Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA1751	85452	broad.mit.edu	37	1	1896365	1896365	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1896365G>A	uc001aim.1	-	13	1693	c.1537C>T	c.(1537-1539)CGC>TGC	p.R513C	KIAA1751_uc009vkz.1_Missense_Mutation_p.R513C	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	513										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TTGAAGGGGCGTCCTTGGAAC	0.662													26	28	---	---	---	---	capture	Missense_Mutation	SNP	1896365	1896365	KIAA1751	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8178	64
RBMXL1	494115	broad.mit.edu	37	1	89448410	89448410	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89448410C>T	uc009wcx.2	-	3	1816	c.1100G>A	c.(1099-1101)AGC>AAC	p.S367N	CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Missense_Mutation_p.S367N	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN	RNA binding motif protein, X-linked-like 1	367	Ser-rich.						nucleotide binding|RNA binding				0						TGCTCCGCGGCTTGAACTGCT	0.517													66	87	---	---	---	---	capture	Missense_Mutation	SNP	89448410	89448410	RBMXL1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	13048	64
GFI1	2672	broad.mit.edu	37	1	92946526	92946526	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92946526G>A	uc001dou.3	-	4	582	c.418C>T	c.(418-420)CGA>TGA	p.R140*	GFI1_uc001dov.3_Nonsense_Mutation_p.R140*|GFI1_uc001dow.3_Nonsense_Mutation_p.R140*	NM_001127215	NP_001120687	Q99684	GFI1_HUMAN	growth factor independent 1	140					negative regulation of calcidiol 1-monooxygenase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1/S phase of mitotic cell cycle|transcription, DNA-dependent|viral reproduction	nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)	1		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		CCACACGGTCGGTAGCTCTGC	0.716													21	11	---	---	---	---	capture	Nonsense_Mutation	SNP	92946526	92946526	GFI1	1	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	6279	64
DENND2C	163259	broad.mit.edu	37	1	115165651	115165651	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115165651G>T	uc001efd.1	-	6	1715	c.1013C>A	c.(1012-1014)GCA>GAA	p.A338E	DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.A338E	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	338										skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAGCTTCCATGCTGAAGGGGA	0.343													8	80	---	---	---	---	capture	Missense_Mutation	SNP	115165651	115165651	DENND2C	1	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	4388	64
USH2A	7399	broad.mit.edu	37	1	216595737	216595737	+	Translation_Start_Site	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216595737C>T	uc001hku.1	-	2	329	c.-58G>A	c.(-60--56)GCGTG>GCATG		USH2A_uc001hkv.2_Translation_Start_Site	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATCAGGCCCACGCCACTTGCC	0.408										HNSCC(13;0.011)			13	16	---	---	---	---	capture	Translation_Start_Site	SNP	216595737	216595737	USH2A	1	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	16918	64
HHIPL2	79802	broad.mit.edu	37	1	222717477	222717477	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222717477G>C	uc001hnh.1	-	2	434	c.376C>G	c.(376-378)CTC>GTC	p.L126V		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	126					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		AGATTCCGGAGAGGCGTCTGG	0.587													90	130	---	---	---	---	capture	Missense_Mutation	SNP	222717477	222717477	HHIPL2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	7019	64
SNAP47	116841	broad.mit.edu	37	1	227935725	227935725	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:227935725T>A	uc001hrf.2	+	2	837	c.423T>A	c.(421-423)CAT>CAA	p.H141Q	SNAP47_uc001hqz.2_Missense_Mutation_p.H96Q|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_Missense_Mutation_p.H141Q|SNAP47_uc001hre.2_Intron|SNAP47_uc001hrg.1_Missense_Mutation_p.H96Q	NM_053052	NP_444280	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	141						endomembrane system|membrane|perinuclear region of cytoplasm				ovary(1)	1						TCATCGAGCATTTCTGGAGGG	0.597													7	50	---	---	---	---	capture	Missense_Mutation	SNP	227935725	227935725	SNAP47	1	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	14724	64
OR6F1	343169	broad.mit.edu	37	1	247875632	247875632	+	Silent	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247875632C>T	uc001idj.1	-	1	426	c.426G>A	c.(424-426)GCG>GCA	p.A142A		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GGGCCAGCTGCGCTGAGAGCA	0.597													73	72	---	---	---	---	capture	Silent	SNP	247875632	247875632	OR6F1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11105	64
IL15RA	3601	broad.mit.edu	37	10	5995110	5995110	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5995110C>A	uc001iiv.2	-	7	834	c.752G>T	c.(751-753)TGG>TTG	p.W251L	IL15RA_uc001iiu.2_Intron|IL15RA_uc010qau.1_Missense_Mutation_p.W218L|IL15RA_uc001iiw.2_Missense_Mutation_p.W215L|IL15RA_uc001iix.2_Missense_Mutation_p.W182L|IL15RA_uc001iiy.2_Missense_Mutation_p.W99L	NM_002189	NP_002180	Q13261	I15RA_HUMAN	interleukin 15 receptor, alpha isoform 1	251	Cytoplasmic (Potential).				cell proliferation	cytoplasmic vesicle membrane|endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane|nuclear membrane	cytokine receptor activity				0						GCTGGTCCCCCAAGTCACCGG	0.557													51	10	---	---	---	---	capture	Missense_Mutation	SNP	5995110	5995110	IL15RA	10	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	7555	64
AGAP6	414189	broad.mit.edu	37	10	51754173	51754173	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:51754173G>T	uc001jix.3	+	4	778	c.380G>T	c.(379-381)AGC>ATC	p.S127I		NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	127					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						ATAAGAAGAAGCAACTGTACA	0.269													3	44	---	---	---	---	capture	Missense_Mutation	SNP	51754173	51754173	AGAP6	10	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	372	64
DUSP13	51207	broad.mit.edu	37	10	76867879	76867879	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:76867879C>T	uc001jws.2	-	2	293	c.238G>A	c.(238-240)GGC>AGC	p.G80S	DUSP13_uc001jwu.2_Intron|DUSP13_uc001jww.2_Intron|DUSP13_uc009xrs.2_5'UTR|DUSP13_uc001jwt.2_5'UTR|DUSP13_uc001jwv.2_Intron	NM_001007271	NP_001007272	Q6B8I1	MDSP_HUMAN	muscle-restricted dual specificity phosphatase	80	Tyrosine-protein phosphatase.					cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					AAGTCAGGGCCGCCCTGACAG	0.622													35	7	---	---	---	---	capture	Missense_Mutation	SNP	76867879	76867879	DUSP13	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4768	64
MUC2	4583	broad.mit.edu	37	11	1078153	1078153	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1078153G>T	uc001lsx.1	+	4	547	c.520G>T	c.(520-522)GGC>TGC	p.G174C		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	174	VWFD 1.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GGACTACAACGGCCTGCAGAG	0.667													4	16	---	---	---	---	capture	Missense_Mutation	SNP	1078153	1078153	MUC2	11	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	9885	64
UBQLN3	50613	broad.mit.edu	37	11	5529867	5529867	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5529867A>T	uc001may.1	-	2	1008	c.922T>A	c.(922-924)TCC>ACC	p.S308T	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	308										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCATGTGTGGAAGTCCAGGGG	0.517													6	122	---	---	---	---	capture	Missense_Mutation	SNP	5529867	5529867	UBQLN3	11	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	16780	64
GYLTL1B	120071	broad.mit.edu	37	11	45946107	45946107	+	Silent	SNP	A	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45946107A>C	uc001nbv.1	+	5	654	c.543A>C	c.(541-543)CTA>CTC	p.L181L	GYLTL1B_uc001nbw.1_Silent_p.L150L|GYLTL1B_uc001nbx.1_Silent_p.L181L|GYLTL1B_uc001nby.1_5'Flank	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	181	Lumenal (Potential).				muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.226)		TCTATGGGCTAATGAAGCTGG	0.612													23	44	---	---	---	---	capture	Silent	SNP	45946107	45946107	GYLTL1B	11	A	C	C	C	1	0	0	0	0	0	0	0	1	158	13	4	4	6836	64
OR4S2	219431	broad.mit.edu	37	11	55419288	55419288	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55419288T>A	uc001nhs.1	+	1	909	c.909T>A	c.(907-909)AAT>AAA	p.N303K		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				GGGGCAGAAATGTTTTCTTGG	0.274													45	125	---	---	---	---	capture	Missense_Mutation	SNP	55419288	55419288	OR4S2	11	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	10987	64
MRE11A	4361	broad.mit.edu	37	11	94192689	94192689	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94192689A>T	uc001peu.2	-	13	1574	c.1385T>A	c.(1384-1386)GTG>GAG	p.V462E	MRE11A_uc001pev.2_Missense_Mutation_p.V462E|MRE11A_uc009ywj.2_Missense_Mutation_p.V465E	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1	462					DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				CTCCTTGTCCACAAATTCTTG	0.398								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				5	81	---	---	---	---	capture	Missense_Mutation	SNP	94192689	94192689	MRE11A	11	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	9669	64
PIWIL4	143689	broad.mit.edu	37	11	94328516	94328516	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94328516G>A	uc001pfa.2	+	10	1403	c.1192G>A	c.(1192-1194)GCT>ACT	p.A398T	PIWIL4_uc010rue.1_RNA|PIWIL4_uc009ywk.1_RNA	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4	398					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GCTGATGAAGGCTGTGGCTGA	0.502													5	105	---	---	---	---	capture	Missense_Mutation	SNP	94328516	94328516	PIWIL4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11863	64
INHBE	83729	broad.mit.edu	37	12	57849443	57849443	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57849443C>G	uc001snw.2	+	1	348	c.124C>G	c.(124-126)CTG>GTG	p.L42V		NM_031479	NP_113667	P58166	INHBE_HUMAN	activin beta E precursor	42					growth	extracellular region	growth factor activity|hormone activity			breast(2)|central_nervous_system(1)	3						AGAACGAGCTCTGGTGCTGGA	0.622													351	39	---	---	---	---	capture	Missense_Mutation	SNP	57849443	57849443	INHBE	12	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	7667	64
KCNRG	283518	broad.mit.edu	37	13	50589662	50589662	+	Silent	SNP	G	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:50589662G>C	uc001vdu.2	+	1	273	c.33G>C	c.(31-33)GTG>GTC	p.V11V	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_Silent_p.V11V|TRIM13_uc001vdp.1_3'UTR|TRIM13_uc001vdq.1_3'UTR|TRIM13_uc001vdr.1_3'UTR|TRIM13_uc001vds.1_3'UTR	NM_173605	NP_775876	Q8N5I3	KCNRG_HUMAN	potassium channel regulator isoform 1	11	BTB.					voltage-gated potassium channel complex	identical protein binding|voltage-gated potassium channel activity				0		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		CTTTGAATGTGGGAGGGAAGA	0.433													58	76	---	---	---	---	capture	Silent	SNP	50589662	50589662	KCNRG	13	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	8009	64
NEK3	4752	broad.mit.edu	37	13	52715184	52715184	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:52715184A>G	uc001vgi.2	-	13	1134	c.899T>C	c.(898-900)ATA>ACA	p.I300T	NEK3_uc001vgg.2_Intron|NEK3_uc001vgh.2_Intron|NEK3_uc010tgx.1_RNA|NEK3_uc010tgy.1_Intron	NM_152720	NP_689933	P51956	NEK3_HUMAN	NIMA-related kinase 3 isoform a	300					cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TCCCAAAGCTATCCTGATTCT	0.323													7	7	---	---	---	---	capture	Missense_Mutation	SNP	52715184	52715184	NEK3	13	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	10232	64
CTSG	1511	broad.mit.edu	37	14	25043567	25043567	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25043567G>A	uc001wpq.2	-	4	515	c.478C>T	c.(478-480)CGA>TGA	p.R160*		NM_001911	NP_001902	P08311	CATG_HUMAN	cathepsin G preproprotein	160	Peptidase S1.				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0269)		TGCACCTCTCGGAGTGTATCT	0.642													60	80	---	---	---	---	capture	Nonsense_Mutation	SNP	25043567	25043567	CTSG	14	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	3996	64
CLMN	79789	broad.mit.edu	37	14	95669370	95669370	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95669370C>G	uc001yef.2	-	9	2432	c.2316G>C	c.(2314-2316)GAG>GAC	p.E772D		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	772						integral to membrane	actin binding				0				Epithelial(152;0.193)		CATCGGCCTCCTCCTCCCTGG	0.567													7	87	---	---	---	---	capture	Missense_Mutation	SNP	95669370	95669370	CLMN	14	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	3507	64
HHIPL1	84439	broad.mit.edu	37	14	100118755	100118755	+	Silent	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100118755C>T	uc010avs.2	+	2	515	c.450C>T	c.(448-450)TCC>TCT	p.S150S	HHIPL1_uc001ygl.1_Silent_p.S150S	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a	150					carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				GCTACCTGTCCCTGGATGACA	0.602													10	120	---	---	---	---	capture	Silent	SNP	100118755	100118755	HHIPL1	14	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7018	64
ZNF609	23060	broad.mit.edu	37	15	64966530	64966530	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:64966530G>A	uc002ann.2	+	4	1477	c.1477G>A	c.(1477-1479)GTC>ATC	p.V493I		NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	493						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CCCCTCCCCCGTCCTAATTGA	0.522													62	70	---	---	---	---	capture	Missense_Mutation	SNP	64966530	64966530	ZNF609	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17913	64
ISLR	3671	broad.mit.edu	37	15	74468444	74468444	+	Silent	SNP	G	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74468444G>C	uc002axg.1	+	2	1527	c.1245G>C	c.(1243-1245)CTG>CTC	p.L415L	ISLR_uc002axh.1_Silent_p.L415L	NM_005545	NP_005536	O14498	ISLR_HUMAN	immunoglobulin superfamily containing	415					cell adhesion	extracellular region				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						TGCTCCTGCTGGGCCAAAGCC	0.617													30	54	---	---	---	---	capture	Silent	SNP	74468444	74468444	ISLR	15	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	7781	64
ARNT2	9915	broad.mit.edu	37	15	80845010	80845010	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:80845010G>T	uc002bfr.2	+	10	1150	c.984G>T	c.(982-984)ATG>ATT	p.M328I	ARNT2_uc010unm.1_Missense_Mutation_p.M317I|ARNT2_uc002bfs.2_Missense_Mutation_p.M317I	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator	328	PAS 2.				central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			GCATGGACATGAATGGGATGT	0.493													5	134	---	---	---	---	capture	Missense_Mutation	SNP	80845010	80845010	ARNT2	15	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	959	64
C15orf26	161502	broad.mit.edu	37	15	81428924	81428924	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81428924A>G	uc002bgb.2	+	3	254	c.227A>G	c.(226-228)GAT>GGT	p.D76G	C15orf26_uc010blp.1_Missense_Mutation_p.D51G	NM_173528	NP_775799	Q6P656	CO026_HUMAN	hypothetical protein LOC161502	76											0						GTGAATCCTGATGATCCTGAC	0.408													27	65	---	---	---	---	capture	Missense_Mutation	SNP	81428924	81428924	C15orf26	15	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	1773	64
PAQR4	124222	broad.mit.edu	37	16	3021597	3021597	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3021597C>T	uc002csj.3	+	3	804	c.470C>T	c.(469-471)TCG>TTG	p.S157L	PAQR4_uc002csk.3_Missense_Mutation_p.S118L|PAQR4_uc002csl.3_Missense_Mutation_p.S83L|PAQR4_uc010uwm.1_Missense_Mutation_p.S88L	NM_152341	NP_689554	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	157	Helical; (Potential).					integral to membrane	receptor activity				0						ACTGTGTTGTCGGGTGTGGCC	0.687													60	84	---	---	---	---	capture	Missense_Mutation	SNP	3021597	3021597	PAQR4	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11341	64
MYH11	4629	broad.mit.edu	37	16	15841499	15841499	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15841499T>C	uc002ddy.2	-	19	2446	c.2339A>G	c.(2338-2340)GAG>GGG	p.E780G	MYH11_uc002ddv.2_Missense_Mutation_p.E787G|MYH11_uc002ddw.2_Missense_Mutation_p.E780G|MYH11_uc002ddx.2_Missense_Mutation_p.E787G|MYH11_uc010bvg.2_Missense_Mutation_p.E612G	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	780	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						ATCTCGCTCCTCCTCTAGGTG	0.498			T	CBFB	AML								8	78	---	---	---	---	capture	Missense_Mutation	SNP	15841499	15841499	MYH11	16	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	9941	64
RBBP6	5930	broad.mit.edu	37	16	24582927	24582927	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24582927A>C	uc002dmh.2	+	18	5580	c.4540A>C	c.(4540-4542)AAA>CAA	p.K1514Q	RBBP6_uc002dmi.2_Missense_Mutation_p.K1480Q|RBBP6_uc010bxr.2_Missense_Mutation_p.K674Q|RBBP6_uc002dmk.2_Missense_Mutation_p.K1347Q	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	1514	Interaction with p53 (By similarity).				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		ACAGAAAAATAAACCAAGGGA	0.368													19	14	---	---	---	---	capture	Missense_Mutation	SNP	24582927	24582927	RBBP6	16	A	C	C	C	1	0	0	0	0	1	0	0	0	169	13	4	4	12998	64
RNF40	9810	broad.mit.edu	37	16	30774800	30774800	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30774800C>A	uc002dzq.2	+	4	485	c.362C>A	c.(361-363)GCG>GAG	p.A121E	C16orf93_uc002dzm.2_5'Flank|C16orf93_uc002dzn.2_5'Flank|C16orf93_uc002dzo.2_5'Flank|C16orf93_uc002dzp.2_5'Flank|RNF40_uc010caa.2_Missense_Mutation_p.A121E|RNF40_uc010cab.2_Missense_Mutation_p.A121E|RNF40_uc010vfa.1_Intron|RNF40_uc002dzr.2_Missense_Mutation_p.A121E|RNF40_uc010vfb.1_Intron	NM_014771	NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40	121					histone H2B ubiquitination|histone monoubiquitination|ubiquitin-dependent protein catabolic process	nucleus|synaptosome|ubiquitin ligase complex	protein homodimerization activity|ubiquitin protein ligase binding|zinc ion binding			central_nervous_system(1)	1			Colorectal(24;0.198)			CTGTCTTCAGCGCCTGAGGCA	0.562													6	96	---	---	---	---	capture	Missense_Mutation	SNP	30774800	30774800	RNF40	16	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	13385	64
ZNF23	7571	broad.mit.edu	37	16	71483233	71483233	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71483233C>A	uc002faf.2	-	6	1509	c.695G>T	c.(694-696)AGC>ATC	p.S232I	ZNF23_uc002fad.2_Missense_Mutation_p.S174I|ZNF23_uc002fae.2_Missense_Mutation_p.S174I|ZNF23_uc010vmf.1_Missense_Mutation_p.S174I|ZNF23_uc002fag.2_Missense_Mutation_p.S174I|ZNF23_uc002fah.2_Missense_Mutation_p.S232I|ZNF23_uc002fai.2_Missense_Mutation_p.S271I	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	232	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		GTAGCTGAAGCTTTTCCCACA	0.448													45	96	---	---	---	---	capture	Missense_Mutation	SNP	71483233	71483233	ZNF23	16	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	17663	64
SMARCD2	6603	broad.mit.edu	37	17	61912798	61912798	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61912798G>A	uc010deb.1	-	5	1014	c.697C>T	c.(697-699)CGA>TGA	p.R233*	SMARCD2_uc010wpt.1_Nonsense_Mutation_p.R185*|SMARCD2_uc010dea.1_Nonsense_Mutation_p.R158*|SMARCD2_uc010dec.1_Nonsense_Mutation_p.R212*	NM_001098426	NP_001091896	Q92925	SMRD2_HUMAN	SWI/SNF-related matrix-associated	233					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	SWI/SNF complex	protein binding|transcription coactivator activity				0						CCTTCCACTCGGAGTTCCCAG	0.527													29	47	---	---	---	---	capture	Nonsense_Mutation	SNP	61912798	61912798	SMARCD2	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	14670	64
ABCA8	10351	broad.mit.edu	37	17	66928560	66928560	+	Silent	SNP	A	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66928560A>T	uc002jhp.2	-	6	845	c.666T>A	c.(664-666)ACT>ACA	p.T222T	ABCA8_uc002jhq.2_Silent_p.T222T|ABCA8_uc010wqq.1_Silent_p.T222T|ABCA8_uc010wqr.1_Silent_p.T161T|ABCA8_uc002jhr.2_Silent_p.T222T|ABCA8_uc002jhs.2_Silent_p.T222T|ABCA8_uc002jht.2_Silent_p.T222T	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	222	Helical; (Potential).					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					GGTACAAATCAGTTATAACTC	0.363													40	57	---	---	---	---	capture	Silent	SNP	66928560	66928560	ABCA8	17	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	38	64
CD7	924	broad.mit.edu	37	17	80274786	80274786	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80274786C>A	uc002kel.1	-	2	263	c.154G>T	c.(154-156)GGG>TGG	p.G52W	CD7_uc010din.2_Missense_Mutation_p.G52W|CD7_uc002kem.2_Missense_Mutation_p.R33L|CD7_uc010wvk.1_Missense_Mutation_p.G52W	NM_006137	NP_006128	P09564	CD7_HUMAN	CD7 antigen precursor	52	Ig-like.|Extracellular (Probable).				immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity				0	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			CGCAGGCCCCCGCTGGTGGAG	0.647													36	43	---	---	---	---	capture	Missense_Mutation	SNP	80274786	80274786	CD7	17	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	3003	64
MUC16	94025	broad.mit.edu	37	19	9015333	9015333	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9015333C>T	uc002mkp.2	-	30	38459	c.38255G>A	c.(38254-38256)AGA>AAA	p.R12752K	MUC16_uc010xki.1_5'Flank	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12754	SEA 5.|Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAAGGTCAGTCTGCAGCCAGA	0.517													30	53	---	---	---	---	capture	Missense_Mutation	SNP	9015333	9015333	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	9883	64
CYP4F3	4051	broad.mit.edu	37	19	15758065	15758065	+	Silent	SNP	G	A	A	rs138865516		TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15758065G>A	uc002nbj.2	+	5	506	c.456G>A	c.(454-456)ACG>ACA	p.T152T	CYP4F3_uc010xok.1_Silent_p.T152T|CYP4F3_uc010xol.1_Silent_p.T152T|CYP4F3_uc010xom.1_Silent_p.T3T|CYP4F3_uc002nbk.2_Silent_p.T152T|CYP4F3_uc010xon.1_5'Flank	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	152					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GGATGCTGACGCCTGCCTTCC	0.552													50	54	---	---	---	---	capture	Silent	SNP	15758065	15758065	CYP4F3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4150	64
ZNF493	284443	broad.mit.edu	37	19	21606980	21606980	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:21606980C>T	uc002npx.2	+	2	1415	c.1135C>T	c.(1135-1137)CAT>TAT	p.H379Y	ZNF493_uc002npw.2_Missense_Mutation_p.H507Y|ZNF493_uc002npy.2_Missense_Mutation_p.H379Y	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	379	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CCTTAGTATACATAAAATAAT	0.328													8	28	---	---	---	---	capture	Missense_Mutation	SNP	21606980	21606980	ZNF493	19	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17823	64
ZSCAN5A	79149	broad.mit.edu	37	19	56733609	56733609	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56733609C>T	uc002qmq.2	-	5	992	c.826G>A	c.(826-828)GTT>ATT	p.V276I	ZSCAN5A_uc010ygi.1_Missense_Mutation_p.V159I|ZSCAN5A_uc002qmr.2_Missense_Mutation_p.V276I|ZSCAN5A_uc002qms.1_Missense_Mutation_p.V275I	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	276					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						CTCTCCACAACGCAGGCAGAA	0.527													7	154	---	---	---	---	capture	Missense_Mutation	SNP	56733609	56733609	ZSCAN5A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18114	64
ALLC	55821	broad.mit.edu	37	2	3727521	3727521	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3727521G>A	uc010ewt.2	+	5	396	c.235G>A	c.(235-237)GTT>ATT	p.V79I		NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	98							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		CGACGTGGACGTTTCTTACTT	0.532										HNSCC(21;0.051)			52	67	---	---	---	---	capture	Missense_Mutation	SNP	3727521	3727521	ALLC	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	534	64
TGFA	7039	broad.mit.edu	37	2	70680446	70680446	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70680446G>A	uc002sgs.3	-	5	585	c.379C>T	c.(379-381)CGA>TGA	p.R127*	TGFA_uc010fdq.2_Nonsense_Mutation_p.R133*|TGFA_uc010fdr.2_Nonsense_Mutation_p.R132*|TGFA_uc002sgt.3_Nonsense_Mutation_p.R126*|TGFA_uc002sgu.2_Nonsense_Mutation_p.R126*|TGFA_uc002sgv.2_Nonsense_Mutation_p.R127*|TGFA_uc002sgw.2_Nonsense_Mutation_p.R126*	NM_003236	NP_003227	P01135	TGFA_HUMAN	transforming growth factor, alpha isoform 1	127	Cytoplasmic (Potential).				activation of MAPK activity|cell proliferation|positive regulation of cell division|positive regulation of epidermal growth factor receptor activity|positive regulation of epithelial cell proliferation|positive regulation of mitosis	cell surface|extracellular space|integral to membrane|plasma membrane	epidermal growth factor receptor binding|growth factor activity|MAP kinase kinase activity|signal transducer activity			prostate(1)	1						CAGTGTTTTCGGACCTGGCAG	0.632													60	74	---	---	---	---	capture	Nonsense_Mutation	SNP	70680446	70680446	TGFA	2	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	15700	64
CNTNAP5	129684	broad.mit.edu	37	2	125660583	125660583	+	Silent	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125660583G>A	uc002tno.2	+	22	3922	c.3558G>A	c.(3556-3558)GCG>GCA	p.A1186A	CNTNAP5_uc010flu.2_Silent_p.A1187A	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1186	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		CCACTGTCGCGCCTGTGACTG	0.537													8	13	---	---	---	---	capture	Silent	SNP	125660583	125660583	CNTNAP5	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3615	64
TTN	7273	broad.mit.edu	37	2	179438951	179438951	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179438951G>A	uc010zfg.1	-	275	64428	c.64204C>T	c.(64204-64206)CGG>TGG	p.R21402W	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R15097W|TTN_uc010zfi.1_Missense_Mutation_p.R15030W|TTN_uc010zfj.1_Missense_Mutation_p.R14905W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22329							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.R21402C(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAGCCACCGTCCATTAGGA	0.413													21	49	---	---	---	---	capture	Missense_Mutation	SNP	179438951	179438951	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	16617	64
TTN	7273	broad.mit.edu	37	2	179569359	179569359	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179569359A>C	uc010zfg.1	-	102	26332	c.26108T>G	c.(26107-26109)TTT>TGT	p.F8703C	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.F5364C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9630							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTATTTCAAATTTATCACT	0.368													20	18	---	---	---	---	capture	Missense_Mutation	SNP	179569359	179569359	TTN	2	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	16617	64
ALPPL2	251	broad.mit.edu	37	2	233272379	233272379	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233272379T>C	uc002vss.3	+	4	429	c.376T>C	c.(376-378)TTC>CTC	p.F126L		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	126					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	CAAGGGCAACTTCCAGACCAT	0.582													17	32	---	---	---	---	capture	Missense_Mutation	SNP	233272379	233272379	ALPPL2	2	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	549	64
GRIK1	2897	broad.mit.edu	37	21	31023612	31023612	+	Splice_Site	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31023612C>T	uc002yno.1	-	6	1245	c.781_splice	c.e6-1	p.D261_splice	GRIK1_uc002ynn.2_Splice_Site_p.D261_splice|GRIK1_uc011acs.1_Splice_Site_p.D261_splice|GRIK1_uc011act.1_Splice_Site_p.D205_splice|GRIK1_uc010glq.1_Splice_Site_p.D119_splice|GRIK1_uc002ynr.2_Splice_Site_p.D261_splice	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	CAAATAAGTCCTGCATAGTAT	0.348													4	50	---	---	---	---	capture	Splice_Site	SNP	31023612	31023612	GRIK1	21	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	6706	64
CBS	875	broad.mit.edu	37	21	44478273	44478273	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:44478273G>C	uc002zcu.2	-	15	1694	c.1449C>G	c.(1447-1449)ATC>ATG	p.I483M	CBS_uc002zcs.1_Missense_Mutation_p.I378M|CBS_uc002zct.2_Missense_Mutation_p.I483M|CBS_uc002zcw.3_Missense_Mutation_p.I483M|CBS_uc002zcv.2_Missense_Mutation_p.I483M|CBS_uc002zcx.2_Missense_Mutation_p.I102M	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase	483					cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	ACTGCTTGTAGATGACTTTGC	0.567													27	37	---	---	---	---	capture	Missense_Mutation	SNP	44478273	44478273	CBS	21	G	C	C	C	1	0	0	0	0	1	0	0	0	421	33	4	4	2687	64
CRELD1	78987	broad.mit.edu	37	3	9982660	9982660	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9982660G>A	uc003bug.2	+	6	705	c.587G>A	c.(586-588)GGC>GAC	p.G196D	CIDEC_uc003bto.2_Intron|CRELD1_uc003buf.2_Missense_Mutation_p.G196D|CRELD1_uc003buh.2_Missense_Mutation_p.G196D|CRELD1_uc003bui.2_Missense_Mutation_p.G196D|CRELD1_uc003buj.2_RNA	NM_001077415	NP_001070883	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1 isoform 3	196	Extracellular (Potential).				cardiac septum development|endocardial cushion development	integral to membrane	calcium ion binding			ovary(1)	1						GGCCAGTGTGGCCTTGGCTAC	0.642													12	82	---	---	---	---	capture	Missense_Mutation	SNP	9982660	9982660	CRELD1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3831	64
PLS1	5357	broad.mit.edu	37	3	142383125	142383125	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142383125C>G	uc010huv.2	+	2	205	c.46C>G	c.(46-48)CTA>GTA	p.L16V	PLS1_uc003euz.2_Missense_Mutation_p.L16V|PLS1_uc003eva.2_Missense_Mutation_p.L16V	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1	16	EF-hand 1.					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						GCTTGAAGAACTACAAGAGGC	0.333													3	105	---	---	---	---	capture	Missense_Mutation	SNP	142383125	142383125	PLS1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	12010	64
GHSR	2693	broad.mit.edu	37	3	172165997	172165997	+	Silent	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172165997C>T	uc003fib.1	-	1	207	c.207G>A	c.(205-207)TCG>TCA	p.S69S	GHSR_uc011bpv.1_Silent_p.S69S	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	69	Cytoplasmic (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CGCGGAAGCGCGACACCACCA	0.657													41	51	---	---	---	---	capture	Silent	SNP	172165997	172165997	GHSR	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6314	64
FRYL	285527	broad.mit.edu	37	4	48503638	48503638	+	Splice_Site	SNP	A	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48503638A>C	uc003gyh.1	-	62	9197	c.8592_splice	c.e62+1	p.E2864_splice	FRYL_uc003gye.1_Splice_Site_p.E46_splice|FRYL_uc003gyf.1_Splice_Site_p.E254_splice|FRYL_uc003gyg.1_Splice_Site_p.E1554_splice	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						CTGAATATTTACCTCTGCTTC	0.294													9	110	---	---	---	---	capture	Splice_Site	SNP	48503638	48503638	FRYL	4	A	C	C	C	1	0	0	0	0	0	0	1	0	182	14	6	4	6007	64
NPY5R	4889	broad.mit.edu	37	4	164272650	164272650	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164272650A>G	uc003iqn.2	+	4	1407	c.1225A>G	c.(1225-1227)ATT>GTT	p.I409V		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	409	Helical; Name=7; (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				GGTGTATTGCATTTGTCATTT	0.348													48	55	---	---	---	---	capture	Missense_Mutation	SNP	164272650	164272650	NPY5R	4	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	10517	64
TRIML1	339976	broad.mit.edu	37	4	189065255	189065255	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189065255C>T	uc003izm.1	+	5	939	c.824C>T	c.(823-825)ACG>ATG	p.T275M	TRIML1_uc003izn.1_Translation_Start_Site	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	275	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding	p.T275T(1)		ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TGCCGCATCACGGGAATGAAG	0.527													19	30	---	---	---	---	capture	Missense_Mutation	SNP	189065255	189065255	TRIML1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16433	64
CTNND2	1501	broad.mit.edu	37	5	11082954	11082954	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:11082954G>A	uc003jfa.1	-	16	2787	c.2642C>T	c.(2641-2643)TCA>TTA	p.S881L	CTNND2_uc010itt.2_Missense_Mutation_p.S790L|CTNND2_uc011cmy.1_Missense_Mutation_p.S544L|CTNND2_uc011cmz.1_Missense_Mutation_p.S448L|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.S473L	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	881					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GATATATACTGACCACTGCAA	0.537													26	33	---	---	---	---	capture	Missense_Mutation	SNP	11082954	11082954	CTNND2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	3983	64
AP3B1	8546	broad.mit.edu	37	5	77311333	77311333	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:77311333A>G	uc003kfj.2	-	26	3157	c.3032T>C	c.(3031-3033)ATT>ACT	p.I1011T		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	1011					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TGGTGCAGCAATGATTACAGC	0.383									Hermansky-Pudlak_syndrome				28	32	---	---	---	---	capture	Missense_Mutation	SNP	77311333	77311333	AP3B1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	737	64
GPR150	285601	broad.mit.edu	37	5	94956705	94956705	+	Silent	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94956705C>T	uc003kle.1	+	1	726	c.726C>T	c.(724-726)GTC>GTT	p.V242V		NM_199243	NP_954713	Q8NGU9	GP150_HUMAN	G protein-coupled receptor 150	242	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(142;0.000462)|all_epithelial(76;2.44e-06)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)		all cancers(79;1.82e-16)		CGGGCTTCGTCGCGCCTGTTA	0.682													5	4	---	---	---	---	capture	Silent	SNP	94956705	94956705	GPR150	5	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	6590	64
PPIC	5480	broad.mit.edu	37	5	122359634	122359634	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:122359634G>A	uc003kth.2	-	5	680	c.575C>T	c.(574-576)TCG>TTG	p.S192L		NM_000943	NP_000934	P45877	PPIC_HUMAN	peptidylprolyl isomerase C	192	PPIase cyclophilin-type.				protein folding|signal transduction	cytoplasm	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding			ovary(1)	1		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	GTTGATGATCGAGCAGTTGGT	0.478													89	152	---	---	---	---	capture	Missense_Mutation	SNP	122359634	122359634	PPIC	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12221	64
SLC12A2	6558	broad.mit.edu	37	5	127520072	127520072	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127520072A>G	uc003kus.2	+	25	3478	c.3314A>G	c.(3313-3315)GAG>GGG	p.E1105G	SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Missense_Mutation_p.E1089G	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	1105	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	ATAGCTTTTGAGGAAATCATT	0.289													16	32	---	---	---	---	capture	Missense_Mutation	SNP	127520072	127520072	SLC12A2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	14276	64
PCDHA13	56136	broad.mit.edu	37	5	140263877	140263877	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140263877C>T	uc003lif.2	+	1	2024	c.2024C>T	c.(2023-2025)GCG>GTG	p.A675V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.A675V|PCDHA13_uc003lid.2_Missense_Mutation_p.A675V	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	675	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.A675V(1)		ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGGCCAAGCGCCACAGGCT	0.662													4	99	---	---	---	---	capture	Missense_Mutation	SNP	140263877	140263877	PCDHA13	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11426	64
PDGFRB	5159	broad.mit.edu	37	5	149503887	149503887	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149503887G>A	uc003lro.2	-	14	2418	c.1949C>T	c.(1948-1950)TCG>TTG	p.S650L	PDGFRB_uc010jhd.2_Missense_Mutation_p.S489L	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	650	Cytoplasmic (Potential).|Protein kinase.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTCAGCTCCGACATAAGGGC	0.637			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								25	44	---	---	---	---	capture	Missense_Mutation	SNP	149503887	149503887	PDGFRB	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11565	64
GABRG2	2566	broad.mit.edu	37	5	161520964	161520964	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161520964A>G	uc003lyz.3	+	2	596	c.238A>G	c.(238-240)AAA>GAA	p.K80E	GABRG2_uc010jjc.2_Missense_Mutation_p.K80E|GABRG2_uc003lyy.3_Missense_Mutation_p.K80E|GABRG2_uc011dej.1_Translation_Start_Site	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	80	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		ATATGACAATAAACTTCGGCC	0.373													44	74	---	---	---	---	capture	Missense_Mutation	SNP	161520964	161520964	GABRG2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	6114	64
GRM6	2916	broad.mit.edu	37	5	178415969	178415969	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178415969G>A	uc003mjr.2	-	6	1500	c.1321C>T	c.(1321-1323)CTT>TTT	p.L441F	GRM6_uc010jla.1_Missense_Mutation_p.L24F|GRM6_uc003mjs.1_Missense_Mutation_p.L61F	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	441	Extracellular (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TACTGCAGAAGCATCCGCCCA	0.642													3	44	---	---	---	---	capture	Missense_Mutation	SNP	178415969	178415969	GRM6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	6734	64
ZNF184	7738	broad.mit.edu	37	6	27420960	27420960	+	Silent	SNP	T	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27420960T>G	uc003njj.2	-	5	1189	c.378A>C	c.(376-378)ATA>ATC	p.I126I	ZNF184_uc010jqv.2_Silent_p.I126I|ZNF184_uc003nji.2_Silent_p.I126I	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	126					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GTTTTTCCACTATTACCTCTG	0.413													48	121	---	---	---	---	capture	Silent	SNP	27420960	27420960	ZNF184	6	T	G	G	G	1	0	0	0	0	0	0	0	1	680	53	4	4	17631	64
OR2H1	26716	broad.mit.edu	37	6	29430405	29430405	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29430405G>A	uc003nmi.2	+	3	1302	c.859G>A	c.(859-861)GTA>ATA	p.V287I	OR2H1_uc003nmj.1_Missense_Mutation_p.V287I|OR2H1_uc010jri.1_Missense_Mutation_p.V209I	NM_030883	NP_112145	Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H,	287	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TAACCCTCTCGTATACACCCT	0.493													29	89	---	---	---	---	capture	Missense_Mutation	SNP	29430405	29430405	OR2H1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10905	64
SUN3	256979	broad.mit.edu	37	7	48035742	48035742	+	Silent	SNP	T	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48035742T>A	uc003tof.2	-	8	676	c.579A>T	c.(577-579)GGA>GGT	p.G193G	SUN3_uc010kyq.2_Silent_p.G93G|SUN3_uc003tog.2_Silent_p.G193G|SUN3_uc011kcf.1_Silent_p.G181G	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1	193	SUN.					integral to membrane				central_nervous_system(1)	1						TGATGGAGGCTCCTAAAATTA	0.313													18	86	---	---	---	---	capture	Silent	SNP	48035742	48035742	SUN3	7	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	15281	64
ADAM22	53616	broad.mit.edu	37	7	87704970	87704970	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87704970G>A	uc003ujn.2	+	4	432	c.353G>A	c.(352-354)AGA>AAA	p.R118K	ADAM22_uc003uji.1_Missense_Mutation_p.R117K|ADAM22_uc003ujj.1_Missense_Mutation_p.R118K|ADAM22_uc003ujk.1_Missense_Mutation_p.R118K|ADAM22_uc003ujl.1_Missense_Mutation_p.R118K|ADAM22_uc003ujm.2_Missense_Mutation_p.R118K|ADAM22_uc003ujo.2_Missense_Mutation_p.R118K|ADAM22_uc003ujp.1_Missense_Mutation_p.R170K	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	118					cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TACATAGAGAGACACATTGAA	0.338													19	65	---	---	---	---	capture	Missense_Mutation	SNP	87704970	87704970	ADAM22	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	244	64
SAMD9L	219285	broad.mit.edu	37	7	92764397	92764397	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92764397G>T	uc003umh.1	-	5	2104	c.888C>A	c.(886-888)AAC>AAA	p.N296K	SAMD9L_uc003umj.1_Missense_Mutation_p.N296K|SAMD9L_uc003umi.1_Missense_Mutation_p.N296K|SAMD9L_uc010lfb.1_Missense_Mutation_p.N296K|SAMD9L_uc003umk.1_Missense_Mutation_p.N296K|SAMD9L_uc010lfc.1_Missense_Mutation_p.N296K|SAMD9L_uc010lfd.1_Missense_Mutation_p.N296K|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	296										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			ATGGTGTATTGTTCTGCAGAA	0.338													8	309	---	---	---	---	capture	Missense_Mutation	SNP	92764397	92764397	SAMD9L	7	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	13719	64
AZGP1	563	broad.mit.edu	37	7	99564649	99564649	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99564649C>G	uc003ush.2	-	4	918	c.874G>C	c.(874-876)GTG>CTG	p.V292L		NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc	292	Ig-like C1-type.				antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CAGGGCACCACGAGGGGCTGG	0.637													58	251	---	---	---	---	capture	Missense_Mutation	SNP	99564649	99564649	AZGP1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	1229	64
ARHGEF10	9639	broad.mit.edu	37	8	1808147	1808147	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1808147C>T	uc003wpr.2	+	4	456	c.278C>T	c.(277-279)TCT>TTT	p.S93F	ARHGEF10_uc003wpq.1_Missense_Mutation_p.S117F|ARHGEF10_uc003wps.2_Missense_Mutation_p.S93F|ARHGEF10_uc003wpt.2_Missense_Mutation_p.S7F|ARHGEF10_uc010lrd.1_Missense_Mutation_p.S7F|ARHGEF10_uc003wpu.2_Missense_Mutation_p.S7F	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	117					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		AACCCATATTCTGTCATCGAC	0.597													5	164	---	---	---	---	capture	Missense_Mutation	SNP	1808147	1808147	ARHGEF10	8	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	887	64
CHD7	55636	broad.mit.edu	37	8	61769309	61769309	+	Silent	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:61769309G>A	uc003xue.2	+	34	7947	c.7470G>A	c.(7468-7470)TCG>TCA	p.S2490S		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2490					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CAGGCCTTTCGCGCACACCCA	0.483													76	121	---	---	---	---	capture	Silent	SNP	61769309	61769309	CHD7	8	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3296	64
C8orf34	116328	broad.mit.edu	37	8	69621313	69621313	+	Silent	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:69621313C>T	uc010lyz.2	+	9	1117	c.1068C>T	c.(1066-1068)TTC>TTT	p.F356F	C8orf34_uc003xyb.2_Silent_p.F331F	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328	356					signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CAGATTCATTCGGTAAGTTTT	0.343													19	13	---	---	---	---	capture	Silent	SNP	69621313	69621313	C8orf34	8	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	2399	64
KCNB2	9312	broad.mit.edu	37	8	73849588	73849588	+	Silent	SNP	G	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73849588G>A	uc003xzb.2	+	3	2586	c.1998G>A	c.(1996-1998)ACG>ACA	p.T666T		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	666	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			GGGATGGCACGCTGGAGTATG	0.567													63	68	---	---	---	---	capture	Silent	SNP	73849588	73849588	KCNB2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7935	64
CCNE2	9134	broad.mit.edu	37	8	95900206	95900206	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95900206A>C	uc003yhc.2	-	7	658	c.549T>G	c.(547-549)AAT>AAG	p.N183K	CCNE2_uc003yhd.2_Missense_Mutation_p.N183K	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2	183					cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)					GTTGAAGCATATTTTTATTTA	0.284													38	52	---	---	---	---	capture	Missense_Mutation	SNP	95900206	95900206	CCNE2	8	A	C	C	C	1	0	0	0	0	1	0	0	0	206	16	4	4	2892	64
ENPP2	5168	broad.mit.edu	37	8	120569830	120569830	+	Silent	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120569830C>T	uc003yot.1	-	25	2609	c.2523G>A	c.(2521-2523)AAG>AAA	p.K841K	ENPP2_uc011lic.1_Silent_p.K379K|ENPP2_uc003yor.1_Silent_p.K476K|ENPP2_uc003yos.1_Silent_p.K893K|ENPP2_uc010mdd.1_Silent_p.K866K	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	841	Required for secretion (By similarity).				cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGCGGCTGGTCTTTCGGAAGA	0.468													44	65	---	---	---	---	capture	Silent	SNP	120569830	120569830	ENPP2	8	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	5085	64
COL14A1	7373	broad.mit.edu	37	8	121326187	121326187	+	Missense_Mutation	SNP	G	A	A	rs142082215		TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121326187G>A	uc003yox.2	+	38	4737	c.4472G>A	c.(4471-4473)CGG>CAG	p.R1491Q	COL14A1_uc003yoz.2_Missense_Mutation_p.R456Q	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	1491	Triple-helical region 1 (COL2).				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GATGGCCCTCGGGGTGAAATT	0.468													25	291	---	---	---	---	capture	Missense_Mutation	SNP	121326187	121326187	COL14A1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3636	64
COL22A1	169044	broad.mit.edu	37	8	139606377	139606377	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:139606377C>A	uc003yvd.2	-	63	4945	c.4498G>T	c.(4498-4500)GGG>TGG	p.G1500W	COL22A1_uc011ljo.1_Missense_Mutation_p.G780W	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1500	Pro-rich.|Gly-rich.|Collagen-like 15.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCTGGGGGCCCAGGTCTGCCT	0.632										HNSCC(7;0.00092)			7	125	---	---	---	---	capture	Missense_Mutation	SNP	139606377	139606377	COL22A1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	3646	64
BMP15	9210	broad.mit.edu	37	X	50659431	50659431	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50659431C>A	uc011mnw.1	+	2	1003	c.1003C>A	c.(1003-1005)CCC>ACC	p.P335T		NM_005448	NP_005439	O95972	BMP15_HUMAN	bone morphogenetic protein 15 precursor	335					female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity			ovary(2)	2	Ovarian(276;0.236)					TCTCAATTCCCCCAATCACGC	0.502													54	12	---	---	---	---	capture	Missense_Mutation	SNP	50659431	50659431	BMP15	23	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	1446	64
BCORL1	63035	broad.mit.edu	37	X	129162640	129162640	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129162640C>T	uc004evb.1	+	8	4223	c.4109C>T	c.(4108-4110)TCC>TTC	p.S1370F	BCORL1_uc010nrd.1_Missense_Mutation_p.S1142F|BCORL1_uc004evc.1_Missense_Mutation_p.S132F	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1370					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						AAGACTTCCTCCTCCCAAAGT	0.483											OREG0019921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	149	---	---	---	---	capture	Missense_Mutation	SNP	129162640	129162640	BCORL1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	1376	64
TRPV6	55503	broad.mit.edu	37	7	142572331	142572331	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0686-01	TCGA-06-0686-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142572331delG	uc003wbx.1	-	11	1581	c.1365delC	c.(1363-1365)TCCfs	p.S455fs	TRPV6_uc003wbw.1_Frame_Shift_Del_p.S241fs|TRPV6_uc010lou.1_Frame_Shift_Del_p.S326fs	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	455	Helical; (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CGAGTGCAAAGGACATGGGTA	0.592													40	139	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	142572331	142572331	TRPV6	7	G	-	-	-	1	0	1	0	1	0	0	0	0	444	35	5	5	16483	64
