Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DBT	1629	broad.mit.edu	37	1	100706430	100706430	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:100706430C>T	uc001dta.2	-	2	95	c.62G>A	c.(61-63)CGC>CAC	p.R21H	DBT_uc010oug.1_5'UTR	NM_001918	NP_001909	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase	21					branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		TTGAAAATAGCGAACACAAAT	0.313													56	93	---	---	---	---	capture	Missense_Mutation	SNP	100706430	100706430	DBT	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4217	61
ANP32E	81611	broad.mit.edu	37	1	150202934	150202934	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150202934A>G	uc001etw.2	-	3	669	c.299T>C	c.(298-300)ATA>ACA	p.I100T	ANP32E_uc010pbu.1_Missense_Mutation_p.I52T|ANP32E_uc010pbv.1_Intron|ANP32E_uc001etv.3_Missense_Mutation_p.I100T|ANP32E_uc010pbw.1_Missense_Mutation_p.I100T	NM_030920	NP_112182	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32	100	LRR 4.					cytoplasmic membrane-bounded vesicle|nucleus	phosphatase inhibitor activity				0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGATCTTTTATTTTGTTTCC	0.363													65	83	---	---	---	---	capture	Missense_Mutation	SNP	150202934	150202934	ANP32E	1	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	703	61
HMCN1	83872	broad.mit.edu	37	1	186084452	186084452	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186084452C>T	uc001grq.1	+	75	11696	c.11467C>T	c.(11467-11469)CTG>TTG	p.L3823L		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3823	Ig-like C2-type 37.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TCAAACTACTCTGGCTTGTGA	0.398													6	215	---	---	---	---	capture	Silent	SNP	186084452	186084452	HMCN1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	7145	61
SMYD2	56950	broad.mit.edu	37	1	214505455	214505455	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214505455C>A	uc010ptx.1	+	10	1065	c.1032C>A	c.(1030-1032)TAC>TAA	p.Y344*	SMYD2_uc009xdj.2_3'UTR|SMYD2_uc010ptw.1_RNA|SMYD2_uc009xdl.1_Intron	NM_020197	NP_064582	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	344					negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		ACATGATGTACCAGGCCATGG	0.517											OREG0012979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	59	---	---	---	---	capture	Nonsense_Mutation	SNP	214505455	214505455	SMYD2	1	C	A	A	A	1	0	0	0	0	0	1	0	0	233	18	5	4	14714	61
SLC39A12	221074	broad.mit.edu	37	10	18270258	18270258	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:18270258G>A	uc001ipo.2	+	6	1215	c.942G>A	c.(940-942)AGG>AGA	p.R314R	SLC39A12_uc001ipn.2_Silent_p.R314R|SLC39A12_uc001ipp.2_Silent_p.R314R|SLC39A12_uc010qck.1_Silent_p.R180R	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	314	Cytoplasmic (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TCTCTGCTAGGCAGCTGGTGG	0.448													59	13	---	---	---	---	capture	Silent	SNP	18270258	18270258	SLC39A12	10	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	14507	61
FAM196A	642938	broad.mit.edu	37	10	128973691	128973691	+	Silent	SNP	C	T	T	rs139302074	byFrequency	TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:128973691C>T	uc001lju.1	-	1	1010	c.969G>A	c.(967-969)TCG>TCA	p.S323S	DOCK1_uc001ljt.2_Intron|DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Silent_p.S323S|FAM196A_uc001ljv.1_Silent_p.S323S|FAM196A_uc009yap.1_Silent_p.S323S	NM_001039762	NP_001034851	Q6ZSG2	F196A_HUMAN	hypothetical protein LOC642938	323										ovary(2)	2						TGTGAGTCTGCGACGGCTGCT	0.642													71	26	---	---	---	---	capture	Silent	SNP	128973691	128973691	FAM196A	10	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5480	61
MRPL23	6150	broad.mit.edu	37	11	1973439	1973439	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1973439G>C	uc001lux.2	+	3	314	c.223G>C	c.(223-225)GGC>CGC	p.G75R		NM_021134	NP_066957	Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	75					translation	mitochondrial large ribosomal subunit	nucleotide binding|RNA binding|structural constituent of ribosome			large_intestine(2)|ovary(1)	3		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)		GGTGCAGCATGGTGAGTGCCC	0.602													31	36	---	---	---	---	capture	Missense_Mutation	SNP	1973439	1973439	MRPL23	11	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	9699	61
ANO5	203859	broad.mit.edu	37	11	22239813	22239813	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22239813T>G	uc001mqi.2	+	4	477	c.160T>G	c.(160-162)TTC>GTC	p.F54V	ANO5_uc001mqj.2_Missense_Mutation_p.F53V	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	54	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						ATTCAATTTGTTCCTGAGGCG	0.403													49	78	---	---	---	---	capture	Missense_Mutation	SNP	22239813	22239813	ANO5	11	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	694	61
OR5D16	390144	broad.mit.edu	37	11	55606889	55606889	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606889C>A	uc010rio.1	+	1	662	c.662C>A	c.(661-663)GCA>GAA	p.A221E		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				ACATCTTATGCATTCATCATT	0.468													86	122	---	---	---	---	capture	Missense_Mutation	SNP	55606889	55606889	OR5D16	11	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	11060	61
OR5D16	390144	broad.mit.edu	37	11	55606937	55606937	+	Missense_Mutation	SNP	G	A	A	rs148616685		TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606937G>A	uc010rio.1	+	1	710	c.710G>A	c.(709-711)CGC>CAC	p.R237H		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				AGTGGGCACCGCAAAGTCTTC	0.488													4	168	---	---	---	---	capture	Missense_Mutation	SNP	55606937	55606937	OR5D16	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11060	61
OR5M3	219482	broad.mit.edu	37	11	56237927	56237927	+	Missense_Mutation	SNP	G	A	A	rs147367874	byFrequency	TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56237927G>A	uc010rjk.1	-	1	47	c.47C>T	c.(46-48)ACG>ATG	p.T16M		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					TCGACGGCTCGTTAGCCCCAA	0.383													46	53	---	---	---	---	capture	Missense_Mutation	SNP	56237927	56237927	OR5M3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11079	61
ANO1	55107	broad.mit.edu	37	11	69949227	69949227	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:69949227G>A	uc001opj.2	+	3	802	c.497G>A	c.(496-498)TGC>TAC	p.C166Y	ANO1_uc001opk.1_Missense_Mutation_p.C138Y|ANO1_uc001opl.1_RNA	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	166	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						AACGTGCTGTGCAGAGAGGCC	0.532													8	19	---	---	---	---	capture	Missense_Mutation	SNP	69949227	69949227	ANO1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	689	61
PAAF1	80227	broad.mit.edu	37	11	73627614	73627614	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:73627614G>A	uc001ouk.1	+	9	878	c.844G>A	c.(844-846)GCT>ACT	p.A282T	PAAF1_uc001oul.1_Missense_Mutation_p.A265T|PAAF1_uc009ytx.1_RNA|PAAF1_uc001oum.1_Missense_Mutation_p.A265T|PAAF1_uc001oun.1_5'Flank	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	282	WD 4.				interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)|skin(1)	2	Breast(11;7.42e-05)					TGGCTCAGACGCTTTCAACTG	0.423													38	47	---	---	---	---	capture	Missense_Mutation	SNP	73627614	73627614	PAAF1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11266	61
XRRA1	143570	broad.mit.edu	37	11	74559419	74559419	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74559419A>G	uc009yub.2	-	15	1777	c.1445T>C	c.(1444-1446)ATG>ACG	p.M482T	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovn.2_Missense_Mutation_p.M105T|XRRA1_uc001ovo.2_Missense_Mutation_p.M90T|XRRA1_uc001ovq.3_Missense_Mutation_p.M395T|XRRA1_uc001ovp.3_Missense_Mutation_p.M207T|XRRA1_uc001ovr.2_Missense_Mutation_p.M105T|XRRA1_uc001ovs.1_Missense_Mutation_p.M84T	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	482					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						TGGCTCTAGCATATCCTTTGA	0.552													32	32	---	---	---	---	capture	Missense_Mutation	SNP	74559419	74559419	XRRA1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	17342	61
ADAMTS8	11095	broad.mit.edu	37	11	130281492	130281492	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130281492C>T	uc001qgg.3	-	6	1928	c.1570G>A	c.(1570-1572)GTG>ATG	p.V524M	ADAMTS8_uc001qgf.2_Missense_Mutation_p.V5M	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	524	Disintegrin.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CCATCTGCCACGGGCTGCAAC	0.577													39	47	---	---	---	---	capture	Missense_Mutation	SNP	130281492	130281492	ADAMTS8	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	272	61
KRT4	3851	broad.mit.edu	37	12	53208029	53208029	+	Silent	SNP	G	A	A	rs143824965	by1000genomes	TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53208029G>A	uc001saz.2	-	1	307	c.36C>T	c.(34-36)AAC>AAT	p.N12N		NM_002272	NP_002263	B4DRS2	B4DRS2_HUMAN	keratin 4	Error:Variant_position_missing_in_B4DRS2_after_alignment						keratin filament	structural molecule activity			ovary(4)|skin(2)	6						TCCCGCACCCGTTGAGCATGT	0.542													44	60	---	---	---	---	capture	Silent	SNP	53208029	53208029	KRT4	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8397	61
MYO1A	4640	broad.mit.edu	37	12	57432332	57432332	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57432332G>A	uc001smw.3	-	17	1867	c.1624C>T	c.(1624-1626)CTC>TTC	p.L542F	MYO1A_uc010sqz.1_Missense_Mutation_p.L380F|MYO1A_uc009zpd.2_Missense_Mutation_p.L542F	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA	542	Myosin head-like.				sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						GACCGAAGGAGGGGGTGCTGG	0.537													5	164	---	---	---	---	capture	Missense_Mutation	SNP	57432332	57432332	MYO1A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9978	61
C12orf66	144577	broad.mit.edu	37	12	64588399	64588399	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:64588399G>A	uc001srw.3	-	3	620	c.561C>T	c.(559-561)TTC>TTT	p.F187F	C12orf66_uc009zql.2_Silent_p.F134F	NM_152440	NP_689653	Q96MD2	CL066_HUMAN	hypothetical protein LOC144577	187										ovary(1)	1						CTTCCAGCTGGAAACTGCTTT	0.478													38	51	---	---	---	---	capture	Silent	SNP	64588399	64588399	C12orf66	12	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	1695	61
KSR2	283455	broad.mit.edu	37	12	118016952	118016952	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118016952G>A	uc001two.2	-	7	1265	c.1210C>T	c.(1210-1212)CTT>TTT	p.L404F		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	433	Phorbol-ester/DAG-type.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity	p.L465F(1)		lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGCCAAAAAGCATCCCTTTC	0.478													11	16	---	---	---	---	capture	Missense_Mutation	SNP	118016952	118016952	KSR2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	8502	61
CCDC60	160777	broad.mit.edu	37	12	119866567	119866567	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:119866567G>A	uc001txe.2	+	2	635	c.170G>A	c.(169-171)CGC>CAC	p.R57H	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	57										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		ATACGAAGCCGGTGAGTGAGC	0.502													10	17	---	---	---	---	capture	Missense_Mutation	SNP	119866567	119866567	CCDC60	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2805	61
GPR133	283383	broad.mit.edu	37	12	131487816	131487816	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:131487816G>T	uc001uit.3	+	10	1672	c.1113G>T	c.(1111-1113)CAG>CAT	p.Q371H	GPR133_uc010tbm.1_Missense_Mutation_p.Q403H	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	371	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GCACGCCCCAGGTCACCGTGG	0.617													69	84	---	---	---	---	capture	Missense_Mutation	SNP	131487816	131487816	GPR133	12	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	6577	61
DCLK1	9201	broad.mit.edu	37	13	36428681	36428681	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:36428681C>T	uc001uvf.2	-	6	1223	c.990G>A	c.(988-990)TCG>TCA	p.S330S	DCLK1_uc001uve.3_Silent_p.S23S|DCLK1_uc010teh.1_Silent_p.S23S|DCLK1_uc010abk.2_Silent_p.S23S|DCLK1_uc001uvh.3_RNA	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	330	Pro/Ser-rich.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		ATGGGCTTGGCGACTTGCCTG	0.493													10	103	---	---	---	---	capture	Silent	SNP	36428681	36428681	DCLK1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4250	61
GRK1	6011	broad.mit.edu	37	13	114321752	114321752	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114321752C>T	uc010tkf.1	+	1	159	c.51C>T	c.(49-51)GCC>GCT	p.A17A		NM_002929	NP_002920	Q15835	RK_HUMAN	rhodopsin kinase precursor	17	N-terminal.				regulation of G-protein coupled receptor protein signaling pathway|rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|rhodopsin kinase activity|signal transducer activity			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			CCTTCATCGCCGCCCGAGGCA	0.647													6	10	---	---	---	---	capture	Silent	SNP	114321752	114321752	GRK1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6723	61
SCFD1	23256	broad.mit.edu	37	14	31139520	31139520	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31139520C>G	uc001wqm.1	+	11	938	c.914C>G	c.(913-915)GCT>GGT	p.A305G	SCFD1_uc001wqn.1_Missense_Mutation_p.A238G|SCFD1_uc010tpg.1_Missense_Mutation_p.A246G|SCFD1_uc010tph.1_Missense_Mutation_p.A120G|SCFD1_uc010amf.1_Missense_Mutation_p.A120G|SCFD1_uc010tpi.1_Missense_Mutation_p.A213G|SCFD1_uc010amd.1_Missense_Mutation_p.A137G|SCFD1_uc010ame.1_Missense_Mutation_p.A238G	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a	305					post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		AACTCTCCAGCTGGTGCTAGA	0.328													15	218	---	---	---	---	capture	Missense_Mutation	SNP	31139520	31139520	SCFD1	14	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	13781	61
FANCM	57697	broad.mit.edu	37	14	45665510	45665510	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:45665510G>A	uc001wwd.3	+	21	5575	c.5476G>A	c.(5476-5478)GAA>AAA	p.E1826K	FANCM_uc010anf.2_Missense_Mutation_p.E1800K|FANCM_uc001wwe.3_Missense_Mutation_p.E1362K|FANCM_uc010ang.2_Missense_Mutation_p.E1075K	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1826	Interaction with FAAP24 and EME1.				DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						AGGTGGTCATGAAATCACTTC	0.418								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	229	---	---	---	---	capture	Missense_Mutation	SNP	45665510	45665510	FANCM	14	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	5617	61
ESR2	2100	broad.mit.edu	37	14	64727172	64727172	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64727172A>T	uc001xha.1	-	5	1415	c.947T>A	c.(946-948)ATT>AAT	p.I316N	ESR2_uc001xgu.2_Missense_Mutation_p.I316N|ESR2_uc001xgv.2_Missense_Mutation_p.I316N|ESR2_uc001xgw.2_RNA|ESR2_uc001xgx.2_Missense_Mutation_p.I316N|ESR2_uc001xgy.1_Missense_Mutation_p.I316N|ESR2_uc001xgz.1_Missense_Mutation_p.I316N|ESR2_uc010aqb.1_RNA|ESR2_uc010aqc.1_Missense_Mutation_p.I316N|ESR2_uc010aqd.1_RNA	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	316	Steroid-binding.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CCTACCGGGAATCTTCTTGGC	0.398													6	302	---	---	---	---	capture	Missense_Mutation	SNP	64727172	64727172	ESR2	14	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	5212	61
SERPINA6	866	broad.mit.edu	37	14	94780400	94780400	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94780400C>T	uc001ycv.2	-	2	690	c.586G>A	c.(586-588)GTC>ATC	p.V196I	SERPINA6_uc010auv.2_RNA	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	196					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	TTGACCAGGACGAGGATGGCT	0.502													55	74	---	---	---	---	capture	Missense_Mutation	SNP	94780400	94780400	SERPINA6	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13986	61
AHNAK2	113146	broad.mit.edu	37	14	105410846	105410846	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105410846A>G	uc010axc.1	-	7	11062	c.10942T>C	c.(10942-10944)TTC>CTC	p.F3648L	AHNAK2_uc001ypx.2_Missense_Mutation_p.F3548L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3648						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GATACCCTGAATGACGGCATC	0.592													131	204	---	---	---	---	capture	Missense_Mutation	SNP	105410846	105410846	AHNAK2	14	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	415	61
AHNAK2	113146	broad.mit.edu	37	14	105417866	105417866	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105417866C>T	uc010axc.1	-	7	4042	c.3922G>A	c.(3922-3924)GCA>ACA	p.A1308T	AHNAK2_uc001ypx.2_Missense_Mutation_p.A1208T	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1308						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCAGCTGTGCGCCATCCAAC	0.597													5	273	---	---	---	---	capture	Missense_Mutation	SNP	105417866	105417866	AHNAK2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	415	61
DUOX2	50506	broad.mit.edu	37	15	45392270	45392270	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45392270G>A	uc010bea.2	-	24	3365	c.3162C>T	c.(3160-3162)GGC>GGT	p.G1054G	DUOX2_uc001zun.2_Silent_p.G1054G	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	1054	Interaction with TXNDC11 (By similarity).|Helical; (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CTGCAAACACGCCAACACAGA	0.562													48	15	---	---	---	---	capture	Silent	SNP	45392270	45392270	DUOX2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4756	61
SYNM	23336	broad.mit.edu	37	15	99670079	99670079	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99670079C>T	uc002bup.2	+	6	1634	c.1514C>T	c.(1513-1515)ACG>ATG	p.T505M	SYNM_uc002buo.2_Missense_Mutation_p.T505M|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	505	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						GTGAAAGCCACGAGGGAGCAA	0.488													5	16	---	---	---	---	capture	Missense_Mutation	SNP	99670079	99670079	SYNM	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15343	61
LRRK1	79705	broad.mit.edu	37	15	101586198	101586198	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101586198C>T	uc002bwr.2	+	21	3295	c.2976C>T	c.(2974-2976)CCC>CCT	p.P992P	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	992					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACCTCCTGCCCCATCTCCTTC	0.592													66	56	---	---	---	---	capture	Silent	SNP	101586198	101586198	LRRK1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	8947	61
OR3A2	4995	broad.mit.edu	37	17	3181738	3181738	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3181738G>A	uc002fvg.2	-	1	531	c.492C>T	c.(490-492)AAC>AAT	p.N164N		NM_002551	NP_002542	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A,	164	Helical; Name=4; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						GGGTCAGTGCGTTGGTGAAGG	0.582													76	100	---	---	---	---	capture	Silent	SNP	3181738	3181738	OR3A2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10942	61
DNAH2	146754	broad.mit.edu	37	17	7736507	7736507	+	Missense_Mutation	SNP	G	A	A	rs145226741		TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7736507G>A	uc002giu.1	+	84	13111	c.13097G>A	c.(13096-13098)CGG>CAG	p.R4366Q		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	4366					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ATCCACTTCCGGCCTGCAGAG	0.622													8	66	---	---	---	---	capture	Missense_Mutation	SNP	7736507	7736507	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4559	61
MLLT6	4302	broad.mit.edu	37	17	36873166	36873166	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36873166C>T	uc002hqi.3	+	10	1596	c.1583C>T	c.(1582-1584)TCC>TTC	p.S528F	MLLT6_uc002hqj.2_Intron|MLLT6_uc002hqk.3_5'Flank	NM_005937	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	528					regulation of transcription, DNA-dependent	nucleus	protein binding|zinc ion binding			breast(3)|prostate(1)|lung(1)|skin(1)	6	Breast(7;4.43e-21)					GGAGGTCTGTCCTCCCGAACC	0.637			T	MLL	AL								19	41	---	---	---	---	capture	Missense_Mutation	SNP	36873166	36873166	MLLT6	17	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9542	61
OR4D2	124538	broad.mit.edu	37	17	56247707	56247707	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56247707G>A	uc010wnp.1	+	1	691	c.691G>A	c.(691-693)GAG>AAG	p.E231K		NM_001004707	NP_001004707	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						ACATCCAGGGGAGGCAAGAAG	0.537													61	70	---	---	---	---	capture	Missense_Mutation	SNP	56247707	56247707	OR4D2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10960	61
C18orf45	85019	broad.mit.edu	37	18	20979531	20979531	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:20979531A>T	uc002kuf.2	-	4	387	c.278T>A	c.(277-279)CTG>CAG	p.L93Q	C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_RNA|C18orf45_uc002kug.2_RNA|C18orf45_uc002kuh.2_RNA	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019	93	Helical; (Potential).					integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					AATACTTACCAGTCTGGACAA	0.443													8	53	---	---	---	---	capture	Missense_Mutation	SNP	20979531	20979531	C18orf45	18	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	1887	61
LGALS13	29124	broad.mit.edu	37	19	40095888	40095888	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40095888C>T	uc002omb.2	+	3	203	c.163C>T	c.(163-165)CGA>TGA	p.R55*		NM_013268	NP_037400	Q9UHV8	PP13_HUMAN	galectin-13	55	Galectin.				lipid catabolic process|phospholipid metabolic process		carboxylesterase activity|lysophospholipase activity|sugar binding			ovary(1)	1	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			CTTCCGTTTCCGAGTGCACTT	0.498													20	64	---	---	---	---	capture	Nonsense_Mutation	SNP	40095888	40095888	LGALS13	19	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	8660	61
CEACAM7	1087	broad.mit.edu	37	19	42187746	42187746	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42187746G>A	uc002ori.1	-	3	678	c.676C>T	c.(676-678)CGC>TGC	p.R226C	CEACAM7_uc010ehx.2_Missense_Mutation_p.R226C|CEACAM7_uc010ehy.1_Intron	NM_006890	NP_008821	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion	226	Ig-like C2-type.					anchored to membrane|integral to membrane|plasma membrane				ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		GGGTCACTGCGGCTGGCACCC	0.552													79	124	---	---	---	---	capture	Missense_Mutation	SNP	42187746	42187746	CEACAM7	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3166	61
BCAM	4059	broad.mit.edu	37	19	45322967	45322967	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45322967C>T	uc002ozu.2	+	13	1791	c.1747C>T	c.(1747-1749)CGG>TGG	p.R583W	BCAM_uc002ozt.1_Missense_Mutation_p.R583W	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	583	Cytoplasmic (Potential).				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CCGCCAGCGGCGGGAGAAGGG	0.507													25	12	---	---	---	---	capture	Missense_Mutation	SNP	45322967	45322967	BCAM	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	1333	61
FPR2	2358	broad.mit.edu	37	19	52272072	52272072	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52272072G>A	uc002pxr.2	+	2	206	c.161G>A	c.(160-162)CGG>CAG	p.R54Q	FPR2_uc002pxs.3_Missense_Mutation_p.R54Q|FPR2_uc010epf.2_Missense_Mutation_p.R54Q	NM_001005738	NP_001005738	P25090	FPR2_HUMAN	formyl peptide receptor-like 1	54	Cytoplasmic (Potential).				cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(3)|ovary(1)	4						GCTGGATTCCGGATGACACGC	0.562													73	120	---	---	---	---	capture	Missense_Mutation	SNP	52272072	52272072	FPR2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5983	61
CCDC88A	55704	broad.mit.edu	37	2	55561635	55561635	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:55561635G>C	uc002ryv.2	-	15	3164	c.2322C>G	c.(2320-2322)AAC>AAG	p.N774K	CCDC88A_uc010yoz.1_Missense_Mutation_p.N774K|CCDC88A_uc010ypa.1_Missense_Mutation_p.N774K|CCDC88A_uc010ypb.1_Missense_Mutation_p.N676K|CCDC88A_uc002ryu.2_Missense_Mutation_p.N57K|CCDC88A_uc002ryw.2_Missense_Mutation_p.N57K	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	774	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						TTTTATTGCTGTTCTCTAAAG	0.338													3	153	---	---	---	---	capture	Missense_Mutation	SNP	55561635	55561635	CCDC88A	2	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	2836	61
RMND5A	64795	broad.mit.edu	37	2	86992995	86992995	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:86992995G>A	uc010ytm.1	+	6	1079	c.702G>A	c.(700-702)TTG>TTA	p.L234L	RMND5A_uc002srs.3_Intron|RMND5A_uc002srr.2_Silent_p.L234L	NM_022780	NP_073617	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog	234										ovary(1)|skin(1)	2						TTCAGGTTTTGATGGGAAGCC	0.428													44	37	---	---	---	---	capture	Silent	SNP	86992995	86992995	RMND5A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	13289	61
DDX18	8886	broad.mit.edu	37	2	118587005	118587005	+	Silent	SNP	G	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:118587005G>T	uc002tlh.1	+	13	1932	c.1833G>T	c.(1831-1833)CTG>CTT	p.L611L		NM_006773	NP_006764	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	611							ATP binding|ATP-dependent RNA helicase activity|RNA binding			breast(2)|ovary(1)|lung(1)	4						AGGTTGCTCTGTCATTTGGTT	0.403													5	301	---	---	---	---	capture	Silent	SNP	118587005	118587005	DDX18	2	G	T	T	T	1	0	0	0	0	0	0	0	1	613	48	4	4	4303	61
TTN	7273	broad.mit.edu	37	2	179556814	179556814	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179556814G>T	uc010zfg.1	-	118	28183	c.27959C>A	c.(27958-27960)CCC>CAC	p.P9320H	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P5981H|TTN_uc010fre.1_Missense_Mutation_p.P431H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10247							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGTTTCTTGGGAACCTCAGG	0.433													32	47	---	---	---	---	capture	Missense_Mutation	SNP	179556814	179556814	TTN	2	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	16617	61
TTN	7273	broad.mit.edu	37	2	179569962	179569962	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179569962C>T	uc010zfg.1	-	100	26035	c.25811G>A	c.(25810-25812)CGA>CAA	p.R8604Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R5265Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9531							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGAAGACCTCGGAAGTCAGT	0.383													62	86	---	---	---	---	capture	Missense_Mutation	SNP	179569962	179569962	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16617	61
SPTLC3	55304	broad.mit.edu	37	20	13029756	13029756	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13029756C>A	uc002wod.1	+	2	570	c.281C>A	c.(280-282)GCT>GAT	p.A94D	SPTLC3_uc002woc.2_Missense_Mutation_p.A94D	NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	94					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	TGCAACGCAGCTGTGGAAAGA	0.423													4	143	---	---	---	---	capture	Missense_Mutation	SNP	13029756	13029756	SPTLC3	20	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	15017	61
PLCG1	5335	broad.mit.edu	37	20	39788360	39788360	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39788360A>G	uc002xjp.1	+	2	453	c.332A>G	c.(331-333)TAT>TGT	p.Y111C	PLCG1_uc002xjo.1_Missense_Mutation_p.Y111C	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	111	PH 1.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				GTCATTCTCTATGGAATGGAA	0.537													70	81	---	---	---	---	capture	Missense_Mutation	SNP	39788360	39788360	PLCG1	20	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11938	61
RRP1B	23076	broad.mit.edu	37	21	45107441	45107441	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45107441C>T	uc002zdk.2	+	13	1300	c.1186C>T	c.(1186-1188)CTT>TTT	p.L396F	RRP1B_uc002zdl.2_5'UTR	NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	396					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)		TGAAAGCAGTCTTCAAAAGAG	0.532													67	87	---	---	---	---	capture	Missense_Mutation	SNP	45107441	45107441	RRP1B	21	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	13580	61
CABIN1	23523	broad.mit.edu	37	22	24487684	24487684	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24487684G>A	uc002zzi.1	+	24	3800	c.3673G>A	c.(3673-3675)GTT>ATT	p.V1225I	CABIN1_uc002zzj.1_Missense_Mutation_p.V1175I|CABIN1_uc002zzl.1_Missense_Mutation_p.V1225I	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1225					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GCCACCCACCGTTTACTTGCT	0.612													37	37	---	---	---	---	capture	Missense_Mutation	SNP	24487684	24487684	CABIN1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2504	61
FGD5	152273	broad.mit.edu	37	3	14862435	14862435	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14862435C>T	uc003bzc.2	+	1	1967	c.1857C>T	c.(1855-1857)TTC>TTT	p.F619F	FGD5_uc011avk.1_Silent_p.F619F	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	619					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CACCTCCTTTCGACCTGGCCT	0.557													59	56	---	---	---	---	capture	Silent	SNP	14862435	14862435	FGD5	3	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	5782	61
GCET2	257144	broad.mit.edu	37	3	111842437	111842437	+	Silent	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111842437A>G	uc003dys.1	-	6	552	c.402T>C	c.(400-402)CCT>CCC	p.P134P	C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron|GCET2_uc003dyt.1_Silent_p.P68P	NM_152785	NP_689998	Q8N6F7	GCET2_HUMAN	germinal center expressed transcript 2 isoform	134						mitochondrion					0						GGTCTGTAGAAGGCATATGTA	0.483													33	314	---	---	---	---	capture	Silent	SNP	111842437	111842437	GCET2	3	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	6228	61
ABCF3	55324	broad.mit.edu	37	3	183907351	183907351	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183907351C>A	uc003fmz.2	+	13	1253	c.1120C>A	c.(1120-1122)CCC>ACC	p.P374T	ABCF3_uc003fna.2_Missense_Mutation_p.P368T|ABCF3_uc003fnb.2_Missense_Mutation_p.P55T	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	374	ABC transporter 1.						ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCAGACGTGGCCCTCCACCAT	0.617													85	57	---	---	---	---	capture	Missense_Mutation	SNP	183907351	183907351	ABCF3	3	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	67	61
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													5	5	---	---	---	---	capture	Missense_Mutation	SNP	195505836	195505836	MUC4	3	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	9888	61
EVC2	132884	broad.mit.edu	37	4	5630350	5630350	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:5630350G>A	uc003gij.2	-	12	1876	c.1822C>T	c.(1822-1824)CGT>TGT	p.R608C	EVC2_uc011bwb.1_Missense_Mutation_p.R48C|EVC2_uc003gik.2_Missense_Mutation_p.R528C	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	608						integral to membrane				large_intestine(3)|ovary(2)	5						CCCTGCACACGGGTCTCTGAT	0.498													66	77	---	---	---	---	capture	Missense_Mutation	SNP	5630350	5630350	EVC2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5241	61
SLC2A9	56606	broad.mit.edu	37	4	9889261	9889261	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9889261G>A	uc003gmc.2	-	10	1282	c.1221C>T	c.(1219-1221)CAC>CAT	p.H407H	SLC2A9_uc003gmd.2_Silent_p.H378H	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein	407	Extracellular (Potential).				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3						CCCAGGGGGCGTGGTCCTGGG	0.393													6	9	---	---	---	---	capture	Silent	SNP	9889261	9889261	SLC2A9	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14444	61
PCDH7	5099	broad.mit.edu	37	4	30724267	30724267	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:30724267A>G	uc003gsk.1	+	1	2231	c.1223A>G	c.(1222-1224)GAG>GGG	p.E408G	PCDH7_uc011bxw.1_Missense_Mutation_p.E361G|PCDH7_uc011bxx.1_Missense_Mutation_p.E408G	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	408	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						ATCAAAGACGAGAACGACAAC	0.642													29	38	---	---	---	---	capture	Missense_Mutation	SNP	30724267	30724267	PCDH7	4	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	11419	61
CXCL6	6372	broad.mit.edu	37	4	74702791	74702791	+	Missense_Mutation	SNP	C	A	A	rs149811429		TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74702791C>A	uc003hhf.2	+	2	415	c.220C>A	c.(220-222)CAG>AAG	p.Q74K	IL8_uc011cbh.1_Intron	NM_002993	NP_002984	P80162	CXCL6_HUMAN	chemokine (C-X-C motif) ligand 6 (granulocyte	74					cell-cell signaling|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding				0	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			CGCAGGCCCGCAGTGCTCCAA	0.542													16	96	---	---	---	---	capture	Missense_Mutation	SNP	74702791	74702791	CXCL6	4	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	4048	61
NPNT	255743	broad.mit.edu	37	4	106863540	106863540	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:106863540C>A	uc003hya.2	+	8	1045	c.840C>A	c.(838-840)GAC>GAA	p.D280E	NPNT_uc011cfc.1_Missense_Mutation_p.D297E|NPNT_uc011cfd.1_Missense_Mutation_p.D310E|NPNT_uc011cfe.1_Missense_Mutation_p.D310E|NPNT_uc010ilt.1_Missense_Mutation_p.D280E|NPNT_uc011cff.1_Missense_Mutation_p.D280E|NPNT_uc010ilu.1_Missense_Mutation_p.D176E	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	280					cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		TAAAGGGTGACACAGGAAATA	0.393													9	128	---	---	---	---	capture	Missense_Mutation	SNP	106863540	106863540	NPNT	4	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	10497	61
TLL1	7092	broad.mit.edu	37	4	166960565	166960565	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:166960565C>T	uc003irh.1	+	10	1880	c.1233C>T	c.(1231-1233)GAC>GAT	p.D411D	TLL1_uc011cjn.1_Silent_p.D411D|TLL1_uc011cjo.1_Silent_p.D235D	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	411	CUB 1.				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		AAGTAAGAGACGGGTACTGGA	0.388													34	61	---	---	---	---	capture	Silent	SNP	166960565	166960565	TLL1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15830	61
ODZ3	55714	broad.mit.edu	37	4	183594220	183594220	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183594220C>T	uc003ivd.1	+	6	1211	c.1174C>T	c.(1174-1176)CGA>TGA	p.R392*		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	392	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		TGATATTGGCCGAAGAGCAAT	0.388													11	17	---	---	---	---	capture	Nonsense_Mutation	SNP	183594220	183594220	ODZ3	4	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	10741	61
ODZ3	55714	broad.mit.edu	37	4	183594343	183594343	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183594343C>T	uc003ivd.1	+	6	1334	c.1297C>T	c.(1297-1299)CGG>TGG	p.R433W		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	433	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		AGTATATGGCCGGAAAGGCTT	0.388													21	42	---	---	---	---	capture	Missense_Mutation	SNP	183594343	183594343	ODZ3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	10741	61
FAT1	2195	broad.mit.edu	37	4	187557880	187557880	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187557880G>A	uc003izf.2	-	5	4019	c.3831C>T	c.(3829-3831)ACC>ACT	p.T1277T		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1277	Extracellular (Potential).|Cadherin 11.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CATCCTTGTCGGTGGCTATGA	0.493										HNSCC(5;0.00058)			178	282	---	---	---	---	capture	Silent	SNP	187557880	187557880	FAT1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5635	61
TTC37	9652	broad.mit.edu	37	5	94856458	94856458	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94856458G>A	uc003klb.2	-	20	2346	c.2076C>T	c.(2074-2076)GCC>GCT	p.A692A		NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	692	TPR 12.						binding			ovary(3)|pancreas(1)	4						TGTAGTCTACGGCTTTTCCAT	0.284													4	105	---	---	---	---	capture	Silent	SNP	94856458	94856458	TTC37	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16587	61
DMXL1	1657	broad.mit.edu	37	5	118503534	118503534	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:118503534A>G	uc003ksd.2	+	23	5554	c.5373A>G	c.(5371-5373)ATA>ATG	p.I1791M	DMXL1_uc010jcl.1_Missense_Mutation_p.I1791M	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1791										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AAACATTAATAAAGCAACCTA	0.343													10	96	---	---	---	---	capture	Missense_Mutation	SNP	118503534	118503534	DMXL1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	163	13	3	3	4552	61
ABLIM3	22885	broad.mit.edu	37	5	148620291	148620291	+	Silent	SNP	C	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148620291C>G	uc003lpy.2	+	14	1508	c.1257C>G	c.(1255-1257)TCC>TCG	p.S419S	ABLIM3_uc003lpz.1_Silent_p.S419S|ABLIM3_uc003lqa.1_Intron|ABLIM3_uc003lqb.2_Intron|ABLIM3_uc003lqc.1_Intron|ABLIM3_uc003lqd.1_Intron|ABLIM3_uc003lqf.2_Intron|ABLIM3_uc003lqe.1_Intron	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	419					axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGTGAGGTCCTCCACTCCAA	0.572													6	184	---	---	---	---	capture	Silent	SNP	148620291	148620291	ABLIM3	5	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	96	61
SLIT3	6586	broad.mit.edu	37	5	168112727	168112727	+	Missense_Mutation	SNP	C	T	T	rs150873620	by1000genomes	TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168112727C>T	uc003mab.2	-	31	3940	c.3520G>A	c.(3520-3522)GCC>ACC	p.A1174T	SLIT3_uc010jjg.2_Missense_Mutation_p.A1181T	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	1174	Laminin G-like.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	p.A1174T(1)		ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGGACCTTGGCGGAGGCCAGT	0.627													58	85	---	---	---	---	capture	Missense_Mutation	SNP	168112727	168112727	SLIT3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14633	61
STK10	6793	broad.mit.edu	37	5	171479966	171479966	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:171479966C>T	uc003mbo.1	-	18	3033	c.2733G>A	c.(2731-2733)AAG>AAA	p.K911K		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	911	Potential.						ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCCGCCATTCCTTCAGGTTCT	0.567													40	72	---	---	---	---	capture	Silent	SNP	171479966	171479966	STK10	5	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	15176	61
LMAN2	10960	broad.mit.edu	37	5	176765541	176765541	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176765541G>A	uc003mge.2	-	3	618	c.381C>T	c.(379-381)AAC>AAT	p.N127N	LMAN2_uc003mgd.2_Silent_p.N127N	NM_006816	NP_006807	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2 precursor	127	Lumenal (Potential).|L-type lectin-like.				protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	metal ion binding|sugar binding				0	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCATGGAGGTTCTTCTTCC	0.632													101	154	---	---	---	---	capture	Silent	SNP	176765541	176765541	LMAN2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	8758	61
CANX	821	broad.mit.edu	37	5	179132740	179132740	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179132740G>A	uc003mkk.2	+	2	235	c.58G>A	c.(58-60)GCT>ACT	p.A20T	CANX_uc011dgp.1_Missense_Mutation_p.A55T|CANX_uc010jlb.1_Missense_Mutation_p.A20T|CANX_uc003mkl.2_Missense_Mutation_p.A20T|CANX_uc011dgq.1_5'UTR	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor	20					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	tattgttgaggctcatgatgg	0.104													202	281	---	---	---	---	capture	Missense_Mutation	SNP	179132740	179132740	CANX	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	2594	61
LRFN2	57497	broad.mit.edu	37	6	40359856	40359856	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:40359856C>T	uc003oph.1	-	3	2661	c.2196G>A	c.(2194-2196)GCG>GCA	p.A732A		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	732	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTCCCGCCGCCGCAGCAGCAA	0.682													4	2	---	---	---	---	capture	Silent	SNP	40359856	40359856	LRFN2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8854	61
UNC5CL	222643	broad.mit.edu	37	6	40996138	40996138	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:40996138C>T	uc003opi.2	-	9	1620	c.1531G>A	c.(1531-1533)GGC>AGC	p.G511S		NM_173561	NP_775832	Q8IV45	UN5CL_HUMAN	unc-5 homolog C-like	511	Cytoplasmic (Potential).				signal transduction	cytoplasm|integral to membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGCTCCAGGCCCTGGTTATCC	0.687											OREG0017423	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	13	---	---	---	---	capture	Missense_Mutation	SNP	40996138	40996138	UNC5CL	6	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	16876	61
SMPD2	6610	broad.mit.edu	37	6	109764877	109764877	+	Silent	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109764877A>G	uc003pti.2	+	10	1435	c.1041A>G	c.(1039-1041)GGA>GGG	p.G347G	PPIL6_uc003pth.1_5'Flank	NM_003080	NP_003071	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral	347	Helical; (Potential).				induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|sphingomyelin metabolic process	integral to plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		TGGCGGCTGGAGGAGGGGCCG	0.632													9	33	---	---	---	---	capture	Silent	SNP	109764877	109764877	SMPD2	6	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	14697	61
UTRN	7402	broad.mit.edu	37	6	144809879	144809879	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:144809879T>A	uc003qkt.2	+	29	4135	c.4043T>A	c.(4042-4044)GTC>GAC	p.V1348D		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1348	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ATGCTTCAAGTCTTGCAAGAG	0.483													10	56	---	---	---	---	capture	Missense_Mutation	SNP	144809879	144809879	UTRN	6	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	16985	61
SLC29A4	222962	broad.mit.edu	37	7	5330480	5330480	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5330480A>G	uc003sod.2	+	3	448	c.287A>G	c.(286-288)CAT>CGT	p.H96R	SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Missense_Mutation_p.H96R|SLC29A4_uc003soe.2_Missense_Mutation_p.H96R	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	96	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		GACTACCTGCATCACAAGTAC	0.627													26	105	---	---	---	---	capture	Missense_Mutation	SNP	5330480	5330480	SLC29A4	7	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	14429	61
STK31	56164	broad.mit.edu	37	7	23830449	23830449	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23830449C>T	uc003sws.3	+	22	2711	c.2644C>T	c.(2644-2646)CGA>TGA	p.R882*	STK31_uc003swt.3_Nonsense_Mutation_p.R859*|STK31_uc011jze.1_Nonsense_Mutation_p.R882*|STK31_uc010kuq.2_Nonsense_Mutation_p.R859*|STK31_uc003swv.1_Nonsense_Mutation_p.R48*	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	882	Protein kinase.						ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						GCAGAGTCAGCGAGCCTCGGT	0.378													8	169	---	---	---	---	capture	Nonsense_Mutation	SNP	23830449	23830449	STK31	7	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	15186	61
EGFR	1956	broad.mit.edu	37	7	55233035	55233035	+	Silent	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233035C>T	uc003tqk.2	+	15	2031	c.1785C>T	c.(1783-1785)TGC>TGT	p.C595C	EGFR_uc003tqi.2_Silent_p.C595C|EGFR_uc003tqj.2_Silent_p.C595C|EGFR_uc010kzg.1_Silent_p.C550C|EGFR_uc011kco.1_Silent_p.C542C|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	595	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCAAGACCTGCCCGGCAGGAG	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			5	215	---	---	---	---	capture	Silent	SNP	55233035	55233035	EGFR	7	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	4922	61
MCM4	4173	broad.mit.edu	37	8	48889249	48889249	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:48889249A>G	uc003xqk.1	+	17	2598	c.2503A>G	c.(2503-2505)ATT>GTT	p.I835V	MCM4_uc003xql.1_Missense_Mutation_p.I835V|MCM4_uc011ldi.1_Missense_Mutation_p.I822V	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	835					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				CCCACAGGCAATTACTAAAGA	0.423													50	59	---	---	---	---	capture	Missense_Mutation	SNP	48889249	48889249	MCM4	8	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9302	61
TTC39B	158219	broad.mit.edu	37	9	15185345	15185345	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:15185345G>A	uc003zlr.1	-	16	1470	c.1349C>T	c.(1348-1350)GCT>GTT	p.A450V	TTC39B_uc003zlq.1_Missense_Mutation_p.A419V|TTC39B_uc011lmp.1_Missense_Mutation_p.A351V|TTC39B_uc010mie.1_Missense_Mutation_p.A448V|TTC39B_uc011lmq.1_Missense_Mutation_p.A437V|TTC39B_uc011lmr.1_Missense_Mutation_p.A381V|TTC39B_uc003zlp.1_Missense_Mutation_p.A33V	NM_152574	NP_689787	Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	450							binding			ovary(1)	1						CTTCCTCACAGCAAACTTCTC	0.507													4	194	---	---	---	---	capture	Missense_Mutation	SNP	15185345	15185345	TTC39B	9	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	16590	61
C9orf125	84302	broad.mit.edu	37	9	104238682	104238682	+	Silent	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:104238682G>A	uc004bbm.2	-	2	1015	c.693C>T	c.(691-693)CGC>CGT	p.R231R	uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	231						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				GCTCAGAGAAGCGAGCCCGCA	0.542													45	73	---	---	---	---	capture	Silent	SNP	104238682	104238682	C9orf125	9	G	A	A	A	1	0	0	0	0	0	0	0	1	431	34	2	2	2431	61
SMC2	10592	broad.mit.edu	37	9	106885401	106885401	+	Silent	SNP	A	G	G			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:106885401A>G	uc004bbv.2	+	17	2433	c.2145A>G	c.(2143-2145)CTA>CTG	p.L715L	SMC2_uc004bbu.1_Silent_p.L715L|SMC2_uc004bbw.2_Silent_p.L715L|SMC2_uc011lvl.1_Silent_p.L715L|SMC2_uc004bbx.2_Silent_p.L715L	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	715	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						ATCGCCAACTAAAACAGCAGT	0.348													33	39	---	---	---	---	capture	Silent	SNP	106885401	106885401	SMC2	9	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	14675	61
COL27A1	85301	broad.mit.edu	37	9	117071558	117071558	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117071558C>T	uc011lxl.1	+	60	5236	c.5236C>T	c.(5236-5238)CGG>TGG	p.R1746W	COL27A1_uc004bii.2_RNA|COL27A1_uc011lxn.1_Missense_Mutation_p.R61W	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1746	Fibrillar collagen NC1.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						TGCCATCAGCCGGGTCCAGAT	0.607													123	191	---	---	---	---	capture	Missense_Mutation	SNP	117071558	117071558	COL27A1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	3650	61
ATP6V1G1	9550	broad.mit.edu	37	9	117359986	117359986	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117359986G>A	uc004bjc.2	+	3	445	c.320G>A	c.(319-321)CGG>CAG	p.R107Q		NM_004888	NP_004879	O75348	VATG1_HUMAN	vacuolar H+ ATPase G1	107					cellular iron ion homeostasis|insulin receptor signaling pathway|proton transport|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances				0						TGTGACATTCGGCCAGAAATC	0.478													42	55	---	---	---	---	capture	Missense_Mutation	SNP	117359986	117359986	ATP6V1G1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1177	61
NELF	26012	broad.mit.edu	37	9	140351900	140351900	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140351900C>T	uc004cna.2	-	3	819	c.587G>A	c.(586-588)CGC>CAC	p.R196H	C9orf167_uc011mew.1_Intron|NELF_uc011mex.1_5'Flank|NELF_uc010nci.2_5'Flank|NELF_uc011mey.1_RNA|NELF_uc011mez.1_Missense_Mutation_p.R196H|NELF_uc004cmz.2_Missense_Mutation_p.R196H|NELF_uc004cnc.2_Missense_Mutation_p.R196H|NELF_uc004cnb.2_Missense_Mutation_p.R196H	NM_001130969	NP_001124441	Q6X4W1	NELF_HUMAN	nasal embryonic LHRH factor isoform a	196						nucleus|plasma membrane					0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000222)|Epithelial(140;0.000888)		CAGCTTCTTGCGGCGACCGGA	0.652													3	58	---	---	---	---	capture	Missense_Mutation	SNP	140351900	140351900	NELF	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10239	61
SHOX	6473	broad.mit.edu	37	X	591909	591909	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:591909G>A	uc004cph.1	+	2	968	c.277G>A	c.(277-279)GGG>AGG	p.G93R	SHOX_uc004cpi.2_Missense_Mutation_p.G93R	NM_000451	NP_000442	O15266	SHOX_HUMAN	short stature homeobox isoform SHOXa	93					skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGTGGCAGAAGGTAAGTTCCT	0.647													29	47	---	---	---	---	capture	Missense_Mutation	SNP	591909	591909	SHOX	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	14181	61
FOXR2	139628	broad.mit.edu	37	X	55650926	55650926	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55650926A>C	uc004duo.2	+	1	1094	c.782A>C	c.(781-783)GAT>GCT	p.D261A		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	261	Fork-head.				embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						AAGGATGAAGATAATGCAAGA	0.517													74	8	---	---	---	---	capture	Missense_Mutation	SNP	55650926	55650926	FOXR2	23	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	5976	61
FBXO22	26263	broad.mit.edu	37	15	76205599	76205599	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:76205599delT	uc002bbk.2	+	3	440	c.335delT	c.(334-336)ATTfs	p.I112fs	FBXO22_uc002bbj.1_Frame_Shift_Del_p.I112fs|FBXO22_uc002bbl.2_Frame_Shift_Del_p.I8fs	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	112					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						GAAACTTTCATTAGTCTGGAA	0.358													25	78	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	76205599	76205599	FBXO22	15	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	5680	61
SPIRE2	84501	broad.mit.edu	37	16	89916966	89916966	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89916966delC	uc002foz.1	+	3	595	c.543delC	c.(541-543)GACfs	p.D181fs	SPIRE2_uc010civ.1_Frame_Shift_Del_p.D96fs|SPIRE2_uc010ciw.1_Frame_Shift_Del_p.D181fs|SPIRE2_uc002fpa.1_Frame_Shift_Del_p.D133fs|SPIRE2_uc010cix.1_Frame_Shift_Del_p.D50fs	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	181	KIND.				transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		GGCTGACCGACCCCCGGGGCG	0.751													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89916966	89916966	SPIRE2	16	C	-	-	-	1	0	1	0	1	0	0	0	0	233	18	5	5	14964	61
ABCF1	23	broad.mit.edu	37	6	30552069	30552069	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0648-01	TCGA-06-0648-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30552069delG	uc003nql.2	+	13	1298	c.1203delG	c.(1201-1203)CTGfs	p.L401fs	ABCF1_uc003nqk.2_Frame_Shift_Del_p.L402fs|ABCF1_uc003nqm.2_Frame_Shift_Del_p.L363fs|ABCF1_uc010jsb.2_Intron|MIR877_hsa-mir-877|MI0005561_5'Flank	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1	401	ABC transporter 1.				inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						AGGGACAGCTGGAACAAGGGG	0.592													42	74	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	30552069	30552069	ABCF1	6	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	65	61
