_p.T717M|CSF3R_uc001cay.1_Missense_Mutation_p.R659C	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	690	Cytoplasmic (Potential).				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity	p.T717M(1)		central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GATGGGTGGCGTGCCAAGGCC	0.612													104	117	---	---	---	---	capture	Missense_Mutation	SNP	36932400	36932400	CSF3R	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3902	57
DNALI1	7802	broad.mit.edu	37	1	38027710	38027710	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38027710A>G	uc001cbj.2	+	5	681	c.671A>G	c.(670-672)GAC>GGC	p.D224G	DNALI1_uc010oie.1_RNA	NM_003462	NP_003453	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	202	Potential.				cellular component movement|single fertilization	axonemal dynein complex	microtubule motor activity			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAAAAGAGAGACCTGGAGAGG	0.557											OREG0013380	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	123	---	---	---	---	capture	Missense_Mutation	SNP	38027710	38027710	DNALI1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	4615	57
FAM46C	54855	broad.mit.edu	37	1	118165644	118165644	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118165644G>A	uc001ehe.2	+	2	353	c.154G>A	c.(154-156)GTC>ATC	p.V52I		NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855	52											0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		GAAGGACATCGTCCAGACCGT	0.567										Multiple Myeloma(3;1.13e-06)			47	62	---	---	---	---	capture	Missense_Mutation	SNP	118165644	118165644	FAM46C	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5515	57
ZNF697	90874	broad.mit.edu	37	1	120165750	120165750	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120165750C>A	uc001ehy.1	-	3	1330	c.1216G>T	c.(1216-1218)GAG>TAG	p.E406*		NM_001080470	NP_001073939	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	406					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		TAGGGCTTCTCGCCCGTGTGC	0.672													6	8	---	---	---	---	capture	Nonsense_Mutation	SNP	120165750	120165750	ZNF697	1	C	A	A	A	1	0	0	0	0	0	1	0	0	403	31	5	4	17978	57
AQP10	89872	broad.mit.edu	37	1	154294529	154294529	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154294529G>A	uc001feu.2	+	2	266	c.226G>A	c.(226-228)GTC>ATC	p.V76I	AQP10_uc001fev.2_Missense_Mutation_p.V76I	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	76	Cytoplasmic (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGGTGGTAACGTCTCAGGTGA	0.547													23	23	---	---	---	---	capture	Missense_Mutation	SNP	154294529	154294529	AQP10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	815	57
TMEM79	84283	broad.mit.edu	37	1	156255048	156255048	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156255048G>A	uc010phi.1	+	2	227	c.31G>A	c.(31-33)GAA>AAA	p.E11K	SMG5_uc001foc.3_5'Flank|TMEM79_uc001fod.2_5'UTR|TMEM79_uc009wrw.2_Missense_Mutation_p.E11K	NM_032323	NP_115699	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	11						integral to membrane				central_nervous_system(1)	1	Hepatocellular(266;0.158)					GGCCCTACTGGAAGTGAAGAG	0.597													45	70	---	---	---	---	capture	Missense_Mutation	SNP	156255048	156255048	TMEM79	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16086	57
SVIL	6840	broad.mit.edu	37	10	29839816	29839816	+	Silent	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:29839816G>A	uc001iut.1	-	6	1290	c.537C>T	c.(535-537)GCC>GCT	p.A179A	SVIL_uc001iuu.1_Silent_p.A179A|SVIL_uc009xld.1_Silent_p.A179A	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	179					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TGGATTCACCGGCACAGGTCC	0.557													4	138	---	---	---	---	capture	Silent	SNP	29839816	29839816	SVIL	10	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15309	57
MUC5B	727897	broad.mit.edu	37	11	1251288	1251288	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1251288G>A	uc009ycr.1	+	27	3377	c.3251G>A	c.(3250-3252)TGC>TAC	p.C1084Y	MUC5B_uc009yct.1_Missense_Mutation_p.C425Y|MUC5B_uc001ltb.2_Missense_Mutation_p.C428Y|MUC5B_uc001lta.2_Missense_Mutation_p.C93Y	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	425	VWFD 2.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTGGCACCTGCTCTGTGCAG	0.652													64	81	---	---	---	---	capture	Missense_Mutation	SNP	1251288	1251288	MUC5B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9889	57
NAV2	89797	broad.mit.edu	37	11	20099593	20099593	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20099593G>A	uc010rdm.1	+	26	5651	c.5290G>A	c.(5290-5292)GCA>ACA	p.A1764T	NAV2_uc001mpp.2_Missense_Mutation_p.A1644T|NAV2_uc001mpr.3_Missense_Mutation_p.A1708T|NAV2_uc001mpt.2_Missense_Mutation_p.A757T|NAV2_uc009yhx.2_Missense_Mutation_p.A772T|NAV2_uc009yhy.1_Missense_Mutation_p.A670T|NAV2_uc009yhz.2_Missense_Mutation_p.A353T|NAV2_uc001mpu.2_Missense_Mutation_p.A146T	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	1764	Potential.					nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GAAACAGAACGCAGCTGCCCA	0.433													19	17	---	---	---	---	capture	Missense_Mutation	SNP	20099593	20099593	NAV2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10091	57
NOX4	50507	broad.mit.edu	37	11	89073272	89073272	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89073272A>C	uc001pct.2	-	15	1644	c.1405T>G	c.(1405-1407)TTC>GTC	p.F469V	NOX4_uc009yvr.2_Missense_Mutation_p.F444V|NOX4_uc001pcu.2_Missense_Mutation_p.F395V|NOX4_uc001pcw.2_Missense_Mutation_p.F162V|NOX4_uc001pcx.2_Missense_Mutation_p.F122V|NOX4_uc001pcv.2_Missense_Mutation_p.F429V|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Missense_Mutation_p.F233V|NOX4_uc010rtv.1_Missense_Mutation_p.F405V|NOX4_uc009yvq.2_Missense_Mutation_p.F445V	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	469	Cytoplasmic (Potential).|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AACCAACGGAAGGACTGGATA	0.328													13	203	---	---	---	---	capture	Missense_Mutation	SNP	89073272	89073272	NOX4	11	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	10465	57
LRP1	4035	broad.mit.edu	37	12	57581183	57581183	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57581183C>T	uc001snd.2	+	42	7441	c.6975C>T	c.(6973-6975)GTC>GTT	p.V2325V		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2325	LDL-receptor class B 22.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GTGAGACCGTCATCACTATGT	0.612													46	56	---	---	---	---	capture	Silent	SNP	57581183	57581183	LRP1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	8867	57
MBIP	51562	broad.mit.edu	37	14	36789728	36789728	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:36789728G>T	uc001wtm.2	-	1	155	c.67C>A	c.(67-69)CCC>ACC	p.P23T	MBIP_uc001wto.2_Missense_Mutation_p.P23T|MBIP_uc010tpy.1_5'UTR|MBIP_uc001wtn.2_Missense_Mutation_p.P23T	NM_016586	NP_057670	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1 isoform 1	23					histone H3 acetylation|inactivation of MAPK activity involved in osmosensory signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm|nucleolus	identical protein binding|protein kinase inhibitor activity				0	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		GAGAGGTTGGGTCTGCATCTT	0.587													45	10	---	---	---	---	capture	Missense_Mutation	SNP	36789728	36789728	MBIP	14	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	9262	57
FBN1	2200	broad.mit.edu	37	15	48787734	48787734	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:48787734C>T	uc001zwx.1	-	21	2799	c.2471G>A	c.(2470-2472)AGC>AAC	p.S824N		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	824	EGF-like 13; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGAGCCTGGGCTGTTCTTGCA	0.368													178	234	---	---	---	---	capture	Missense_Mutation	SNP	48787734	48787734	FBN1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	5648	57
AKAP13	11214	broad.mit.edu	37	15	86123972	86123972	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:86123972C>T	uc002blv.1	+	7	2843	c.2673C>T	c.(2671-2673)GAC>GAT	p.D891D	AKAP13_uc002blt.1_Silent_p.D891D|AKAP13_uc002blu.1_Silent_p.D891D|AKAP13_uc010bne.1_5'Flank	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	891					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						GGAACACTGACTCTTCCCTGC	0.512													73	84	---	---	---	---	capture	Silent	SNP	86123972	86123972	AKAP13	15	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	449	57
FANCI	55215	broad.mit.edu	37	15	89859631	89859631	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89859631A>G	uc010bnp.1	+	38	4018	c.3928A>G	c.(3928-3930)ACT>GCT	p.T1310A	FANCI_uc002bnm.1_Missense_Mutation_p.T1250A|FANCI_uc002bnn.1_RNA|FANCI_uc002bnp.1_Missense_Mutation_p.T1070A|FANCI_uc002bnq.1_Missense_Mutation_p.T723A|POLG_uc002bns.3_3'UTR|POLG_uc002bnr.3_3'UTR	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I isoform	1310					cell cycle|DNA repair	nucleoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					CTTCTAGGGCACTGCATCAGA	0.398								Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				13	34	---	---	---	---	capture	Missense_Mutation	SNP	89859631	89859631	FANCI	15	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	5615	57
ITGAM	3684	broad.mit.edu	37	16	31308885	31308885	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31308885C>T	uc002ebq.2	+	13	1505	c.1407C>T	c.(1405-1407)AAC>AAT	p.N469N	ITGAM_uc002ebr.2_Silent_p.N469N|ITGAM_uc010cam.1_Missense_Mutation_p.R73W|ITGAM_uc010can.2_Translation_Start_Site	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	469	FG-GAP 5.|Extracellular (Potential).|Potential.				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						TGGACAGCAACGGCAGCACCG	0.637													143	178	---	---	---	---	capture	Silent	SNP	31308885	31308885	ITGAM	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7810	57
NOL3	8996	broad.mit.edu	37	16	67208778	67208778	+	Silent	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67208778G>A	uc010vjd.1	+	3	733	c.726G>A	c.(724-726)CAG>CAA	p.Q242Q	NOL3_uc010vjc.1_Missense_Mutation_p.E246K|NOL3_uc002erp.2_Missense_Mutation_p.E184K			O60936	NOL3_HUMAN	RecName: Full=Nucleolar protein 3; AltName: Full=Apoptosis repressor with CARD; AltName: Full=Muscle-enriched cytoplasmic protein;          Short=Myp; AltName: Full=Nucleolar protein of 30 kDa;          Short=Nop30;	180					anti-apoptosis|apoptosis|mRNA processing|RNA splicing	cytosol|nucleolus	identical protein binding|RNA binding				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		agcagaaccagagccggaact	0.294													15	17	---	---	---	---	capture	Silent	SNP	67208778	67208778	NOL3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	429	33	2	2	10430	57
KCTD19	146212	broad.mit.edu	37	16	67337179	67337179	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67337179C>T	uc002esu.2	-	4	564	c.513G>A	c.(511-513)GAG>GAA	p.E171E	KCTD19_uc002est.2_5'UTR|KCTD19_uc010vjj.1_5'UTR	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain	171						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		AGTAGTGCACCTCCTCTTCTG	0.567													32	46	---	---	---	---	capture	Silent	SNP	67337179	67337179	KCTD19	16	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	8028	57
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	T	T	rs11540652		TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577538C>T	uc002gim.2	-	7	937	c.743G>A	c.(742-744)CGG>CAG	p.R248Q	TP53_uc002gig.1_Missense_Mutation_p.R248Q|TP53_uc002gih.2_Missense_Mutation_p.R248Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116Q|TP53_uc010cng.1_Missense_Mutation_p.R116Q|TP53_uc002gii.1_Missense_Mutation_p.R116Q|TP53_uc010cnh.1_Missense_Mutation_p.R248Q|TP53_uc010cni.1_Missense_Mutation_p.R248Q|TP53_uc002gij.2_Missense_Mutation_p.R248Q|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155Q|TP53_uc002gio.2_Missense_Mutation_p.R116Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			32	17	---	---	---	---	capture	Missense_Mutation	SNP	7577538	7577538	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	57
THEG	51298	broad.mit.edu	37	19	367156	367156	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:367156C>T	uc002lol.2	-	7	861	c.822G>A	c.(820-822)CCG>CCA	p.P274P	THEG_uc002lom.2_Silent_p.P250P	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	274	THEG 4.				cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGGGCCTTCGGCTTTGACA	0.572													89	123	---	---	---	---	capture	Silent	SNP	367156	367156	THEG	19	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	15742	57
ELSPBP1	64100	broad.mit.edu	37	19	48511941	48511941	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48511941G>C	uc002pht.2	+	2	172	c.17G>C	c.(16-18)AGT>ACT	p.S6T		NM_022142	NP_071425	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1 precursor	6					single fertilization	extracellular region					0		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CGATGGTCCAGTTACCTGTTG	0.468													25	43	---	---	---	---	capture	Missense_Mutation	SNP	48511941	48511941	ELSPBP1	19	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	5038	57
TNNT1	7138	broad.mit.edu	37	19	55648471	55648471	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55648471C>T	uc002qjb.3	-	11	700	c.611G>A	c.(610-612)CGG>CAG	p.R204Q	TNNT1_uc002qiz.3_Missense_Mutation_p.R134Q|TNNT1_uc002qja.3_Missense_Mutation_p.R134Q|TNNT1_uc002qjc.3_Missense_Mutation_p.R204Q|TNNT1_uc002qje.3_Missense_Mutation_p.R193Q|TNNT1_uc002qjd.3_Missense_Mutation_p.R193Q	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a	204					muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		CAGCACCTACCGGAGCTGTTC	0.607													34	23	---	---	---	---	capture	Missense_Mutation	SNP	55648471	55648471	TNNT1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16213	57
PEG3	5178	broad.mit.edu	37	19	57327999	57327999	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57327999C>T	uc002qnu.2	-	7	2162	c.1811G>A	c.(1810-1812)CGC>CAC	p.R604H	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.R575H|PEG3_uc002qnv.2_Missense_Mutation_p.R604H|PEG3_uc002qnw.2_Missense_Mutation_p.R480H|PEG3_uc002qnx.2_Missense_Mutation_p.R478H|PEG3_uc010etr.2_Missense_Mutation_p.R604H	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	604					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.R604H(1)		ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GGTTTCCCCGCGCtcacgttc	0.378													37	43	---	---	---	---	capture	Missense_Mutation	SNP	57327999	57327999	PEG3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11623	57
CD207	50489	broad.mit.edu	37	2	71060827	71060827	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71060827C>T	uc002shg.2	-	3	562	c.515G>A	c.(514-516)CGG>CAG	p.R172Q		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	172	Potential.|Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						CTGGAGTGCCCGGATCTTTGT	0.428													36	42	---	---	---	---	capture	Missense_Mutation	SNP	71060827	71060827	CD207	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2954	57
TBC1D8	11138	broad.mit.edu	37	2	101655055	101655055	+	Silent	SNP	G	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:101655055G>T	uc010fiv.2	-	7	1229	c.1098C>A	c.(1096-1098)ATC>ATA	p.I366I	TBC1D8_uc010yvw.1_Silent_p.I381I|TBC1D8_uc002tau.3_Silent_p.I123I	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	366					blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						CCTTGCTTCTGATACTGACAA	0.612													116	135	---	---	---	---	capture	Silent	SNP	101655055	101655055	TBC1D8	2	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	15512	57
LRP1B	53353	broad.mit.edu	37	2	141597647	141597647	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141597647A>T	uc002tvj.1	-	31	6094	c.5122T>A	c.(5122-5124)TAC>AAC	p.Y1708N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1708	Extracellular (Potential).|LDL-receptor class B 16.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCGGTCCAGTAGAGTTTTCTT	0.318										TSP Lung(27;0.18)			20	29	---	---	---	---	capture	Missense_Mutation	SNP	141597647	141597647	LRP1B	2	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	8871	57
CHD6	84181	broad.mit.edu	37	20	40045338	40045338	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:40045338G>A	uc002xka.1	-	33	6554	c.6376C>T	c.(6376-6378)CCC>TCC	p.P2126S	CHD6_uc002xjz.1_5'Flank	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2126					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				ACCGGGGTGGGCAGTGTGCCT	0.572													4	112	---	---	---	---	capture	Missense_Mutation	SNP	40045338	40045338	CHD6	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3295	57
RTEL1	51750	broad.mit.edu	37	20	62326129	62326129	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62326129G>T	uc002yfu.1	+	32	3488	c.3145G>T	c.(3145-3147)GTG>TTG	p.V1049L	RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Missense_Mutation_p.V1049L|RTEL1_uc011abd.1_Missense_Mutation_p.V1073L|RTEL1_uc011abe.1_Missense_Mutation_p.V826L|RTEL1_uc002yfw.2_RNA|RTEL1_uc002yfx.1_Missense_Mutation_p.V294L|TNFRSF6B_uc002yfy.2_5'Flank|TNFRSF6B_uc002yfz.2_5'Flank	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1	1049					DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GGGGTCTGGAGTGCCCAGAGC	0.687													18	24	---	---	---	---	capture	Missense_Mutation	SNP	62326129	62326129	RTEL1	20	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	13612	57
ARL8B	55207	broad.mit.edu	37	3	5214343	5214343	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:5214343A>G	uc003bqg.2	+	4	511	c.290A>G	c.(289-291)GAT>GGT	p.D97G	ARL8B_uc011asx.1_Missense_Mutation_p.D88G|ARL8B_uc011asy.1_Missense_Mutation_p.D97G	NM_018184	NP_060654	Q9NVJ2	ARL8B_HUMAN	ADP-ribosylation factor-like 10C	97					cell cycle|cell division|chromosome segregation|small GTPase mediated signal transduction	late endosome membrane|lysosomal membrane|midbody|spindle midzone	alpha-tubulin binding|beta-tubulin binding|GDP binding|GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.0717)|Epithelial(13;0.0777)		TACATGATAGATGCTGCAGAT	0.323													63	77	---	---	---	---	capture	Missense_Mutation	SNP	5214343	5214343	ARL8B	3	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	940	57
ITGA9	3680	broad.mit.edu	37	3	37547525	37547525	+	Silent	SNP	G	A	A	rs145062473		TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:37547525G>A	uc003chd.2	+	7	830	c.777G>A	c.(775-777)CCG>CCA	p.P259P	ITGA9_uc003chc.2_Silent_p.P259P	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	259	Extracellular (Potential).|FG-GAP 4.				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TCTCTCACCCGTCCACCATTG	0.537													10	27	---	---	---	---	capture	Silent	SNP	37547525	37547525	ITGA9	3	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	7806	57
CELSR3	1951	broad.mit.edu	37	3	48679336	48679336	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48679336T>G	uc003cul.2	-	32	9053	c.8772A>C	c.(8770-8772)CAA>CAC	p.Q2924H	CELSR3_uc003cuf.1_Missense_Mutation_p.Q3022H|CELSR3_uc010hkf.2_Missense_Mutation_p.Q214H|CELSR3_uc010hkg.2_Missense_Mutation_p.Q907H	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2924	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGAGTGGCCGTTGGAAGCGCC	0.622													9	13	---	---	---	---	capture	Missense_Mutation	SNP	48679336	48679336	CELSR3	3	T	G	G	G	1	0	0	0	0	1	0	0	0	777	60	4	4	3191	57
MAGI1	9223	broad.mit.edu	37	3	65376868	65376868	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:65376868G>T	uc003dmn.2	-	14	2891	c.2365C>A	c.(2365-2367)CCA>ACA	p.P789T	MAGI1_uc003dmm.2_Missense_Mutation_p.P789T|MAGI1_uc003dmo.2_Missense_Mutation_p.P789T|MAGI1_uc003dmp.2_Missense_Mutation_p.P789T|MAGI1_uc010hnx.1_Missense_Mutation_p.P72T	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	789					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		AAAGGATCTGGTTTTTTCTGG	0.567													61	92	---	---	---	---	capture	Missense_Mutation	SNP	65376868	65376868	MAGI1	3	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	9104	57
HSPBAP1	79663	broad.mit.edu	37	3	122459902	122459902	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122459902A>G	uc003efu.1	-	7	1007	c.884T>C	c.(883-885)CTG>CCG	p.L295P	HSPBAP1_uc003eft.1_Missense_Mutation_p.L6P	NM_024610	NP_078886	Q96EW2	HBAP1_HUMAN	Hspb associated protein 1	295						cytoplasm				ovary(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.0531)		TGCAGTTTTCAGGGCACACAC	0.458													5	192	---	---	---	---	capture	Missense_Mutation	SNP	122459902	122459902	HSPBAP1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	7350	57
YEATS2	55689	broad.mit.edu	37	3	183454552	183454552	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183454552G>A	uc003fly.2	+	8	1054	c.859G>A	c.(859-861)GTC>ATC	p.V287I		NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	287	YEATS.				histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TGAGTTTCCCGTCAGAGTTCA	0.418													95	130	---	---	---	---	capture	Missense_Mutation	SNP	183454552	183454552	YEATS2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17353	57
PDGFRA	5156	broad.mit.edu	37	4	55133562	55133562	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55133562A>G	uc003han.3	+	6	1197	c.866A>G	c.(865-867)GAA>GGA	p.E289G	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.E183G|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	289	Ig-like C2-type 3.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GGAGATTACGAATGTGCTGCC	0.468			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			20	932	---	---	---	---	capture	Missense_Mutation	SNP	55133562	55133562	PDGFRA	4	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	11564	57
KDR	3791	broad.mit.edu	37	4	55955634	55955634	+	Missense_Mutation	SNP	G	A	A	rs138424770		TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55955634G>A	uc003has.2	-	25	3613	c.3311C>T	c.(3310-3312)TCT>TTT	p.S1104F	KDR_uc003hat.1_Missense_Mutation_p.S1104F	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1104	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	AGGATATGGAGAAGCACCTAG	0.393			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			19	925	---	---	---	---	capture	Missense_Mutation	SNP	55955634	55955634	KDR	4	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	8061	57
KIAA1109	84162	broad.mit.edu	37	4	123107257	123107257	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123107257C>T	uc003ieh.2	+	5	470	c.425C>T	c.(424-426)TCG>TTG	p.S142L	KIAA1109_uc003iei.1_5'UTR	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	142					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						TATAATCGCTCGGATCTTTAT	0.358													45	62	---	---	---	---	capture	Missense_Mutation	SNP	123107257	123107257	KIAA1109	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8130	57
ANKRD50	57182	broad.mit.edu	37	4	125593092	125593092	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:125593092A>G	uc003ifg.3	-	3	1606	c.1340T>C	c.(1339-1341)TTA>TCA	p.L447S	ANKRD50_uc011cgo.1_Missense_Mutation_p.L268S|ANKRD50_uc010inw.2_Missense_Mutation_p.L447S	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	447										central_nervous_system(1)	1						CAATGGTGTTAAATTCTTGGC	0.388													111	153	---	---	---	---	capture	Missense_Mutation	SNP	125593092	125593092	ANKRD50	4	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	672	57
SH3D19	152503	broad.mit.edu	37	4	152096196	152096196	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:152096196G>C	uc010ipl.1	-	7	1410	c.320C>G	c.(319-321)CCA>CGA	p.P107R	SH3D19_uc003imc.2_Missense_Mutation_p.P107R|SH3D19_uc003ime.2_Missense_Mutation_p.P107R|SH3D19_uc010ipm.2_Missense_Mutation_p.P107R	NM_001009555	NP_001009555	Q5HYK7	SH319_HUMAN	SH3 domain containing 19 isoform a	107	Pro-rich.				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				GCCAGGGTTTGGTTTCTTTGG	0.537													98	125	---	---	---	---	capture	Missense_Mutation	SNP	152096196	152096196	SH3D19	4	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	14142	57
PCDHA2	56146	broad.mit.edu	37	5	140176220	140176220	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140176220C>T	uc003lhd.2	+	1	1777	c.1671C>T	c.(1669-1671)GAC>GAT	p.D557D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.D557D|PCDHA2_uc011czy.1_Silent_p.D557D	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	557	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGTGCTGGACGAGAACGACA	0.687													54	80	---	---	---	---	capture	Silent	SNP	140176220	140176220	PCDHA2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11427	57
RBM27	54439	broad.mit.edu	37	5	145598558	145598558	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145598558G>A	uc003lnz.3	+	2	236	c.70G>A	c.(70-72)GAT>AAT	p.D24N	RBM27_uc003lny.2_Missense_Mutation_p.D24N	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	24					mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGTGATGCTGATCCTTCAGC	0.333													96	102	---	---	---	---	capture	Missense_Mutation	SNP	145598558	145598558	RBM27	5	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	13022	57
NDST1	3340	broad.mit.edu	37	5	149922522	149922522	+	Silent	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149922522A>G	uc003lsk.3	+	10	2461	c.1959A>G	c.(1957-1959)AAA>AAG	p.K653K	NDST1_uc011dcj.1_Silent_p.K653K	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	653	Heparan sulfate N-sulfotransferase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTATCACAAAGGCATCGACT	0.567													142	195	---	---	---	---	capture	Silent	SNP	149922522	149922522	NDST1	5	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	10162	57
POU5F1	5460	broad.mit.edu	37	6	31133413	31133413	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31133413A>G	uc003nsv.2	-	3	646	c.592T>C	c.(592-594)TGT>CGT	p.C198R	POU5F1_uc003nsu.2_Missense_Mutation_p.C103R|uc011dnf.1_5'Flank	NM_002701	NP_002692	Q01860	PO5F1_HUMAN	POU domain, class 5, transcription factor 1	198	POU-specific.				anatomical structure morphogenesis|blastocyst development|BMP signaling pathway involved in heart induction|cardiac cell fate determination|cell fate commitment involved in formation of primary germ layers|mRNA transcription from RNA polymerase II promoter|negative regulation of gene silencing by miRNA|positive regulation of catenin import into nucleus|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|regulation of asymmetric cell division|regulation of heart induction by regulation of canonical Wnt receptor signaling pathway|regulation of methylation-dependent chromatin silencing|response to wounding|somatic stem cell maintenance|somatic stem cell maintenance	cytosol|nucleoplasm|transcription factor complex	miRNA binding|sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding		EWSR1/POU5F1(10)	skin(7)|salivary_gland(2)|bone(2)|lung(1)|ovary(1)	13						CGCAGCTTACACATGTTCTTG	0.547			T	EWSR1	sarcoma								23	34	---	---	---	---	capture	Missense_Mutation	SNP	31133413	31133413	POU5F1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	12182	57
NEU1	4758	broad.mit.edu	37	6	31829050	31829050	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31829050T>C	uc003nxq.3	-	3	686	c.530A>G	c.(529-531)GAT>GGT	p.D177G	NEU1_uc010jtg.2_RNA|NEU1_uc003nxr.3_RNA|NEU1_uc010jth.2_Missense_Mutation_p.D8G|NEU1_uc003nxs.3_Missense_Mutation_p.D177G	NM_000434	NP_000425	Q99519	NEUR1_HUMAN	neuraminidase precursor	177	BNR 2.					cytoplasmic membrane-bounded vesicle|lysosomal lumen|lysosomal membrane|plasma membrane	exo-alpha-sialidase activity|protein binding			ovary(1)	1					Oseltamivir(DB00198)|Zanamivir(DB00558)	GGAAACACCATCATCCTTGCT	0.532													92	97	---	---	---	---	capture	Missense_Mutation	SNP	31829050	31829050	NEU1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	10248	57
HIVEP2	3097	broad.mit.edu	37	6	143074691	143074691	+	Silent	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:143074691A>G	uc003qjd.2	-	10	7637	c.6894T>C	c.(6892-6894)ACT>ACC	p.T2298T		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	2298					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GAGAGGAGGGAGTGCTAGGTG	0.527													52	85	---	---	---	---	capture	Silent	SNP	143074691	143074691	HIVEP2	6	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	7112	57
T	6862	broad.mit.edu	37	6	166571992	166571992	+	Silent	SNP	G	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:166571992G>T	uc003quu.1	-	9	1612	c.1119C>A	c.(1117-1119)GCC>GCA	p.A373A	T_uc003qut.1_Silent_p.A374A|T_uc003quv.1_Silent_p.A315A	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	373					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GGAAGAACTGGGCCCCCAGCC	0.692									Chordoma_Familial_Clustering_of				19	26	---	---	---	---	capture	Silent	SNP	166571992	166571992	T	6	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	15376	57
MAGI2	9863	broad.mit.edu	37	7	77973153	77973153	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77973153C>T	uc003ugx.2	-	9	1604	c.1350G>A	c.(1348-1350)CTG>CTA	p.L450L	MAGI2_uc003ugy.2_Silent_p.L450L|MAGI2_uc010ldx.1_Silent_p.L59L|MAGI2_uc010ldy.1_Silent_p.L59L|MAGI2_uc011kgr.1_Silent_p.L282L|MAGI2_uc011kgs.1_Silent_p.L287L	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	450	PDZ 2.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TTTTCACCTGCAGAAACTCAT	0.453													48	111	---	---	---	---	capture	Silent	SNP	77973153	77973153	MAGI2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	9105	57
DNAJC2	27000	broad.mit.edu	37	7	102953526	102953526	+	Silent	SNP	A	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102953526A>G	uc003vbo.2	-	16	1910	c.1659T>C	c.(1657-1659)CCT>CCC	p.P553P	PMPCB_uc003vbl.2_3'UTR|PMPCB_uc003vbm.2_3'UTR|PMPCB_uc010liv.2_3'UTR|PMPCB_uc010liw.2_3'UTR|PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_Silent_p.P178P|DNAJC2_uc010lix.2_Silent_p.P500P|DNAJC2_uc003vbp.2_Silent_p.P178P	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	553	SANT 2.				'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1						CTGTTGTCCAAGGGGTGAAGT	0.393													124	319	---	---	---	---	capture	Silent	SNP	102953526	102953526	DNAJC2	7	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	4595	57
RELN	5649	broad.mit.edu	37	7	103281043	103281043	+	Silent	SNP	C	T	T	rs146749232		TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103281043C>T	uc003vca.2	-	17	2176	c.2016G>A	c.(2014-2016)CCG>CCA	p.P672P	RELN_uc010liz.2_Silent_p.P672P	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	672	EGF-like 1.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGAGACATGACGGGCCAATAT	0.368													34	82	---	---	---	---	capture	Silent	SNP	103281043	103281043	RELN	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	13115	57
AGPAT6	137964	broad.mit.edu	37	8	41456786	41456786	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41456786G>A	uc003xnz.2	+	2	1067	c.128G>A	c.(127-129)CGC>CAC	p.R43H		NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta	43					acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			TTTGGTATCCGCAAACTCTAC	0.433													5	236	---	---	---	---	capture	Missense_Mutation	SNP	41456786	41456786	AGPAT6	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	391	57
EYA1	2138	broad.mit.edu	37	8	72127864	72127864	+	Missense_Mutation	SNP	G	A	A	rs139717960	byFrequency	TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:72127864G>A	uc003xys.3	-	14	1747	c.1460C>T	c.(1459-1461)TCG>TTG	p.S487L	EYA1_uc003xyr.3_Missense_Mutation_p.S452L|EYA1_uc003xyt.3_Missense_Mutation_p.S454L|EYA1_uc010lzf.2_Missense_Mutation_p.S414L|EYA1_uc003xyu.2_Missense_Mutation_p.S487L|EYA1_uc011lfe.1_Missense_Mutation_p.S481L|EYA1_uc003xyv.2_Missense_Mutation_p.S365L	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b	487			S -> P (in BOR1).		double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	p.S487L(1)		ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GTGAATGAGCGAGAGTGCTTT	0.532													79	119	---	---	---	---	capture	Missense_Mutation	SNP	72127864	72127864	EYA1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5283	57
FAM83H	286077	broad.mit.edu	37	8	144808129	144808129	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144808129C>T	uc003yzk.2	-	5	3571	c.3502G>A	c.(3502-3504)GTG>ATG	p.V1168M	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	1168					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ATCTTGGGCACGAACTTGCCC	0.647													21	34	---	---	---	---	capture	Missense_Mutation	SNP	144808129	144808129	FAM83H	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5586	57
KIAA1432	57589	broad.mit.edu	37	9	5765489	5765489	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5765489G>A	uc003zji.2	+	19	2773	c.2680G>A	c.(2680-2682)GAC>AAC	p.D894N	KIAA1432_uc003zjh.2_Missense_Mutation_p.D894N|KIAA1432_uc003zjl.3_Missense_Mutation_p.D857N|KIAA1432_uc003zjj.1_Missense_Mutation_p.D436N|ERMP1_uc011lme.1_RNA	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	973						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		AGGCAAGTGGGACCTTTGTCG	0.448													99	159	---	---	---	---	capture	Missense_Mutation	SNP	5765489	5765489	KIAA1432	9	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	8155	57
TESK1	7016	broad.mit.edu	37	9	35608190	35608190	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35608190C>G	uc003zxa.2	+	8	1165	c.829C>G	c.(829-831)CTG>GTG	p.L277V	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Missense_Mutation_p.L117V	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	277	Protein kinase.				cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTTCCGAACTCTGGTGGGGGA	0.597													26	85	---	---	---	---	capture	Missense_Mutation	SNP	35608190	35608190	TESK1	9	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	15652	57
OR13C8	138802	broad.mit.edu	37	9	107332367	107332367	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107332367G>T	uc011lvo.1	+	1	919	c.919G>T	c.(919-921)GTC>TTC	p.V307F		NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C,	307	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AAAGGCTGCTGTCAAAAACAT	0.373													7	141	---	---	---	---	capture	Missense_Mutation	SNP	107332367	107332367	OR13C8	9	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	10842	57
ASS1	445	broad.mit.edu	37	9	133364801	133364801	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133364801G>A	uc004bzm.2	+	13	1276	c.920G>A	c.(919-921)CGC>CAC	p.R307H	ASS1_uc004bzn.2_Missense_Mutation_p.R307H|ASS1_uc010mza.2_Missense_Mutation_p.R383H|ASS1_uc004bzo.2_Missense_Mutation_p.R288H|ASS1_uc010mzb.2_Missense_Mutation_p.R345H|ASS1_uc004bzp.2_Missense_Mutation_p.R307H|ASS1_uc010mzc.2_Missense_Mutation_p.R307H	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1	307			R -> C (in CTLN1).		arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	CGGGAAGTGCGCAAAATCAAA	0.532													6	346	---	---	---	---	capture	Missense_Mutation	SNP	133364801	133364801	ASS1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1052	57
MAGEB4	4115	broad.mit.edu	37	X	30260976	30260976	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30260976C>T	uc004dcb.2	+	1	808	c.724C>T	c.(724-726)CGA>TGA	p.R242*	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	242	MAGE.									ovary(1)	1						TGGGGAACCCCGAAAGCTCAT	0.488													52	67	---	---	---	---	capture	Nonsense_Mutation	SNP	30260976	30260976	MAGEB4	23	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	9092	57
TAB3	257397	broad.mit.edu	37	X	30872355	30872355	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30872355C>T	uc004dcj.2	-	6	2090	c.1427G>A	c.(1426-1428)CGC>CAC	p.R476H	TAB3_uc004dck.2_Missense_Mutation_p.R476H|TAB3_uc010ngl.2_Missense_Mutation_p.R476H	NM_152787	NP_690000	Q8N5C8	TAB3_HUMAN	mitogen-activated protein kinase kinase kinase 7	476					activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein binding|zinc ion binding			ovary(1)	1						TGCTGCAGAGCGCTCTTCTTG	0.443													74	98	---	---	---	---	capture	Missense_Mutation	SNP	30872355	30872355	TAB3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15385	57
RGN	9104	broad.mit.edu	37	X	46951551	46951551	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46951551C>G	uc004dgz.1	+	7	1755	c.786C>G	c.(784-786)TGC>TGG	p.C262W	RGN_uc004dha.1_Missense_Mutation_p.C262W|RGN_uc010nho.1_Missense_Mutation_p.C209W|RGN_uc010nhp.1_Missense_Mutation_p.C190W	NM_152869	NP_690608	Q15493	RGN_HUMAN	regucalcin	262					cellular calcium ion homeostasis|positive regulation of ATPase activity|regulation of calcium-mediated signaling	cytoplasm|nucleus	calcium ion binding|enzyme regulator activity|gluconolactonase activity|zinc ion binding				0						ATGTGACCTGCGCCCGGGATG	0.468													14	25	---	---	---	---	capture	Missense_Mutation	SNP	46951551	46951551	RGN	23	C	G	G	G	1	0	0	0	0	1	0	0	0	350	27	4	4	13177	57
USP11	8237	broad.mit.edu	37	X	47098522	47098522	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47098522G>A	uc004dhp.2	+	2	359	c.359G>A	c.(358-360)GGG>GAG	p.G120E	USP11_uc004dhq.2_5'UTR	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	120	DUSP.				protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						GTGCAGGGAGGGGACCAGGAC	0.557													23	41	---	---	---	---	capture	Missense_Mutation	SNP	47098522	47098522	USP11	23	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16924	57
KLF8	11279	broad.mit.edu	37	X	56291902	56291902	+	Missense_Mutation	SNP	C	A	A	rs143280924		TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:56291902C>A	uc004dur.2	+	3	1317	c.371C>A	c.(370-372)ACG>AAG	p.T124K	KLF8_uc010nkg.2_Missense_Mutation_p.T119K|KLF8_uc011mop.1_Missense_Mutation_p.T124K|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	124					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GTGGTGTCCACGTCAACATCT	0.542													46	67	---	---	---	---	capture	Missense_Mutation	SNP	56291902	56291902	KLF8	23	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	8272	57
UBQLN2	29978	broad.mit.edu	37	X	56592046	56592046	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:56592046C>T	uc004dus.2	+	1	1975	c.1740C>T	c.(1738-1740)GTC>GTT	p.V580V	UBQLN2_uc011moq.1_Silent_p.V468V	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	580						cytoplasm|nucleus|plasma membrane	binding			ovary(1)|skin(1)	2						ATCCAGAAGTCAGATTTCAGC	0.512													27	32	---	---	---	---	capture	Silent	SNP	56592046	56592046	UBQLN2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	16779	57
MTMR8	55613	broad.mit.edu	37	X	63445208	63445208	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:63445208G>A	uc011mou.1	-	10	1516	c.1448C>T	c.(1447-1449)ACG>ATG	p.T483M	ASB12_uc004dvp.1_Missense_Mutation_p.T99M|ASB12_uc004dvq.1_Missense_Mutation_p.T108M|ASB12_uc004dvr.1_Missense_Mutation_p.T108M	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	Error:Variant_position_missing_in_Q96EF0_after_alignment						nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						GAAAAGTGGCGTCTGTGCCTT	0.517													21	28	---	---	---	---	capture	Missense_Mutation	SNP	63445208	63445208	MTMR8	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9859	57
KIF4A	24137	broad.mit.edu	37	X	69595167	69595167	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69595167G>A	uc004dyg.2	+	17	2019	c.1892G>A	c.(1891-1893)CGT>CAT	p.R631H	KIF4A_uc010nkw.2_Missense_Mutation_p.R631H|KIF4A_uc004dyf.1_Missense_Mutation_p.R631H	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	631	Potential.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						TCCACAGAGCGTACTGTCTCC	0.423													65	96	---	---	---	---	capture	Missense_Mutation	SNP	69595167	69595167	KIF4A	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8225	57
ATRX	546	broad.mit.edu	37	X	76937238	76937238	+	Silent	SNP	T	C	C			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76937238T>C	uc004ecp.3	-	9	3742	c.3510A>G	c.(3508-3510)CAA>CAG	p.Q1170Q	ATRX_uc004ecq.3_Silent_p.Q1132Q|ATRX_uc004eco.3_Silent_p.Q955Q|ATRX_uc004ecr.2_Silent_p.Q1102Q|ATRX_uc010nlx.1_Silent_p.Q1141Q|ATRX_uc010nly.1_Silent_p.Q1115Q	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1170					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	ATGAAGTTCTTTGCTTCTTCT	0.348			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						125	127	---	---	---	---	capture	Silent	SNP	76937238	76937238	ATRX	23	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	1199	57
GPR174	84636	broad.mit.edu	37	X	78427380	78427380	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78427380C>T	uc004edg.1	+	1	912	c.876C>T	c.(874-876)TAC>TAT	p.Y292Y		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	292	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						CAGTCATATACTACTTTTCCA	0.398										HNSCC(63;0.18)			76	114	---	---	---	---	capture	Silent	SNP	78427380	78427380	GPR174	23	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	6606	57
COL4A6	1288	broad.mit.edu	37	X	107412771	107412771	+	Silent	SNP	G	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107412771G>A	uc004enw.3	-	37	3751	c.3648C>T	c.(3646-3648)ATC>ATT	p.I1216I	COL4A6_uc004env.3_Silent_p.I1215I|COL4A6_uc011msn.1_Silent_p.I1191I|COL4A6_uc010npk.2_Silent_p.I1191I	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1216	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CTGGAGCTCCGATGCCAATTC	0.577									Alport_syndrome_with_Diffuse_Leiomyomatosis				57	71	---	---	---	---	capture	Silent	SNP	107412771	107412771	COL4A6	23	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	3660	57
SLC9A6	10479	broad.mit.edu	37	X	135081058	135081058	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135081058C>T	uc004ezj.2	+	5	704	c.628C>T	c.(628-630)CAA>TAA	p.Q210*	SLC9A6_uc004ezk.2_Nonsense_Mutation_p.Q242*|SLC9A6_uc011mvx.1_Nonsense_Mutation_p.Q190*	NM_006359	NP_006350	Q92581	SL9A6_HUMAN	solute carrier family 9 (sodium/hydrogen	210					regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GGTAACGGGACAACTTGCAGG	0.353													101	154	---	---	---	---	capture	Nonsense_Mutation	SNP	135081058	135081058	SLC9A6	23	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	5	2	14610	57
PLXNB3	5365	broad.mit.edu	37	X	153033730	153033730	+	Silent	SNP	C	T	T			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153033730C>T	uc004fii.2	+	4	1287	c.1113C>T	c.(1111-1113)GGC>GGT	p.G371G	PLXNB3_uc011mzb.1_Intron|PLXNB3_uc011mzc.1_Silent_p.G53G|PLXNB3_uc010nuk.2_Silent_p.G394G|PLXNB3_uc011mzd.1_Silent_p.G10G	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	371	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCCCTGTGGCGACGAGCACA	0.687													54	75	---	---	---	---	capture	Silent	SNP	153033730	153033730	PLXNB3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12028	57
NR1I3	9970	broad.mit.edu	37	1	161202999	161203000	+	Frame_Shift_Ins	INS	-	G	G	rs139473535	by1000genomes	TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161202999_161203000insG	uc001fzx.2	-	4	570_571	c.367_368insC	c.(367-369)CGCfs	p.R123fs	TOMM40L_uc009wuf.1_Intron|NR1I3_uc001fzf.2_Frame_Shift_Ins_p.R123fs|NR1I3_uc001fzg.2_Frame_Shift_Ins_p.R94fs|NR1I3_uc001fzh.2_Frame_Shift_Ins_p.R94fs|NR1I3_uc001fzi.2_Frame_Shift_Ins_p.R94fs|NR1I3_uc001fzj.2_Frame_Shift_Ins_p.R94fs|NR1I3_uc001fzk.2_Frame_Shift_Ins_p.R94fs|NR1I3_uc001fzl.2_Frame_Shift_Ins_p.R94fs|NR1I3_uc001fzm.2_Frame_Shift_Ins_p.R48fs|NR1I3_uc001fzn.2_Intron|NR1I3_uc009wug.2_Intron|NR1I3_uc001fzp.2_Frame_Shift_Ins_p.R123fs|NR1I3_uc001fzo.2_Intron|NR1I3_uc001fzq.2_Intron|NR1I3_uc001fzr.2_Intron|NR1I3_uc001fzs.2_Intron|NR1I3_uc001fzt.2_Intron|NR1I3_uc001fzu.2_Intron|NR1I3_uc001fzv.2_Intron|NR1I3_uc001fzw.2_Frame_Shift_Ins_p.R123fs|NR1I3_uc001fzy.2_Frame_Shift_Ins_p.R123fs|NR1I3_uc001fzz.2_Frame_Shift_Ins_p.R123fs|NR1I3_uc001gaa.2_Frame_Shift_Ins_p.R123fs|NR1I3_uc001gab.2_Frame_Shift_Ins_p.R123fs|NR1I3_uc001gac.2_Frame_Shift_Ins_p.R94fs|NR1I3_uc010pkm.1_Frame_Shift_Ins_p.R94fs|NR1I3_uc010pkn.1_Frame_Shift_Ins_p.R123fs	NM_001077480	NP_001070948	Q14994	NR1I3_HUMAN	constitutive androstane receptor isoform 2	123					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	androgen receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(1)|skin(1)	2	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GCCCATGTGGCGGGTGTGGGCC	0.564													7	445	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	161202999	161203000	NR1I3	1	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	10528	57
PCDH17	27253	broad.mit.edu	37	13	58207302	58207303	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:58207302_58207303insA	uc001vhq.1	+	1	1514_1515	c.622_623insA	c.(622-624)CACfs	p.H208fs	PCDH17_uc010aec.1_Frame_Shift_Ins_p.H208fs	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	208	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GCAACAGAATCACCATACGCTC	0.599													31	60	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	58207302	58207303	PCDH17	13	-	A	A	A	1	0	1	1	0	0	0	0	0	377	29	5	5	11415	57
L3MBTL	26013	broad.mit.edu	37	20	42163558	42163558	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42163558delG	uc010zwh.1	+	16	1781	c.1735delG	c.(1735-1737)GGAfs	p.G579fs	L3MBTL_uc002xkl.2_Frame_Shift_Del_p.G511fs|L3MBTL_uc002xkm.2_Frame_Shift_Del_p.G511fs|L3MBTL_uc010ggl.2_Frame_Shift_Del_p.G511fs|L3MBTL_uc002xkn.1_Frame_Shift_Del_p.G270fs|L3MBTL_uc002xko.2_Frame_Shift_Del_p.G163fs	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	511	MBT 3.				chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTCCAAGACAGGACATCCCCT	0.557													14	35	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	42163558	42163558	L3MBTL	20	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	8511	57
CNOT4	4850	broad.mit.edu	37	7	135047676	135047676	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0241-01	TCGA-06-0241-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:135047676delG	uc011kpy.1	-	11	2195	c.2103delC	c.(2101-2103)CCCfs	p.P701fs	CNOT4_uc003vss.2_Frame_Shift_Del_p.P627fs|CNOT4_uc011kpz.1_Frame_Shift_Del_p.P698fs|CNOT4_uc003vst.2_Frame_Shift_Del_p.P630fs	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	370					nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0						GTAAATCTGTGGGGGTTTTGC	0.527													169	615	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	135047676	135047676	CNOT4	7	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	6	5	3586	57
