Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TMEM52	339456	broad.mit.edu	37	1	1849551	1849551	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1849551C>A	uc001aij.2	-	5	436	c.400G>T	c.(400-402)GGG>TGG	p.G134W	TMEM52_uc001aii.2_Missense_Mutation_p.G119W	NM_178545	NP_848640	Q8NDY8	TMM52_HUMAN	transmembrane protein 52 precursor	134						integral to membrane					0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TCCAGCTCCCCAAAGGGCAGG	0.637													6	93	---	---	---	---	capture	Missense_Mutation	SNP	1849551	1849551	TMEM52	1	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	16061	62
ESPN	83715	broad.mit.edu	37	1	6517297	6517297	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6517297C>T	uc001amy.2	+	11	2547	c.2379C>T	c.(2377-2379)CTC>CTT	p.L793L	ESPN_uc001amz.2_Silent_p.L227L	NM_031475	NP_113663	B1AK53	ESPN_HUMAN	espin	793	Glu-rich.|Potential.				sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GGCGGGACCTCCTGCGGAAGA	0.642													10	12	---	---	---	---	capture	Silent	SNP	6517297	6517297	ESPN	1	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	5209	62
ZNF683	257101	broad.mit.edu	37	1	26691247	26691247	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26691247C>T	uc001bmg.1	-	4	908	c.790G>A	c.(790-792)GGC>AGC	p.G264S	ZNF683_uc001bmh.1_Missense_Mutation_p.G264S|ZNF683_uc009vsj.1_Missense_Mutation_p.G264S	NM_173574	NP_775845	Q8IZ20	ZN683_HUMAN	zinc finger protein 683	264					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		AGAGCTTGGCCAGAGGCTTGG	0.647													23	61	---	---	---	---	capture	Missense_Mutation	SNP	26691247	26691247	ZNF683	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	17968	62
CSMD2	114784	broad.mit.edu	37	1	34209005	34209005	+	Silent	SNP	G	A	A	rs141295499		TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:34209005G>A	uc001bxn.1	-	14	1958	c.1929C>T	c.(1927-1929)CCC>CCT	p.P643P	CSMD2_uc001bxm.1_Silent_p.P683P	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	643	Extracellular (Potential).|CUB 4.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGCCCAGGACGGGCGCCTCGG	0.612													6	112	---	---	---	---	capture	Silent	SNP	34209005	34209005	CSMD2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3910	62
PTCH2	8643	broad.mit.edu	37	1	45307671	45307671	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45307671G>C	uc010olf.1	-	2	125	c.113C>G	c.(112-114)GCT>GGT	p.A38G	PTCH2_uc010olg.1_5'UTR	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	38	Cytoplasmic (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					CTGGAAGTAAGCACGAAGCCA	0.552									Basal_Cell_Nevus_syndrome				34	118	---	---	---	---	capture	Missense_Mutation	SNP	45307671	45307671	PTCH2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	12626	62
NBPF9	400818	broad.mit.edu	37	1	144615193	144615193	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144615193C>T	uc009wig.1	+	3	139	c.63C>T	c.(61-63)AAC>AAT	p.N21N	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Translation_Start_Site|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Translation_Start_Site|NBPF9_uc010oyg.1_Silent_p.N21N|NBPF9_uc009wii.1_Translation_Start_Site|NBPF9_uc009wif.1_RNA|C1orf152_uc001elf.3_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	21						cytoplasm					0						TAGAAATCAACGAGAAATTGC	0.522													82	225	---	---	---	---	capture	Silent	SNP	144615193	144615193	NBPF9	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10106	62
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254													4	73	---	---	---	---	capture	Missense_Mutation	SNP	145367767	145367767	NBPF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10100	62
TCHH	7062	broad.mit.edu	37	1	152081057	152081057	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152081057C>T	uc001ezp.2	-	2	4636	c.4636G>A	c.(4636-4638)GGG>AGG	p.G1546R	TCHH_uc009wne.1_Missense_Mutation_p.G1546R	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1546	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGCTGTTGCCCGCGCTCCTGG	0.617													7	104	---	---	---	---	capture	Missense_Mutation	SNP	152081057	152081057	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15585	62
SLAMF8	56833	broad.mit.edu	37	1	159802791	159802791	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159802791C>T	uc001fue.3	+	3	703	c.493C>T	c.(493-495)CGA>TGA	p.R165*		NM_020125	NP_064510	Q9P0V8	SLAF8_HUMAN	SLAM family member 8 precursor	165	Ig-like C2-type.|Extracellular (Potential).					integral to membrane					0	all_hematologic(112;0.0597)					CTATAGCTGGCGACGGGAGAC	0.537													19	88	---	---	---	---	capture	Nonsense_Mutation	SNP	159802791	159802791	SLAMF8	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	14263	62
SOAT1	6646	broad.mit.edu	37	1	179310266	179310266	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179310266T>G	uc001gml.2	+	7	664	c.601T>G	c.(601-603)TTT>GTT	p.F201V	SOAT1_uc010pni.1_Missense_Mutation_p.F136V|SOAT1_uc001gmm.2_Missense_Mutation_p.F143V|SOAT1_uc010pnj.1_Translation_Start_Site|SOAT1_uc010pnk.1_Missense_Mutation_p.F136V	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	201					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	AGTTCCCTATTTTCTGTTTCA	0.448													55	187	---	---	---	---	capture	Missense_Mutation	SNP	179310266	179310266	SOAT1	1	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	14802	62
HMCN1	83872	broad.mit.edu	37	1	186088926	186088926	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186088926C>T	uc001grq.1	+	79	12235	c.12006C>T	c.(12004-12006)AAC>AAT	p.N4002N		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4002	Ig-like C2-type 39.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TCATTCTGAACAATCCTATTT	0.388													33	57	---	---	---	---	capture	Silent	SNP	186088926	186088926	HMCN1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	7145	62
LBR	3930	broad.mit.edu	37	1	225598033	225598033	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:225598033C>T	uc001hoy.2	-	10	1417	c.1274G>A	c.(1273-1275)AGT>AAT	p.S425N	LBR_uc001hoz.2_Missense_Mutation_p.S425N|LBR_uc001hpa.1_Missense_Mutation_p.S425N	NM_002296	NP_002287	Q14739	LBR_HUMAN	lamin B receptor	425					cholesterol biosynthetic process	integral to nuclear inner membrane	chromo shadow domain binding|delta14-sterol reductase activity|DNA binding|lamin binding|receptor activity			ovary(1)|skin(1)	2	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AAGCTGGAAACTATTAACTAA	0.443													15	152	---	---	---	---	capture	Missense_Mutation	SNP	225598033	225598033	LBR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	8572	62
ERCC6	2074	broad.mit.edu	37	10	50667268	50667268	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50667268T>C	uc001jhs.3	-	21	4229	c.4075A>G	c.(4075-4077)AAA>GAA	p.K1359E	ERCC6_uc009xod.2_Missense_Mutation_p.K519E|ERCC6_uc010qgr.1_Missense_Mutation_p.K729E|ERCC6_uc001jhr.3_Missense_Mutation_p.K727E	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	1359					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						CCCTCCTTTTTCATGATGCCA	0.443								Direct_reversal_of_damage|NER					57	61	---	---	---	---	capture	Missense_Mutation	SNP	50667268	50667268	ERCC6	10	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	5172	62
PCDH15	65217	broad.mit.edu	37	10	55582616	55582616	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:55582616G>A	uc001jju.1	-	33	5265	c.4870C>T	c.(4870-4872)CCA>TCA	p.P1624S	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.P1621S|PCDH15_uc010qhw.1_Missense_Mutation_p.P1584S|PCDH15_uc010qhx.1_Missense_Mutation_p.P1555S|PCDH15_uc010qhy.1_Missense_Mutation_p.P1631S|PCDH15_uc010qhz.1_Missense_Mutation_p.P1626S|PCDH15_uc010qia.1_Missense_Mutation_p.P1604S|PCDH15_uc010qib.1_Missense_Mutation_p.P1601S	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1624	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GTAAGCAATGGATTGCTGCTA	0.418										HNSCC(58;0.16)			9	179	---	---	---	---	capture	Missense_Mutation	SNP	55582616	55582616	PCDH15	10	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11414	62
PTEN	5728	broad.mit.edu	37	10	89692904	89692904	+	Missense_Mutation	SNP	C	G	G	rs121909224		TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692904C>G	uc001kfb.2	+	6	1419	c.388C>G	c.(388-390)CGA>GGA	p.R130G		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(65)|p.R130*(61)|p.R130Q(43)|p.R130fs*4(12)|p.R130L(7)|p.R130P(4)|p.R55fs*1(4)|p.K128_R130del(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.R130R(1)|p.F56fs*2(1)|p.G129fs*50(1)|p.G129fs*51(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGGAAAGGGACGAACTGGTGT	0.403	R130G(OV56_OVARY)|R130G(KMBC2_URINARY_TRACT)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			7	97	---	---	---	---	capture	Missense_Mutation	SNP	89692904	89692904	PTEN	10	C	G	G	G	1	0	0	0	0	1	0	0	0	243	19	4	4	12633	62
HTR7	3363	broad.mit.edu	37	10	92509172	92509172	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:92509172G>A	uc001kha.2	-	2	962	c.719C>T	c.(718-720)ACG>ATG	p.T240M	HTR7_uc001kgz.2_Missense_Mutation_p.T240M|HTR7_uc001khb.2_Missense_Mutation_p.T240M	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	240	Helical; Name=5; (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	AGAGTAAATCGTATAGCCAAA	0.473													31	41	---	---	---	---	capture	Missense_Mutation	SNP	92509172	92509172	HTR7	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7377	62
AFAP1L2	84632	broad.mit.edu	37	10	116060363	116060363	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:116060363G>A	uc001lbn.2	-	14	1930	c.1629C>T	c.(1627-1629)GTC>GTT	p.V543V	AFAP1L2_uc001lbo.2_Silent_p.V543V|AFAP1L2_uc010qse.1_Silent_p.V596V|AFAP1L2_uc001lbp.2_Silent_p.V571V|AFAP1L2_uc001lbr.1_Silent_p.V543V|AFAP1L2_uc001lbm.2_Intron|AFAP1L2_uc010qsd.1_Silent_p.V109V|AFAP1L2_uc001lbq.1_Silent_p.V65V	NM_001001936	NP_001001936	Q8N4X5	AF1L2_HUMAN	KIAA1914 protein isoform 1	543					inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GAAAGGACTTGACAGGTGTGA	0.602													28	42	---	---	---	---	capture	Silent	SNP	116060363	116060363	AFAP1L2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	355	62
ATRNL1	26033	broad.mit.edu	37	10	117607492	117607492	+	Silent	SNP	T	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:117607492T>G	uc001lcg.2	+	28	4394	c.4008T>G	c.(4006-4008)CCT>CCG	p.P1336P	ATRNL1_uc010qsm.1_Silent_p.P465P|ATRNL1_uc010qsn.1_RNA	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1336	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CCCCTCCCCCTGGGCAGTCAG	0.468													11	21	---	---	---	---	capture	Silent	SNP	117607492	117607492	ATRNL1	10	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	1198	62
MKI67	4288	broad.mit.edu	37	10	129913850	129913850	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129913850T>A	uc001lke.2	-	7	1017	c.822A>T	c.(820-822)AAA>AAT	p.K274N	MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	274					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CAGCACTTTCTTTCTCTGTTG	0.443													6	70	---	---	---	---	capture	Missense_Mutation	SNP	129913850	129913850	MKI67	10	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	9510	62
CHRNA10	57053	broad.mit.edu	37	11	3687530	3687530	+	Missense_Mutation	SNP	C	T	T	rs148252978		TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3687530C>T	uc001lyf.2	-	5	1232	c.1160G>A	c.(1159-1161)CGA>CAA	p.R387Q	CHRNA10_uc010qxt.1_Missense_Mutation_p.R181Q|CHRNA10_uc010qxu.1_Missense_Mutation_p.R181Q	NM_020402	NP_065135	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10	387	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding			ovary(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)	GCACAGACATCGTGGCTCGTG	0.667													10	123	---	---	---	---	capture	Missense_Mutation	SNP	3687530	3687530	CHRNA10	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3347	62
OR5I1	10798	broad.mit.edu	37	11	55703265	55703265	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55703265G>A	uc010ris.1	-	1	612	c.612C>T	c.(610-612)TAC>TAT	p.Y204Y		NM_006637	NP_006628	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I,	204	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CTGAGCTGCCGTATGTGGAGA	0.403													5	29	---	---	---	---	capture	Silent	SNP	55703265	55703265	OR5I1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11068	62
TCN1	6947	broad.mit.edu	37	11	59630104	59630104	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59630104G>T	uc001noj.2	-	3	449	c.351C>A	c.(349-351)CAC>CAA	p.H117Q		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	117					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTCGATCAGGTGGTAATCAT	0.383													21	133	---	---	---	---	capture	Missense_Mutation	SNP	59630104	59630104	TCN1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	15591	62
FAT3	120114	broad.mit.edu	37	11	92624150	92624150	+	Silent	SNP	G	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92624150G>C	uc001pdj.3	+	25	13562	c.13545G>C	c.(13543-13545)TCG>TCC	p.S4515S	FAT3_uc001pdi.3_Silent_p.S987S	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	4547	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCTCATCCTCGGATGTGTCTG	0.557										TCGA Ovarian(4;0.039)			14	16	---	---	---	---	capture	Silent	SNP	92624150	92624150	FAT3	11	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	5637	62
MMP20	9313	broad.mit.edu	37	11	102477401	102477401	+	Missense_Mutation	SNP	C	T	T	rs141875245	byFrequency	TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102477401C>T	uc001phc.2	-	6	831	c.818G>A	c.(817-819)CGG>CAG	p.R273Q		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	273					proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		GAATACTTTCCGAGGTCCTAG	0.522													19	83	---	---	---	---	capture	Missense_Mutation	SNP	102477401	102477401	MMP20	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9571	62
ARHGAP32	9743	broad.mit.edu	37	11	128994764	128994764	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128994764A>G	uc009zcp.2	-	3	251	c.251T>C	c.(250-252)ATT>ACT	p.I84T	ARHGAP32_uc009zcq.1_Missense_Mutation_p.I44T	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	84					cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						ATCTCCAGGAATCTCTGGAAC	0.328													5	107	---	---	---	---	capture	Missense_Mutation	SNP	128994764	128994764	ARHGAP32	11	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	874	62
CACNA1C	775	broad.mit.edu	37	12	2786282	2786282	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2786282G>T	uc009zdu.1	+	42	5308	c.4995G>T	c.(4993-4995)AAG>AAT	p.K1665N	CACNA1C_uc009zdv.1_Missense_Mutation_p.K1614N|CACNA1C_uc001qkb.2_Missense_Mutation_p.K1617N|CACNA1C_uc001qkc.2_Missense_Mutation_p.K1636N|CACNA1C_uc001qke.2_Missense_Mutation_p.K1606N|CACNA1C_uc001qkf.2_Missense_Mutation_p.K1625N|CACNA1C_uc001qjz.2_Missense_Mutation_p.K1617N|CACNA1C_uc001qkd.2_Missense_Mutation_p.K1636N|CACNA1C_uc001qkg.2_Missense_Mutation_p.K1623N|CACNA1C_uc009zdw.1_Missense_Mutation_p.K1658N|CACNA1C_uc001qkh.2_Missense_Mutation_p.K1625N|CACNA1C_uc001qkl.2_Missense_Mutation_p.K1665N|CACNA1C_uc001qkn.2_Missense_Mutation_p.K1617N|CACNA1C_uc001qko.2_Missense_Mutation_p.K1637N|CACNA1C_uc001qkp.2_Missense_Mutation_p.K1617N|CACNA1C_uc001qkr.2_Missense_Mutation_p.K1634N|CACNA1C_uc001qku.2_Missense_Mutation_p.K1617N|CACNA1C_uc001qkq.2_Missense_Mutation_p.K1645N|CACNA1C_uc001qks.2_Missense_Mutation_p.K1617N|CACNA1C_uc001qkt.2_Missense_Mutation_p.K1636N|CACNA1C_uc001qki.1_Missense_Mutation_p.K1353N|CACNA1C_uc001qkj.1_Missense_Mutation_p.K1353N|CACNA1C_uc001qkk.1_Missense_Mutation_p.K1353N|CACNA1C_uc001qkm.1_Missense_Mutation_p.K1342N|CACNA1C_uc010sea.1_Missense_Mutation_p.K308N|uc001qkx.1_RNA|CACNA1C_uc001qky.1_5'Flank	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1665	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CCGTTGGCAAGTTCTACGCCA	0.527													6	17	---	---	---	---	capture	Missense_Mutation	SNP	2786282	2786282	CACNA1C	12	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	2516	62
PZP	5858	broad.mit.edu	37	12	9345129	9345129	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9345129C>T	uc001qvl.2	-	12	1490	c.1461G>A	c.(1459-1461)TCG>TCA	p.S487S	PZP_uc009zgl.2_Silent_p.S356S	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						AACTGAGCTCCGATAACTCTC	0.483													5	111	---	---	---	---	capture	Silent	SNP	9345129	9345129	PZP	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12764	62
GUCY2C	2984	broad.mit.edu	37	12	14827688	14827688	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14827688G>A	uc001rcd.2	-	8	1092	c.955C>T	c.(955-957)CGA>TGA	p.R319*	GUCY2C_uc009zhz.2_Nonsense_Mutation_p.R319*	NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	319	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						GCAAAGTCTCGTTTTGTCTAA	0.363													44	94	---	---	---	---	capture	Nonsense_Mutation	SNP	14827688	14827688	GUCY2C	12	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	6825	62
ARHGAP9	64333	broad.mit.edu	37	12	57868660	57868660	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57868660C>T	uc001sod.2	-	16	2112	c.1919G>A	c.(1918-1920)AGA>AAA	p.R640K	ARHGAP9_uc001sny.2_RNA|ARHGAP9_uc001snz.2_Missense_Mutation_p.R366K|ARHGAP9_uc001soa.2_Missense_Mutation_p.R239K|ARHGAP9_uc001sob.2_Missense_Mutation_p.R550K|ARHGAP9_uc001soc.2_Missense_Mutation_p.R550K|ARHGAP9_uc001soe.1_Missense_Mutation_p.R629K	NM_032496	NP_115885	Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9 isoform 1	569	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			lung(1)	1			GBM - Glioblastoma multiforme(3;3.37e-34)			AAAATGACCTCTTTTATCCAC	0.527													45	43	---	---	---	---	capture	Missense_Mutation	SNP	57868660	57868660	ARHGAP9	12	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	882	62
EBPL	84650	broad.mit.edu	37	13	50243922	50243922	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:50243922C>A	uc001vdg.2	-	2	295	c.232G>T	c.(232-234)GCT>TCT	p.A78S	EBPL_uc001vdh.2_RNA|EBPL_uc001vdi.2_Missense_Mutation_p.A78S	NM_032565	NP_115954	Q9BY08	EBPL_HUMAN	emopamil binding related protein, delta8-delta7	78					sterol metabolic process	endoplasmic reticulum membrane|integral to membrane	cholestenol delta-isomerase activity				0		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		CATAAAGAAGCAATCAAGCCA	0.358											OREG0022412	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	48	---	---	---	---	capture	Missense_Mutation	SNP	50243922	50243922	EBPL	13	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	4842	62
TINF2	26277	broad.mit.edu	37	14	24709082	24709082	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24709082C>T	uc001woa.3	-	9	1619	c.1277G>A	c.(1276-1278)TGT>TAT	p.C426Y	TINF2_uc010alm.2_3'UTR|TINF2_uc001wob.3_3'UTR|TINF2_uc010tof.1_Missense_Mutation_p.C391Y|TINF2_uc001woc.3_3'UTR	NM_001099274	NP_001092744	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	426					negative regulation of epithelial cell proliferation|negative regulation of protein ADP-ribosylation|negative regulation of telomere maintenance via telomerase|positive regulation of telomere maintenance|protein localization to chromosome, telomeric region|telomere assembly|telomere maintenance via telomere lengthening	nuclear telomere cap complex|nucleoplasm|perinucleolar chromocenter	protein binding|protein binding|telomeric DNA binding				0				GBM - Glioblastoma multiforme(265;0.0185)		TAGGTATTCACAGAGAGTGGG	0.463									Ataxia_Pancytopenia_syndrome|Congenital_Dyskeratosis				33	59	---	---	---	---	capture	Missense_Mutation	SNP	24709082	24709082	TINF2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	15808	62
ZBTB25	7597	broad.mit.edu	37	14	64953897	64953897	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64953897C>T	uc001xhf.2	-	3	1235	c.1052G>A	c.(1051-1053)TGT>TAT	p.C351Y	ZBTB25_uc001xhc.2_Intron|ZBTB25_uc001xhg.2_Missense_Mutation_p.C351Y	NM_006977	NP_008908	P24278	ZBT25_HUMAN	zinc finger protein 46	351	C2H2-type 2.					cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		ACAGATGGTACAGCTCATTTT	0.368													54	102	---	---	---	---	capture	Missense_Mutation	SNP	64953897	64953897	ZBTB25	14	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17412	62
LTBP2	4053	broad.mit.edu	37	14	75017917	75017917	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75017917C>T	uc001xqa.2	-	7	1923	c.1536G>A	c.(1534-1536)CCG>CCA	p.P512P		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	512					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GCAGCCAGGGCGGGGGTCTGG	0.701													12	21	---	---	---	---	capture	Silent	SNP	75017917	75017917	LTBP2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8989	62
SERPINA3	12	broad.mit.edu	37	14	95085658	95085658	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95085658A>T	uc001ydp.2	+	3	849	c.770A>T	c.(769-771)GAG>GTG	p.E257V	SERPINA3_uc001ydo.3_Missense_Mutation_p.E282V|SERPINA3_uc001ydr.2_Intron|SERPINA3_uc001ydq.2_Missense_Mutation_p.E257V|SERPINA3_uc001yds.2_Missense_Mutation_p.E257V|SERPINA3_uc010avg.2_Missense_Mutation_p.E257V	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	257					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		TTCCGGGACGAGGAGCTGTCC	0.502													13	34	---	---	---	---	capture	Missense_Mutation	SNP	95085658	95085658	SERPINA3	14	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	13983	62
AHNAK2	113146	broad.mit.edu	37	14	105420083	105420083	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105420083G>C	uc010axc.1	-	7	1825	c.1705C>G	c.(1705-1707)CAG>GAG	p.Q569E	AHNAK2_uc001ypx.2_Missense_Mutation_p.Q469E	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	569						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCTTGTCCTGTTCCTCAGTG	0.542													16	237	---	---	---	---	capture	Missense_Mutation	SNP	105420083	105420083	AHNAK2	14	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	415	62
ATP8B4	79895	broad.mit.edu	37	15	50226374	50226374	+	Missense_Mutation	SNP	T	G	G	rs114705901	by1000genomes	TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50226374T>G	uc001zxu.2	-	15	1435	c.1293A>C	c.(1291-1293)AAA>AAC	p.K431N	ATP8B4_uc010ber.2_Missense_Mutation_p.K304N|ATP8B4_uc010ufd.1_Missense_Mutation_p.K304N|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	431	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CCACAGGCTCTTTTTCCTGTA	0.348													4	58	---	---	---	---	capture	Missense_Mutation	SNP	50226374	50226374	ATP8B4	15	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	1188	62
OR4F6	390648	broad.mit.edu	37	15	102346502	102346502	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:102346502A>G	uc010utr.1	+	1	580	c.580A>G	c.(580-582)ACA>GCA	p.T194A		NM_001005326	NP_001005326	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			AGAGACCTACACATTGGGATT	0.368													102	93	---	---	---	---	capture	Missense_Mutation	SNP	102346502	102346502	OR4F6	15	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	10970	62
CYLD	1540	broad.mit.edu	37	16	50783900	50783900	+	Silent	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50783900A>G	uc002egp.1	+	4	706	c.291A>G	c.(289-291)ACA>ACG	p.T97T	CYLD_uc002egn.1_Silent_p.T97T|CYLD_uc002ego.2_Silent_p.T97T|CYLD_uc010cbs.1_Silent_p.T97T|CYLD_uc002egq.1_Silent_p.T97T|CYLD_uc002egr.1_Silent_p.T97T|CYLD_uc002egs.1_Silent_p.T97T	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	97					cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				AAAAGTTCACAGAGTTACTTT	0.378			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				41	105	---	---	---	---	capture	Silent	SNP	50783900	50783900	CYLD	16	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	4103	62
ACCN1	40	broad.mit.edu	37	17	32483431	32483431	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:32483431G>A	uc002hhu.2	-	1	395	c.121C>T	c.(121-123)CGG>TGG	p.R41W		NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	41	Helical; (Potential).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	AGCACACGCCGGATGGTCAGC	0.602													13	35	---	---	---	---	capture	Missense_Mutation	SNP	32483431	32483431	ACCN1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	128	62
CDK12	51755	broad.mit.edu	37	17	37687203	37687203	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37687203C>T	uc010cvv.2	+	14	4693	c.4107C>T	c.(4105-4107)ACC>ACT	p.T1369T	CDK12_uc002hrw.3_Silent_p.T1360T	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	1369					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						TGGTCCAGACCCTGGTGAAGA	0.552										TCGA Ovarian(9;0.13)			9	63	---	---	---	---	capture	Silent	SNP	37687203	37687203	CDK12	17	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	3098	62
KRT222	125113	broad.mit.edu	37	17	38812778	38812778	+	Nonsense_Mutation	SNP	A	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38812778A>C	uc002hvc.2	-	6	829	c.764T>G	c.(763-765)TTA>TGA	p.L255*	KRT222_uc010wfk.1_RNA|KRT222_uc002hvb.2_Nonsense_Mutation_p.L215*	NM_152349	NP_689562	Q8N1A0	KT222_HUMAN	truncated type I keratin KA21	255						intermediate filament	structural molecule activity			central_nervous_system(1)|skin(1)	2						AGTGGCTGCTAAATGAAGATC	0.378													14	99	---	---	---	---	capture	Nonsense_Mutation	SNP	38812778	38812778	KRT222	17	A	C	C	C	1	0	0	0	0	0	1	0	0	169	13	5	4	8379	62
KRTAP4-11	653240	broad.mit.edu	37	17	39274206	39274206	+	Missense_Mutation	SNP	C	T	T	rs79388709		TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274206C>T	uc002hvz.2	-	1	401	c.362G>A	c.(361-363)AGA>AAA	p.R121K		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	20.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcactggggtctgcagcagct	0.100													5	38	---	---	---	---	capture	Missense_Mutation	SNP	39274206	39274206	KRTAP4-11	17	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8469	62
BRCA1	672	broad.mit.edu	37	17	41244603	41244603	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41244603G>A	uc002icq.2	-	10	3177	c.2945C>T	c.(2944-2946)CCA>CTA	p.P982L	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.P911L|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.P935L|BRCA1_uc002ict.2_Missense_Mutation_p.P982L|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.P982L|BRCA1_uc002ide.1_Missense_Mutation_p.P813L|BRCA1_uc010cyy.1_Missense_Mutation_p.P982L|BRCA1_uc010whs.1_Missense_Mutation_p.P982L|BRCA1_uc010cyz.2_Missense_Mutation_p.P935L|BRCA1_uc010cza.2_Missense_Mutation_p.P956L|BRCA1_uc010wht.1_Missense_Mutation_p.P686L	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	982					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGGAAAAAGTGGTGGTATACG	0.368			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			57	138	---	---	---	---	capture	Missense_Mutation	SNP	41244603	41244603	BRCA1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	1486	62
DCAF7	10238	broad.mit.edu	37	17	61657190	61657190	+	Silent	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61657190C>A	uc002jbc.2	+	4	631	c.414C>A	c.(412-414)ACC>ACA	p.T138T	DCAF7_uc002jbb.2_RNA|DCAF7_uc010wpn.1_Intron	NM_005828	NP_005819	P61962	DCAF7_HUMAN	WD-repeat protein	138	WD 2.				multicellular organismal development	CUL4 RING ubiquitin ligase complex|cytoplasm|nucleus	protein binding			ovary(1)	1						TTGCAGGTACCTCAAGCATTG	0.562													13	33	---	---	---	---	capture	Silent	SNP	61657190	61657190	DCAF7	17	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	4234	62
KPNA2	3838	broad.mit.edu	37	17	66033587	66033587	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66033587G>A	uc002jgk.2	+	3	321	c.189G>A	c.(187-189)CCG>CCA	p.P63P	KPNA2_uc002jgl.2_Silent_p.P63P	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	63					DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTACTTCTCCGCTGCAGGAAA	0.398													56	99	---	---	---	---	capture	Silent	SNP	66033587	66033587	KPNA2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8350	62
MGAT5B	146664	broad.mit.edu	37	17	74900424	74900424	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74900424G>A	uc002jti.2	+	5	746	c.643G>A	c.(643-645)GTC>ATC	p.V215I	MGAT5B_uc002jth.2_Missense_Mutation_p.V204I	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2	204	Lumenal (Potential).					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						CCTCAGTGAGGTCGAGTGGTT	0.662													10	9	---	---	---	---	capture	Missense_Mutation	SNP	74900424	74900424	MGAT5B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9461	62
ENGASE	64772	broad.mit.edu	37	17	77081816	77081816	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77081816G>A	uc002jwv.2	+	13	1823	c.1815G>A	c.(1813-1815)CAG>CAA	p.Q605Q	ENGASE_uc002jww.2_Silent_p.Q310Q	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	605						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						GAGAGATCCAGGTGATGCTTC	0.677													13	18	---	---	---	---	capture	Silent	SNP	77081816	77081816	ENGASE	17	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	5073	62
SMCHD1	23347	broad.mit.edu	37	18	2705783	2705783	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2705783G>T	uc002klm.3	+	14	2123	c.1934G>T	c.(1933-1935)GGA>GTA	p.G645V	SMCHD1_uc002klk.3_RNA|SMCHD1_uc002kll.3_5'Flank	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	645					chromosome organization		ATP binding				0						TATGCTACAGGAGGAGAGGTT	0.333													15	35	---	---	---	---	capture	Missense_Mutation	SNP	2705783	2705783	SMCHD1	18	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	14680	62
DSC1	1823	broad.mit.edu	37	18	28710546	28710546	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28710546C>T	uc002kwn.2	-	16	2878	c.2616G>A	c.(2614-2616)GAG>GAA	p.E872E	DSC1_uc002kwm.2_3'UTR|uc002kwo.1_5'Flank	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	872	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ACTCCAGTCCCTCTTCTTCCT	0.423													66	117	---	---	---	---	capture	Silent	SNP	28710546	28710546	DSC1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	4720	62
KIAA1012	22878	broad.mit.edu	37	18	29437807	29437807	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29437807C>T	uc002kxc.3	-	20	3248	c.2884G>A	c.(2884-2886)GGT>AGT	p.G962S	KIAA1012_uc002kxb.3_Missense_Mutation_p.G908S|KIAA1012_uc002kxd.3_Intron	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	962					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						GCAGTATTACCACCGAAAGTA	0.408													85	206	---	---	---	---	capture	Missense_Mutation	SNP	29437807	29437807	KIAA1012	18	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	8126	62
DOK6	220164	broad.mit.edu	37	18	67345078	67345078	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67345078G>A	uc002lkl.2	+	4	588	c.398G>A	c.(397-399)CGG>CAG	p.R133Q		NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6	133	IRS-type PTB.						insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				GGAGTGCAGCGGGAACAGAAT	0.438													9	42	---	---	---	---	capture	Missense_Mutation	SNP	67345078	67345078	DOK6	18	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4657	62
C3	718	broad.mit.edu	37	19	6677935	6677935	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6677935G>A	uc002mfm.2	-	41	5012	c.4950C>T	c.(4948-4950)GGC>GGT	p.G1650G	C3_uc002mfl.2_Silent_p.G386G	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1650	NTR.				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		CGGTGAAGGCGCCGAGGTCCT	0.562													32	66	---	---	---	---	capture	Silent	SNP	6677935	6677935	C3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2184	62
MRI1	84245	broad.mit.edu	37	19	13876915	13876915	+	Silent	SNP	G	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13876915G>C	uc002mxe.2	+	3	585	c.519G>C	c.(517-519)CTG>CTC	p.L173L	MRI1_uc002mxf.2_Intron	NM_001031727	NP_001026897	Q9BV20	MTNA_HUMAN	translation initiation factor eIF-2B subunit	173					L-methionine salvage from methylthioadenosine	cell projection|cytoplasm|nucleus	identical protein binding|S-methyl-5-thioribose-1-phosphate isomerase activity			ovary(1)	1						CTGGTGCTCTGGCCACCGCTG	0.552													10	46	---	---	---	---	capture	Silent	SNP	13876915	13876915	MRI1	19	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	9680	62
ZNF461	92283	broad.mit.edu	37	19	37129609	37129609	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37129609G>A	uc002oem.2	-	6	1866	c.1638C>T	c.(1636-1638)GGC>GGT	p.G546G	ZNF461_uc002oen.2_Silent_p.G515G|ZNF461_uc010xtj.1_Silent_p.G523G	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	546					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CTGGCTTCTCGCCAGTATGAA	0.388													9	26	---	---	---	---	capture	Silent	SNP	37129609	37129609	ZNF461	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17804	62
CATSPERG	57828	broad.mit.edu	37	19	38861189	38861189	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38861189C>T	uc002oih.3	+	29	3324	c.3237C>T	c.(3235-3237)GGC>GGT	p.G1079G	CATSPERG_uc002oig.3_Silent_p.G1039G|CATSPERG_uc002oif.3_Silent_p.G719G|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	1079	Helical; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						TGTTTGTGGGCCTGGTGATCT	0.522													19	112	---	---	---	---	capture	Silent	SNP	38861189	38861189	CATSPERG	19	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	2668	62
ZNF28	7576	broad.mit.edu	37	19	53303202	53303202	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53303202C>G	uc002qad.2	-	4	2016	c.1896G>C	c.(1894-1896)GAG>GAC	p.E632D	ZNF28_uc002qac.2_Missense_Mutation_p.E579D|ZNF28_uc010eqe.2_Missense_Mutation_p.E578D	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	632					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TGTAAGGTTTCTCTCCAGTAT	0.433													125	254	---	---	---	---	capture	Missense_Mutation	SNP	53303202	53303202	ZNF28	19	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	17693	62
ZNF28	7576	broad.mit.edu	37	19	53304215	53304215	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53304215C>T	uc002qad.2	-	4	1003	c.883G>A	c.(883-885)GCA>ACA	p.A295T	ZNF28_uc002qac.2_Missense_Mutation_p.A242T|ZNF28_uc010eqe.2_Missense_Mutation_p.A241T	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	295					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		GGTTTGTCTGCAGTATGAAGC	0.388													74	148	---	---	---	---	capture	Missense_Mutation	SNP	53304215	53304215	ZNF28	19	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	17693	62
ZNF28	7576	broad.mit.edu	37	19	53304299	53304299	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53304299C>G	uc002qad.2	-	4	919	c.799G>C	c.(799-801)GAT>CAT	p.D267H	ZNF28_uc002qac.2_Missense_Mutation_p.D214H|ZNF28_uc010eqe.2_Missense_Mutation_p.D213H	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	267					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		GGTTTCTCATCAATGTGAGAT	0.398													67	104	---	---	---	---	capture	Missense_Mutation	SNP	53304299	53304299	ZNF28	19	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	17693	62
LILRB3	11025	broad.mit.edu	37	19	54746595	54746595	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54746595C>T	uc010erh.1	-	1	130	c.6G>A	c.(4-6)ACG>ACA	p.T2T	LILRA6_uc002qew.1_Intron|LILRB3_uc002qeh.1_Silent_p.T2T|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Silent_p.T2T|LILRA6_uc002qek.1_Silent_p.T2T|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Silent_p.T2T|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Silent_p.T2T|LILRB3_uc002qep.1_Silent_p.T2T|LILRB3_uc002qeq.1_Silent_p.T2T|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Silent_p.T2T|LILRA6_uc010yep.1_Silent_p.T2T|LILRA6_uc010yeq.1_Silent_p.T2T|LILRA6_uc002qet.3_RNA|LILRA6_uc002qeu.1_Silent_p.T2T|LILRA6_uc002qev.1_5'Flank	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	2					cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGAGGGCGGGCGTCATGGCGT	0.647													15	36	---	---	---	---	capture	Silent	SNP	54746595	54746595	LILRB3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8712	62
NLRP7	199713	broad.mit.edu	37	19	55449588	55449588	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55449588C>T	uc002qih.3	-	5	2029	c.1953G>A	c.(1951-1953)CCG>CCA	p.P651P	NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Silent_p.P651P|NLRP7_uc010esk.2_Silent_p.P651P|NLRP7_uc010esl.2_Silent_p.P679P	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	651			P -> S (in HYDM).				ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		GAGCCCAGTTCGGAATGGTTA	0.453													18	98	---	---	---	---	capture	Silent	SNP	55449588	55449588	NLRP7	19	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	10389	62
PEG3	5178	broad.mit.edu	37	19	57335864	57335864	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57335864A>T	uc002qnu.2	-	1	511	c.160T>A	c.(160-162)TAT>AAT	p.Y54N	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_5'UTR|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.Y54N|PEG3_uc002qnv.2_Missense_Mutation_p.Y54N|PEG3_uc002qnw.2_Intron|PEG3_uc002qnx.2_Intron|PEG3_uc010etr.2_Missense_Mutation_p.Y54N	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	54	SCAN box.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AATTCCACATAGATTAGGTTC	0.498													6	100	---	---	---	---	capture	Missense_Mutation	SNP	57335864	57335864	PEG3	19	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	11623	62
CRIM1	51232	broad.mit.edu	37	2	36740894	36740894	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:36740894G>A	uc002rpd.2	+	11	2015	c.1976G>A	c.(1975-1977)TGC>TAC	p.C659Y		NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor	659	VWFC 3.|Extracellular (Potential).				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GGACAGTGCTGCCCATCATGT	0.388													4	28	---	---	---	---	capture	Missense_Mutation	SNP	36740894	36740894	CRIM1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	3838	62
ZNF638	27332	broad.mit.edu	37	2	71592818	71592818	+	Silent	SNP	T	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71592818T>G	uc002shx.2	+	6	2296	c.1977T>G	c.(1975-1977)GCT>GCG	p.A659A	ZNF638_uc010fec.2_Silent_p.A765A|ZNF638_uc010yqw.1_Silent_p.A238A|ZNF638_uc002shw.2_Silent_p.A659A|ZNF638_uc002shy.2_Silent_p.A659A|ZNF638_uc002shz.2_Silent_p.A659A|ZNF638_uc002sia.2_Silent_p.A659A|ZNF638_uc002sib.1_Silent_p.A659A|ZNF638_uc010fed.2_RNA	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	659					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						CTGATAAAGCTGTTTCTCTCC	0.229													11	37	---	---	---	---	capture	Silent	SNP	71592818	71592818	ZNF638	2	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	17933	62
SLC9A2	6549	broad.mit.edu	37	2	103324656	103324656	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103324656C>A	uc002tca.2	+	12	2289	c.2147C>A	c.(2146-2148)CCA>CAA	p.P716Q		NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN	solute carrier family 9 (sodium/hydrogen	716	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			central_nervous_system(3)|skin(3)|breast(2)	8						CGCTTCTTGCCAGAACAGTTC	0.527													60	120	---	---	---	---	capture	Missense_Mutation	SNP	103324656	103324656	SLC9A2	2	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	14604	62
UGGT1	56886	broad.mit.edu	37	2	128867271	128867271	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128867271A>G	uc002tps.2	+	5	650	c.472A>G	c.(472-474)ACT>GCT	p.T158A	UGGT1_uc010fme.1_Missense_Mutation_p.T33A|UGGT1_uc002tpr.2_Missense_Mutation_p.T134A	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	158					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						TGGAAAGAAGACTTGTGAATC	0.388													29	87	---	---	---	---	capture	Missense_Mutation	SNP	128867271	128867271	UGGT1	2	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	16823	62
TTN	7273	broad.mit.edu	37	2	179641950	179641950	+	Silent	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179641950C>A	uc010zfg.1	-	27	4964	c.4740G>T	c.(4738-4740)ACG>ACT	p.T1580T	TTN_uc010zfh.1_Silent_p.T1534T|TTN_uc010zfi.1_Silent_p.T1534T|TTN_uc010zfj.1_Silent_p.T1534T|TTN_uc002unb.2_Silent_p.T1580T|uc002unc.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1580							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGGGTTACCCGTAGCTCTGA	0.373													7	192	---	---	---	---	capture	Silent	SNP	179641950	179641950	TTN	2	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	16617	62
PTH2R	5746	broad.mit.edu	37	2	209308179	209308179	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209308179G>C	uc002vdb.2	+	6	829	c.616G>C	c.(616-618)GGA>CGA	p.G206R	PTH2R_uc010zjb.1_Missense_Mutation_p.G217R	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor	206	Extracellular (Potential).					integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		TGCTCACATAGGAGTAAAGGA	0.413													22	73	---	---	---	---	capture	Missense_Mutation	SNP	209308179	209308179	PTH2R	2	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	12655	62
TRPM8	79054	broad.mit.edu	37	2	234869493	234869493	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234869493A>G	uc002vvh.2	+	12	1476	c.1436A>G	c.(1435-1437)GAG>GGG	p.E479G	TRPM8_uc010fyj.2_Missense_Mutation_p.E167G	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	479	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CTCTTTCTGGAGAATGGCTTG	0.483													7	129	---	---	---	---	capture	Missense_Mutation	SNP	234869493	234869493	TRPM8	2	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	16475	62
COL6A3	1293	broad.mit.edu	37	2	238283454	238283454	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238283454C>T	uc002vwl.2	-	8	3565	c.3280G>A	c.(3280-3282)GCT>ACT	p.A1094T	COL6A3_uc002vwo.2_Missense_Mutation_p.A888T|COL6A3_uc010znj.1_Missense_Mutation_p.A487T|COL6A3_uc002vwq.2_Missense_Mutation_p.A888T|COL6A3_uc002vwr.2_Missense_Mutation_p.A687T	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1094	Nonhelical region.|VWFA 6.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGGCGGACAGCGTTGACGACG	0.652													13	49	---	---	---	---	capture	Missense_Mutation	SNP	238283454	238283454	COL6A3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3666	62
UMODL1	89766	broad.mit.edu	37	21	43519135	43519135	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43519135T>G	uc002zaf.1	+	7	1031	c.1031T>G	c.(1030-1032)GTC>GGC	p.V344G	UMODL1_uc002zad.1_Missense_Mutation_p.V272G|UMODL1_uc002zae.1_Missense_Mutation_p.V272G|UMODL1_uc002zag.1_Missense_Mutation_p.V344G|UMODL1_uc010gow.1_Missense_Mutation_p.V136G|UMODL1_uc002zai.1_5'UTR|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_5'UTR|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Missense_Mutation_p.V89G	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	344	Extracellular (Potential).|Fibronectin type-III 1.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						ACTTTCCATGTCCGGGTTTAC	0.547													52	115	---	---	---	---	capture	Missense_Mutation	SNP	43519135	43519135	UMODL1	21	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	16862	62
DGCR2	9993	broad.mit.edu	37	22	19044577	19044577	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19044577G>C	uc002zoq.1	-	6	972	c.724C>G	c.(724-726)CCC>GCC	p.P242A	DGCR2_uc002zor.1_Missense_Mutation_p.P18A|DGCR2_uc011agr.1_Missense_Mutation_p.P198A	NM_005137	NP_005128	P98153	IDD_HUMAN	integral membrane protein DGCR2 precursor	242	Extracellular (Potential).				cell adhesion|organ morphogenesis	integral to membrane	receptor activity|sugar binding			large_intestine(1)	1	Colorectal(54;0.0993)					CGCAGGGTGGGGAAATGGAAG	0.572													5	3	---	---	---	---	capture	Missense_Mutation	SNP	19044577	19044577	DGCR2	22	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	4419	62
CACNA1I	8911	broad.mit.edu	37	22	39966921	39966921	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39966921C>T	uc003ayc.2	+	1	164	c.164C>T	c.(163-165)GCG>GTG	p.A55V	CACNA1I_uc003ayd.2_Missense_Mutation_p.A55V	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	55	Cytoplasmic (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	CCAGACCTGGCGCCTATTGCC	0.657													30	115	---	---	---	---	capture	Missense_Mutation	SNP	39966921	39966921	CACNA1I	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2522	62
TGFBR2	7048	broad.mit.edu	37	3	30691812	30691812	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:30691812A>T	uc003ceo.2	+	3	696	c.314A>T	c.(313-315)AAG>ATG	p.K105M	TGFBR2_uc003cen.2_Missense_Mutation_p.K130M	NM_003242	NP_003233	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II	105	Extracellular (Potential).				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						CATGACCCCAAGCTCCCCTAC	0.443													14	141	---	---	---	---	capture	Missense_Mutation	SNP	30691812	30691812	TGFBR2	3	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	15707	62
KBTBD5	131377	broad.mit.edu	37	3	42729720	42729720	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42729720C>T	uc003clv.1	+	2	1339	c.1239C>T	c.(1237-1239)TCC>TCT	p.S413S		NM_152393	NP_689606	Q2TBA0	KBTB5_HUMAN	kelch repeat and BTB (POZ) domain containing 5	413	Kelch 2.									ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CTCTCAACTCCATCTACGTGG	0.637													25	56	---	---	---	---	capture	Silent	SNP	42729720	42729720	KBTBD5	3	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	7918	62
MORC1	27136	broad.mit.edu	37	3	108819325	108819325	+	Silent	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108819325G>T	uc003dxl.2	-	5	340	c.253C>A	c.(253-255)CGA>AGA	p.R85R	MORC1_uc011bhn.1_Silent_p.R85R	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	85					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TTTTTGGATCGTCCAAAGTAA	0.408													12	217	---	---	---	---	capture	Silent	SNP	108819325	108819325	MORC1	3	G	T	T	T	1	0	0	0	0	0	0	0	1	519	40	4	4	9613	62
FBXL5	26234	broad.mit.edu	37	4	15632339	15632339	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15632339T>G	uc003goc.1	-	6	945	c.842A>C	c.(841-843)GAA>GCA	p.E281A	FBXL5_uc010idw.1_Missense_Mutation_p.E194A|FBXL5_uc003gob.1_Missense_Mutation_p.E155A|FBXL5_uc010idx.1_Missense_Mutation_p.E280A|FBXL5_uc003god.1_Missense_Mutation_p.E264A|FBXL5_uc010idy.1_Missense_Mutation_p.E281A	NM_012161	NP_036293	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5 isoform	281					iron ion homeostasis|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|SCF ubiquitin ligase complex	iron ion binding|protein binding|ubiquitin-protein ligase activity				0						AGCACGACTTTCATCTTTCCT	0.343													21	73	---	---	---	---	capture	Missense_Mutation	SNP	15632339	15632339	FBXL5	4	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	5668	62
CLOCK	9575	broad.mit.edu	37	4	56336906	56336906	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:56336906G>T	uc003haz.1	-	9	1342	c.416C>A	c.(415-417)ACT>AAT	p.T139N	CLOCK_uc003hba.1_Missense_Mutation_p.T139N	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	139	PAS 1.				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			AAGTAATGAAGTTACACTCTC	0.299													40	180	---	---	---	---	capture	Missense_Mutation	SNP	56336906	56336906	CLOCK	4	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	3514	62
UGT2B7	7364	broad.mit.edu	37	4	69962642	69962642	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69962642A>T	uc003heg.3	+	1	450	c.404A>T	c.(403-405)AAA>ATA	p.K135I	UGT2B7_uc010ihq.2_Missense_Mutation_p.K135I	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	135					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						TCAAATAAGAAATTTATGAAA	0.313													30	70	---	---	---	---	capture	Missense_Mutation	SNP	69962642	69962642	UGT2B7	4	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	16844	62
UGT2B4	7363	broad.mit.edu	37	4	70351106	70351106	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70351106G>T	uc003hek.3	-	5	1177	c.1130C>A	c.(1129-1131)GCC>GAC	p.A377D	UGT2B4_uc011cap.1_Missense_Mutation_p.A241D|UGT2B4_uc003hel.3_Intron	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	377					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						GATGCCATTGGCTCCACCATG	0.413													79	216	---	---	---	---	capture	Missense_Mutation	SNP	70351106	70351106	UGT2B4	4	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	16843	62
ANK2	287	broad.mit.edu	37	4	114274747	114274747	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114274747T>C	uc003ibe.3	+	38	5073	c.4973T>C	c.(4972-4974)GTT>GCT	p.V1658A	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Missense_Mutation_p.V1673A	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1625					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGCAGACAGTTCAAGATAAG	0.473													8	112	---	---	---	---	capture	Missense_Mutation	SNP	114274747	114274747	ANK2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	618	62
CTNND2	1501	broad.mit.edu	37	5	11236806	11236806	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:11236806G>A	uc003jfa.1	-	10	1903	c.1758C>T	c.(1756-1758)GCC>GCT	p.A586A	CTNND2_uc010itt.2_Silent_p.A495A|CTNND2_uc011cmy.1_Silent_p.A249A|CTNND2_uc011cmz.1_Silent_p.A153A|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.A153A	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	586	ARM 3.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						CACTGACCTCGGCTTTAATTT	0.443													20	184	---	---	---	---	capture	Silent	SNP	11236806	11236806	CTNND2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3983	62
SLIT3	6586	broad.mit.edu	37	5	168098222	168098222	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168098222C>T	uc003mab.2	-	34	4528	c.4108G>A	c.(4108-4110)GAC>AAC	p.D1370N	SLIT3_uc010jjg.2_Missense_Mutation_p.D1377N	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	1370	EGF-like 8.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGCAGGGGTCCCGGGCCTCC	0.672													12	39	---	---	---	---	capture	Missense_Mutation	SNP	168098222	168098222	SLIT3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	14633	62
KIF13A	63971	broad.mit.edu	37	6	17826293	17826293	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17826293A>G	uc003ncg.3	-	15	1700	c.1595T>C	c.(1594-1596)CTA>CCA	p.L532P	KIF13A_uc003ncf.2_Missense_Mutation_p.L532P|KIF13A_uc003nch.3_Missense_Mutation_p.L532P|KIF13A_uc003nci.3_Missense_Mutation_p.L532P|KIF13A_uc003ncj.2_Missense_Mutation_p.L208P	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	532					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			ATTTCCCCATAGGATTCGGTC	0.398													17	88	---	---	---	---	capture	Missense_Mutation	SNP	17826293	17826293	KIF13A	6	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	8196	62
OR2B3	442184	broad.mit.edu	37	6	29054831	29054831	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29054831A>T	uc003nlx.2	-	1	260	c.195T>A	c.(193-195)AAT>AAA	p.N65K		NM_001005226	NP_001005226			olfactory receptor, family 2, subfamily B,											skin(1)	1						AGATGGAGAGATTAGTGAGAA	0.398													6	93	---	---	---	---	capture	Missense_Mutation	SNP	29054831	29054831	OR2B3	6	A	T	T	T	1	0	0	0	0	1	0	0	0	154	12	4	4	10894	62
BTNL2	56244	broad.mit.edu	37	6	32372722	32372722	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32372722C>T	uc003obg.1	-	2	421	c.421G>A	c.(421-423)GTA>ATA	p.V141I	BTNL2_uc010jty.1_Intron|BTNL2_uc010jtz.1_Intron|BTNL2_uc010jua.1_Intron	NM_019602	NP_062548	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2	141	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1						TCACCTGCTACTTTGAGCAGC	0.448													14	97	---	---	---	---	capture	Missense_Mutation	SNP	32372722	32372722	BTNL2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	1553	62
CGA	1081	broad.mit.edu	37	6	87796012	87796012	+	Missense_Mutation	SNP	C	T	T	rs145503313		TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:87796012C>T	uc003plj.1	-	3	330	c.229G>A	c.(229-231)GTC>ATC	p.V77I		NM_000735	NP_000726	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	77					hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity			ovary(1)	1		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		TCTGAGGTGACGTTCTTTTGG	0.483													64	149	---	---	---	---	capture	Missense_Mutation	SNP	87796012	87796012	CGA	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3261	62
LAMA2	3908	broad.mit.edu	37	6	129813614	129813614	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:129813614C>T	uc003qbn.2	+	57	8335	c.8230C>T	c.(8230-8232)CCA>TCA	p.P2744S	LAMA2_uc003qbo.2_Missense_Mutation_p.P2740S|uc003qbq.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2744					cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TACGCCCACCCCAGTTCTGAC	0.443													8	99	---	---	---	---	capture	Missense_Mutation	SNP	129813614	129813614	LAMA2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8526	62
PLG	5340	broad.mit.edu	37	6	161127532	161127532	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161127532A>G	uc003qtm.3	+	2	206	c.143A>G	c.(142-144)GAA>GGA	p.E48G		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	48	PAN.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	AGTATAGAAGAATGTGCAGCA	0.468													74	123	---	---	---	---	capture	Missense_Mutation	SNP	161127532	161127532	PLG	6	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	11989	62
C7orf41	222166	broad.mit.edu	37	7	30174862	30174862	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30174862C>T	uc011kab.1	+	1	311	c.110C>T	c.(109-111)CCC>CTC	p.P37L	C7orf41_uc010kvr.1_RNA|C7orf41_uc003tar.1_Missense_Mutation_p.P37L	NM_152793	NP_690006	Q8N3F0	CG041_HUMAN	hypothetical protein LOC222166	37											0						TACGCCGACCCCGGCGTCTCC	0.642													5	20	---	---	---	---	capture	Missense_Mutation	SNP	30174862	30174862	C7orf41	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	2368	62
PDE1C	5137	broad.mit.edu	37	7	31855588	31855588	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31855588C>T	uc003tcm.1	-	15	2232	c.1763G>A	c.(1762-1764)CGT>CAT	p.R588H	PDE1C_uc003tcn.1_Missense_Mutation_p.R588H|PDE1C_uc003tco.1_Missense_Mutation_p.R648H|PDE1C_uc003tcr.2_Missense_Mutation_p.R588H|PDE1C_uc003tcs.2_Missense_Mutation_p.R588H	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	588					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GTTTTTCCCACGAGGGTTGTC	0.468													91	347	---	---	---	---	capture	Missense_Mutation	SNP	31855588	31855588	PDE1C	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11538	62
C7orf10	79783	broad.mit.edu	37	7	40228112	40228112	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40228112G>A	uc003thn.1	+	4	290	c.245G>A	c.(244-246)CGA>CAA	p.R82Q	C7orf10_uc003thm.1_Missense_Mutation_p.R89Q|C7orf10_uc003tho.1_Missense_Mutation_p.R82Q	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	89							transferase activity			ovary(2)	2						GATGATACACGAACTTGGGGG	0.279													6	41	---	---	---	---	capture	Missense_Mutation	SNP	40228112	40228112	C7orf10	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2353	62
EGFR	1956	broad.mit.edu	37	7	55223624	55223624	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55223624G>A	uc003tqk.2	+	8	1237	c.991G>A	c.(991-993)GGG>AGG	p.G331R	EGFR_uc003tqh.2_Missense_Mutation_p.G331R|EGFR_uc003tqi.2_Missense_Mutation_p.G331R|EGFR_uc003tqj.2_Missense_Mutation_p.G331R|EGFR_uc010kzg.1_Missense_Mutation_p.G286R|EGFR_uc011kco.1_Missense_Mutation_p.G278R|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	331	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GAAGTGCGAAGGGCCTTGCCG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			5	34	---	---	---	---	capture	Missense_Mutation	SNP	55223624	55223624	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	4922	62
WBSCR17	64409	broad.mit.edu	37	7	71130459	71130459	+	Nonsense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71130459A>T	uc003tvy.2	+	7	1144	c.1144A>T	c.(1144-1146)AAG>TAG	p.K382*	WBSCR17_uc003tvz.2_Nonsense_Mutation_p.K81*	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	382	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CATTGAGCGGAAGAAGAAGCC	0.488													11	182	---	---	---	---	capture	Nonsense_Mutation	SNP	71130459	71130459	WBSCR17	7	A	T	T	T	1	0	0	0	0	0	1	0	0	117	9	5	4	17145	62
MLXIPL	51085	broad.mit.edu	37	7	73011056	73011056	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73011056G>A	uc003tyn.1	-	11	1783	c.1735C>T	c.(1735-1737)CGG>TGG	p.R579W	MLXIPL_uc003tyj.1_Intron|MLXIPL_uc003tyk.1_Missense_Mutation_p.R579W|MLXIPL_uc003tyl.1_Missense_Mutation_p.R579W|MLXIPL_uc003tym.1_Missense_Mutation_p.R579W|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Missense_Mutation_p.R485W|MLXIPL_uc003tyq.1_Missense_Mutation_p.R346W	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14	579					anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				GGAGGTGGCCGGGGCGGTGTA	0.692													5	10	---	---	---	---	capture	Missense_Mutation	SNP	73011056	73011056	MLXIPL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	9549	62
SEMA3C	10512	broad.mit.edu	37	7	80390932	80390932	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80390932C>A	uc003uhj.2	-	14	2047	c.1485G>T	c.(1483-1485)AAG>AAT	p.K495N	SEMA3C_uc011kgw.1_Missense_Mutation_p.K513N	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	495	Sema.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						TAGTTTTTACCTTTTTAGATG	0.229													11	39	---	---	---	---	capture	Missense_Mutation	SNP	80390932	80390932	SEMA3C	7	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	13919	62
PCLO	27445	broad.mit.edu	37	7	82581469	82581469	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82581469C>T	uc003uhx.2	-	5	9089	c.8800G>A	c.(8800-8802)GCA>ACA	p.A2934T	PCLO_uc003uhv.2_Missense_Mutation_p.A2934T|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2865					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTTCTCCCTGCGGTTAAATCA	0.433													35	194	---	---	---	---	capture	Missense_Mutation	SNP	82581469	82581469	PCLO	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11486	62
SAMD9L	219285	broad.mit.edu	37	7	92761300	92761300	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92761300T>C	uc003umh.1	-	5	5201	c.3985A>G	c.(3985-3987)AGG>GGG	p.R1329G	SAMD9L_uc003umj.1_Missense_Mutation_p.R1329G|SAMD9L_uc003umi.1_Missense_Mutation_p.R1329G|SAMD9L_uc010lfb.1_Missense_Mutation_p.R1329G|SAMD9L_uc003umk.1_Missense_Mutation_p.R1329G|SAMD9L_uc010lfc.1_Missense_Mutation_p.R1329G|SAMD9L_uc010lfd.1_Missense_Mutation_p.R1329G|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1329										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			AGCTTTTTCCTGCAATTCTCC	0.388													48	161	---	---	---	---	capture	Missense_Mutation	SNP	92761300	92761300	SAMD9L	7	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	13719	62
HEPACAM2	253012	broad.mit.edu	37	7	92848596	92848596	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92848596G>A	uc003umm.2	-	2	271	c.248C>T	c.(247-249)TCT>TTT	p.S83F	HEPACAM2_uc003uml.2_Missense_Mutation_p.S71F|HEPACAM2_uc010lff.2_Missense_Mutation_p.S71F|HEPACAM2_uc011khy.1_Missense_Mutation_p.S106F	NM_001039372	NP_001034461	A8MVW5	HECA2_HUMAN	HEPACAM family member 2 isoform 1	83	Extracellular (Potential).					integral to membrane				ovary(3)|breast(1)|kidney(1)	5						CTTATTCACAGAGCCCAGTAA	0.478													35	101	---	---	---	---	capture	Missense_Mutation	SNP	92848596	92848596	HEPACAM2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	6979	62
NPTX2	4885	broad.mit.edu	37	7	98254367	98254367	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98254367C>T	uc003upl.2	+	3	954	c.777C>T	c.(775-777)AGC>AGT	p.S259S		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	259	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			TGCGGTCCAGCGCCTCACCAG	0.607													8	241	---	---	---	---	capture	Silent	SNP	98254367	98254367	NPTX2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	10510	62
LAMB4	22798	broad.mit.edu	37	7	107720190	107720190	+	Silent	SNP	A	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107720190A>C	uc010ljo.1	-	15	1827	c.1743T>G	c.(1741-1743)GTT>GTG	p.V581V	LAMB4_uc003vey.2_Silent_p.V581V	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	581	Laminin IV type B.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						GCTCTCCTAAAACAACGTGAA	0.502													7	55	---	---	---	---	capture	Silent	SNP	107720190	107720190	LAMB4	7	A	C	C	C	1	0	0	0	0	0	0	0	1	2	1	4	4	8533	62
EPHA1	2041	broad.mit.edu	37	7	143095767	143095767	+	Silent	SNP	G	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143095767G>C	uc003wcz.2	-	6	1350	c.1263C>G	c.(1261-1263)GCC>GCG	p.A421A		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	421	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CTCCATTTTGGGCTTCCACAT	0.607													8	122	---	---	---	---	capture	Silent	SNP	143095767	143095767	EPHA1	7	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	5120	62
GIMAP4	55303	broad.mit.edu	37	7	150269791	150269791	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150269791C>T	uc003whl.2	+	3	715	c.633C>T	c.(631-633)CGC>CGT	p.R211R	GIMAP4_uc011kuu.1_Silent_p.R72R|GIMAP4_uc011kuv.1_Silent_p.R225R	NM_018326	NP_060796	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	211	Potential.						GTP binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGATCCAGCGCGTGGTGAGGG	0.542													42	110	---	---	---	---	capture	Silent	SNP	150269791	150269791	GIMAP4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6320	62
KCNU1	157855	broad.mit.edu	37	8	36693858	36693858	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:36693858T>A	uc010lvw.2	+	13	1427	c.1340T>A	c.(1339-1341)ATA>AAA	p.I447K	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	447	RCK N-terminal.|Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGAATCATCATACAGATACTG	0.358													33	118	---	---	---	---	capture	Missense_Mutation	SNP	36693858	36693858	KCNU1	8	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	8015	62
TMEM70	54968	broad.mit.edu	37	8	74893724	74893724	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:74893724A>C	uc003yab.2	+	3	738	c.651A>C	c.(649-651)AAA>AAC	p.K217N	TMEM70_uc003yac.2_3'UTR	NM_017866	NP_060336	Q9BUB7	TMM70_HUMAN	transmembrane protein 70 isoform a	217					mitochondrial proton-transporting ATP synthase complex assembly	integral to mitochondrial membrane|mitochondrial inner membrane				ovary(1)	1	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			CTAAAACAAAATCACTGTTAG	0.343													5	124	---	---	---	---	capture	Missense_Mutation	SNP	74893724	74893724	TMEM70	8	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	16082	62
KIAA0196	9897	broad.mit.edu	37	8	126056120	126056120	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:126056120C>T	uc003yrt.2	-	23	3126	c.2797G>A	c.(2797-2799)GCC>ACC	p.A933T	KIAA0196_uc011lir.1_Missense_Mutation_p.A785T|KIAA0196_uc003yru.1_Missense_Mutation_p.A507T	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin	933					cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TTGGCAATGGCGGAAAAATAA	0.353													28	50	---	---	---	---	capture	Missense_Mutation	SNP	126056120	126056120	KIAA0196	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8083	62
GPR20	2843	broad.mit.edu	37	8	142367229	142367229	+	Silent	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142367229C>A	uc003ywf.2	-	2	884	c.795G>T	c.(793-795)GCG>GCT	p.A265A		NM_005293	NP_005284	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	265	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			CGGGCCACAGCGCCACGGCCA	0.657													14	27	---	---	---	---	capture	Silent	SNP	142367229	142367229	GPR20	8	C	A	A	A	1	0	0	0	0	0	0	0	1	340	27	4	4	6614	62
SMARCA2	6595	broad.mit.edu	37	9	2104169	2104169	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2104169G>A	uc003zhc.2	+	23	3391	c.3292G>A	c.(3292-3294)GGC>AGC	p.G1098S	SMARCA2_uc003zhd.2_Missense_Mutation_p.G1098S|SMARCA2_uc010mha.2_Missense_Mutation_p.G1031S	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	1098	Helicase C-terminal.				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		ACGCCTTGATGGTAAGTGCAT	0.438													30	47	---	---	---	---	capture	Missense_Mutation	SNP	2104169	2104169	SMARCA2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	14661	62
TRPM3	80036	broad.mit.edu	37	9	73152156	73152156	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:73152156G>T	uc004aid.2	-	25	4081	c.3837C>A	c.(3835-3837)AAC>AAA	p.N1279K	TRPM3_uc004ahu.2_Missense_Mutation_p.N1121K|TRPM3_uc004ahv.2_Missense_Mutation_p.N1081K|TRPM3_uc004ahw.2_Missense_Mutation_p.N1151K|TRPM3_uc004ahx.2_Missense_Mutation_p.N1138K|TRPM3_uc004ahy.2_Missense_Mutation_p.N1141K|TRPM3_uc004ahz.2_Missense_Mutation_p.N1128K|TRPM3_uc004aia.2_Missense_Mutation_p.N1126K|TRPM3_uc004aib.2_Missense_Mutation_p.N1116K|TRPM3_uc004aic.2_Missense_Mutation_p.N1279K	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	1304	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						AGCGGATTTTGTTGGACTCGG	0.627													9	99	---	---	---	---	capture	Missense_Mutation	SNP	73152156	73152156	TRPM3	9	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	16470	62
TRPM6	140803	broad.mit.edu	37	9	77377948	77377948	+	Silent	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:77377948A>G	uc004ajl.1	-	26	3877	c.3639T>C	c.(3637-3639)GAT>GAC	p.D1213D	TRPM6_uc004ajk.1_Silent_p.D1208D|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Silent_p.D169D	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	1213	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GGGCAGAGAGATCCTGCAGGT	0.463													31	112	---	---	---	---	capture	Silent	SNP	77377948	77377948	TRPM6	9	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	16473	62
TTC16	158248	broad.mit.edu	37	9	130489287	130489287	+	Silent	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130489287G>T	uc004brq.1	+	11	1531	c.1464G>T	c.(1462-1464)TCG>TCT	p.S488S	PTRH1_uc011mah.1_5'Flank|TTC16_uc011mai.1_Silent_p.S475S|TTC16_uc004brr.1_Intron|TTC16_uc010mxn.1_Silent_p.S84S	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	488							binding				0						CGGGCATGTCGGTGGAGGAGG	0.642													47	128	---	---	---	---	capture	Silent	SNP	130489287	130489287	TTC16	9	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	16565	62
RXRA	6256	broad.mit.edu	37	9	137309139	137309139	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137309139A>T	uc004cfb.2	+	5	908	c.746A>T	c.(745-747)TAC>TTC	p.Y249F	RXRA_uc004cfc.1_Missense_Mutation_p.Y152F|RXRA_uc004cfd.1_Missense_Mutation_p.Y20F	NM_002957	NP_002948	P19793	RXRA_HUMAN	retinoid X receptor, alpha	249	Ligand-binding.				cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)	ACCGAGACCTACGTGGAGGCA	0.622													25	40	---	---	---	---	capture	Missense_Mutation	SNP	137309139	137309139	RXRA	9	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	13655	62
DDX53	168400	broad.mit.edu	37	X	23019452	23019452	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:23019452G>T	uc004daj.2	+	1	1366	c.1278G>T	c.(1276-1278)ATG>ATT	p.M426I		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	426	Helicase ATP-binding.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						AAGATCCTATGATTGTTTATG	0.373													69	191	---	---	---	---	capture	Missense_Mutation	SNP	23019452	23019452	DDX53	23	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	4329	62
PIM2	11040	broad.mit.edu	37	X	48775821	48775821	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48775821G>A	uc004dls.2	-	2	465	c.163C>T	c.(163-165)CGA>TGA	p.R55*		NM_006875	NP_006866	Q9P1W9	PIM2_HUMAN	serine/threonine protein kinase pim-2	55	Protein kinase.				anti-apoptosis|cell proliferation|male meiosis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|response to virus		ATP binding|protein serine/threonine kinase activity			lung(3)|stomach(1)	4						ACCTGGAGTCGATCTGTGAGG	0.652													14	42	---	---	---	---	capture	Nonsense_Mutation	SNP	48775821	48775821	PIM2	23	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	11831	62
CSTF2	1478	broad.mit.edu	37	X	100075410	100075410	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100075410C>T	uc004egh.2	+	1	63	c.5C>T	c.(4-6)GCG>GTG	p.A2V	CSTF2_uc010nnd.2_Missense_Mutation_p.A2V|CSTF2_uc004egi.2_Missense_Mutation_p.A2V	NM_001325	NP_001316	P33240	CSTF2_HUMAN	cleavage stimulation factor subunit 2	2					mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cleavage body|mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding			skin(1)	1						AGAGCTATGGCGGGTTTGACT	0.597													16	49	---	---	---	---	capture	Missense_Mutation	SNP	100075410	100075410	CSTF2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3949	62
BCORL1	63035	broad.mit.edu	37	X	129155121	129155121	+	Silent	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129155121G>A	uc004evb.1	+	5	3717	c.3603G>A	c.(3601-3603)GAG>GAA	p.E1201E	BCORL1_uc010nrd.1_Silent_p.E1103E	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1201					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						ACAGCCACGAGGAAGGTAGGC	0.637													8	25	---	---	---	---	capture	Silent	SNP	129155121	129155121	BCORL1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	1376	62
SLC25A14	9016	broad.mit.edu	37	X	129506901	129506901	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129506901C>A	uc004evn.1	+	11	1168	c.955C>A	c.(955-957)CAG>AAG	p.Q319K	SLC25A14_uc004evo.1_Missense_Mutation_p.Q140K|SLC25A14_uc004evp.1_Missense_Mutation_p.Q319K|SLC25A14_uc004evq.1_Missense_Mutation_p.Q316K|SLC25A14_uc004evr.1_Missense_Mutation_p.Q347K	NM_003951	NP_003942	O95258	UCP5_HUMAN	solute carrier family 25, member 14 isoform	319	Solcar 3.				aerobic respiration|mitochondrial transport	integral to plasma membrane|mitochondrial inner membrane	binding			ovary(1)	1						TACATACGAGCAGCTAAAGAG	0.398													99	354	---	---	---	---	capture	Missense_Mutation	SNP	129506901	129506901	SLC25A14	23	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	14368	62
FRMD7	90167	broad.mit.edu	37	X	131214270	131214270	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131214270C>A	uc004ewn.2	-	10	1108	c.930G>T	c.(928-930)TTG>TTT	p.L310F	FRMD7_uc011muy.1_Missense_Mutation_p.L295F	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	310					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TCCCATATTCCAAAAGTTGCC	0.373													6	113	---	---	---	---	capture	Missense_Mutation	SNP	131214270	131214270	FRMD7	23	C	A	A	A	1	0	0	0	0	1	0	0	0	272	21	4	4	5998	62
SPANXN3	139067	broad.mit.edu	37	X	142596854	142596854	+	Silent	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142596854C>T	uc004fbw.2	-	2	304	c.216G>A	c.(214-216)CAG>CAA	p.Q72Q		NM_001009609	NP_001009609	Q5MJ09	SPXN3_HUMAN	SPANX-N3 protein	72										ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCTTGGGACTGTTCATTCT	0.388													72	182	---	---	---	---	capture	Silent	SNP	142596854	142596854	SPANXN3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	14884	62
UBE2NL	389898	broad.mit.edu	37	X	142967366	142967366	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142967366G>A	uc004fca.2	+	1	194	c.164G>A	c.(163-165)CGT>CAT	p.R55H		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	55							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					ACTTTTAAACGTGAACTATTA	0.418													71	186	---	---	---	---	capture	Missense_Mutation	SNP	142967366	142967366	UBE2NL	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16749	62
UBE2NL	389898	broad.mit.edu	37	X	142967428	142967428	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142967428A>G	uc004fca.2	+	1	256	c.226A>G	c.(226-228)ATT>GTT	p.I76V		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	76							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					CATGACCAAAATTTATCATCC	0.408													61	143	---	---	---	---	capture	Missense_Mutation	SNP	142967428	142967428	UBE2NL	23	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	16749	62
IRAK1	3654	broad.mit.edu	37	X	153278845	153278845	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153278845C>T	uc004fjs.1	-	12	1658	c.1579G>A	c.(1579-1581)GGG>AGG	p.G527R	IRAK1_uc004fjr.1_Intron|IRAK1_uc004fjt.1_Missense_Mutation_p.G448R|IRAK1_uc010nur.2_Intron	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	527					activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGGGCACCCCCGCCACCACT	0.667													15	48	---	---	---	---	capture	Missense_Mutation	SNP	153278845	153278845	IRAK1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7744	62
F8	2157	broad.mit.edu	37	X	154225292	154225292	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154225292A>T	uc004fmt.2	-	3	515	c.344T>A	c.(343-345)GTC>GAC	p.V115D	F8_uc011mzx.1_Missense_Mutation_p.V80D	NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	115	Plastocyanin-like 1.|F5/8 type A 1.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	ATGAAGACTGACAGGATGGGA	0.448													93	230	---	---	---	---	capture	Missense_Mutation	SNP	154225292	154225292	F8	23	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	5304	62
KPNA6	23633	broad.mit.edu	37	1	32620313	32620317	+	Frame_Shift_Del	DEL	AGAGC	-	-			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32620313_32620317delAGAGC	uc001bug.2	+	2	217_221	c.129_133delAGAGC	c.(127-135)CGAGAGCAAfs	p.R43fs	KPNA6_uc001buh.2_5'UTR|KPNA6_uc010ogx.1_Frame_Shift_Del_p.R40fs|KPNA6_uc010ogy.1_Frame_Shift_Del_p.R48fs|KPNA6_uc009vtz.2_5'Flank	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6	43_45	IBB.|Nuclear localization signal (By similarity).				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AGCAGAAGCGAGAGCAACAAGTGAG	0.454													9	58	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	32620313	32620317	KPNA6	1	AGAGC	-	-	-	1	0	1	0	1	0	0	0	0	132	11	5	5	8354	62
KLRG1	10219	broad.mit.edu	37	12	9144889	9144889	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9144889delA	uc001qvh.2	+	2	181	c.170delA	c.(169-171)CAGfs	p.Q57fs	KLRG1_uc001qvg.2_Frame_Shift_Del_p.Q57fs	NM_005810	NP_005801	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G,	57	Helical; Signal-anchor for type II membrane protein; (Potential).				cell surface receptor linked signaling pathway|cellular defense response|inflammatory response|regulation of immune response	integral to membrane	receptor activity|sugar binding			central_nervous_system(1)	1						CTGCTATACCAGTGGATCCTG	0.398													90	276	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	9144889	9144889	KLRG1	12	A	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	8341	62
VEZF1	7716	broad.mit.edu	37	17	56056604	56056605	+	In_Frame_Ins	INS	-	TGC	TGC	rs138088904;rs61731354	byFrequency	TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56056604_56056605insTGC	uc002ivf.1	-	5	1189_1190	c.1046_1047insGCA	c.(1045-1047)CAA>CAGCAA	p.349_349Q>QQ	VEZF1_uc010dcn.1_In_Frame_Ins_p.199_199Q>QQ	NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	349	Poly-Gln.				cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						gttgttgttgttgctgctgctg	0.307													11	347	---	---	---	---	capture_indel	In_Frame_Ins	INS	56056604	56056605	VEZF1	17	-	TGC	TGC	TGC	1	0	1	1	0	0	0	0	0	777	60	5	5	17037	62
ZNF358	140467	broad.mit.edu	37	19	7584719	7584719	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7584719delC	uc002mgn.2	+	2	761	c.591delC	c.(589-591)CACfs	p.H197fs	MCOLN1_uc010dvh.1_5'Flank|MCOLN1_uc002mgo.2_5'Flank|MCOLN1_uc002mgp.2_5'Flank	NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358	197	C2H2-type 2.				embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						TGGCTCAGCACCGTGGCATCC	0.711													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	7584719	7584719	ZNF358	19	C	-	-	-	1	0	1	0	1	0	0	0	0	233	18	5	5	17747	62
RFC4	5984	broad.mit.edu	37	3	186508171	186508173	+	In_Frame_Del	DEL	CAT	-	-			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186508171_186508173delCAT	uc003fqz.2	-	9	1047_1049	c.824_826delATG	c.(823-828)GATGGA>GGA	p.D275del	RFC4_uc011bsc.1_In_Frame_Del_p.D275del	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4	275					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		GCAAATACTCCATCAATTTTCTC	0.424													39	98	---	---	---	---	capture_indel	In_Frame_Del	DEL	186508171	186508173	RFC4	3	CAT	-	-	-	1	0	1	0	1	0	0	0	0	273	21	5	5	13142	62
PCDH10	57575	broad.mit.edu	37	4	134071967	134071968	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:134071967_134071968insC	uc003iha.2	+	1	1498_1499	c.672_673insC	c.(670-675)CTGCCCfs	p.L224fs	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Frame_Shift_Ins_p.L224fs	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	224_225	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		gagcaggCCTGCCCCCCCAGCA	0.480													15	46	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	134071967	134071968	PCDH10	4	-	C	C	C	1	0	1	1	0	0	0	0	0	587	46	5	5	11410	62
KIAA2026	158358	broad.mit.edu	37	9	5944873	5944874	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0649-01	TCGA-06-0649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5944873_5944874insT	uc003zjq.3	-	5	2595_2596	c.2379_2380insA	c.(2377-2382)AAATCGfs	p.K793fs	KIAA2026_uc010mht.2_Intron	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	793_794										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACACCTACCGATTTTTTTCTAC	0.307													2	4	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	5944873	5944874	KIAA2026	9	-	T	T	T	1	0	1	1	0	0	0	0	0	156	12	5	5	8192	62
