Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ARHGEF16	27237	broad.mit.edu	37	1	3389688	3389688	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3389688G>A	uc001akg.3	+	7	1317	c.1069G>A	c.(1069-1071)GAG>AAG	p.E357K	ARHGEF16_uc001aki.2_Missense_Mutation_p.E69K|ARHGEF16_uc001akj.2_Missense_Mutation_p.E69K|ARHGEF16_uc009vli.1_Missense_Mutation_p.E61K|ARHGEF16_uc010nzh.1_Missense_Mutation_p.E61K	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16	357	DH.|Required for RHOG activation and mediates interaction with EPHA2.				activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GGTGCTGGTCGAGGACATCAG	0.632													23	41	---	---	---	---	capture	Missense_Mutation	SNP	3389688	3389688	ARHGEF16	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	892	65
MAST2	23139	broad.mit.edu	37	1	46500629	46500629	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46500629C>T	uc001cov.2	+	29	4571	c.4288C>T	c.(4288-4290)CTT>TTT	p.L1430F	MAST2_uc001cow.2_Missense_Mutation_p.L1429F|MAST2_uc001cpa.2_RNA	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase	1430					regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CAAGCACAGCCTTGACCTGCC	0.592													16	64	---	---	---	---	capture	Missense_Mutation	SNP	46500629	46500629	MAST2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	9238	65
CC2D1B	200014	broad.mit.edu	37	1	52820329	52820329	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:52820329A>G	uc001ctq.1	-	23	2537	c.2399T>C	c.(2398-2400)CTG>CCG	p.L800P	CC2D1B_uc001ctr.2_Missense_Mutation_p.L340P|CC2D1B_uc001cts.2_Missense_Mutation_p.L485P	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	800										ovary(2)	2						CTCCAGTTTCAGGTGTGCTGT	0.567													4	137	---	---	---	---	capture	Missense_Mutation	SNP	52820329	52820329	CC2D1B	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	2701	65
PIAS3	10401	broad.mit.edu	37	1	145584562	145584562	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145584562G>A	uc001eoc.1	+	12	1620	c.1529G>A	c.(1528-1530)AGT>AAT	p.S510N	NBPF10_uc001emp.3_Intron|PIAS3_uc001eod.1_Missense_Mutation_p.S179N	NM_006099	NP_006090	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	510					positive regulation of protein sumoylation|protein sumoylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	enzyme binding|nucleic acid binding|protein C-terminus binding|zinc ion binding			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTCCTGTCCAGTCTCCCACTA	0.592													61	143	---	---	---	---	capture	Missense_Mutation	SNP	145584562	145584562	PIAS3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	11780	65
FLG	2312	broad.mit.edu	37	1	152286200	152286200	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152286200G>T	uc001ezu.1	-	3	1198	c.1162C>A	c.(1162-1164)CAC>AAC	p.H388N	uc001ezv.2_RNA	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	388	Ser-rich.|Filaggrin 2.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTGCTGGTGGCCGGATCCA	0.577									Ichthyosis				190	333	---	---	---	---	capture	Missense_Mutation	SNP	152286200	152286200	FLG	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	5867	65
FLG2	388698	broad.mit.edu	37	1	152323312	152323312	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152323312T>G	uc001ezw.3	-	3	7023	c.6950A>C	c.(6949-6951)CAG>CCG	p.Q2317P	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2317							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAACCTGTCTGTGTGGATTG	0.463													117	149	---	---	---	---	capture	Missense_Mutation	SNP	152323312	152323312	FLG2	1	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	5868	65
LCE3E	353145	broad.mit.edu	37	1	152538509	152538509	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152538509C>T	uc001faa.2	-	2	232	c.176G>A	c.(175-177)CGC>CAC	p.R59H		NM_178435	NP_848522	Q5T5B0	LCE3E_HUMAN	late cornified envelope 3E	59					keratinization					ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)		TCGGTGGTGGCGCCTGTGGTG	0.682													38	67	---	---	---	---	capture	Missense_Mutation	SNP	152538509	152538509	LCE3E	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8593	65
CD5L	922	broad.mit.edu	37	1	157805716	157805716	+	Silent	SNP	A	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157805716A>G	uc001frk.3	-	3	428	c.285T>C	c.(283-285)AGT>AGC	p.S95S		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	95	SRCR 1.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TTCCTGTGCAACTGACTGATT	0.493													31	311	---	---	---	---	capture	Silent	SNP	157805716	157805716	CD5L	1	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	2998	65
ZNF124	7678	broad.mit.edu	37	1	247320190	247320190	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247320190C>T	uc001ick.2	-	4	873	c.734G>A	c.(733-735)TGT>TAT	p.C245Y	ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_Missense_Mutation_p.C183Y	NM_003431	NP_003422	Q15973	ZN124_HUMAN	zinc finger protein 124	245	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			GGAACTGAGACAACTGAAAGC	0.458													51	105	---	---	---	---	capture	Missense_Mutation	SNP	247320190	247320190	ZNF124	1	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17600	65
PGBD2	267002	broad.mit.edu	37	1	249212440	249212440	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:249212440T>A	uc001ifh.2	+	3	1804	c.1657T>A	c.(1657-1659)TGG>AGG	p.W553R	PGBD2_uc001ifg.2_Missense_Mutation_p.W302R|PGBD2_uc009xhd.2_Missense_Mutation_p.W550R	NM_170725	NP_733843	Q6P3X8	PGBD2_HUMAN	hypothetical protein LOC267002 isoform a	553										ovary(1)	1	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GATTGGGCACTGGATTATCCA	0.547													25	114	---	---	---	---	capture	Missense_Mutation	SNP	249212440	249212440	PGBD2	1	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	11684	65
LRIT1	26103	broad.mit.edu	37	10	85992166	85992166	+	Silent	SNP	G	A	A	rs142074653	byFrequency	TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:85992166G>A	uc001kcz.1	-	4	1411	c.1389C>T	c.(1387-1389)TAC>TAT	p.Y463Y		NM_015613	NP_056428	Q9P2V4	LRIT1_HUMAN	retina specific protein PAL	463	Fibronectin type-III.|Lumenal (Potential).					integral to endoplasmic reticulum membrane					0						CAAAGACCGCGTAGAGGACAC	0.582													16	7	---	---	---	---	capture	Silent	SNP	85992166	85992166	LRIT1	10	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8863	65
PTEN	5728	broad.mit.edu	37	10	89692785	89692785	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692785T>C	uc001kfb.2	+	6	1300	c.269T>C	c.(268-270)TTT>TCT	p.F90S		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	90	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.F90fs*9(5)|p.R55fs*1(4)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.F90L(1)|p.F90S(1)|p.Q87_P96del(1)|p.N82_P95del(1)|p.F90_P95>L(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAATATCCTTTTGAAGACCAT	0.338		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			3	23	---	---	---	---	capture	Missense_Mutation	SNP	89692785	89692785	PTEN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	12633	65
SORCS1	114815	broad.mit.edu	37	10	108923743	108923743	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:108923743G>C	uc001kym.2	-	1	550	c.542C>G	c.(541-543)TCT>TGT	p.S181C	SORCS1_uc001kyl.2_Missense_Mutation_p.S181C|SORCS1_uc009xxs.2_Missense_Mutation_p.S181C|SORCS1_uc001kyn.1_Missense_Mutation_p.S181C|SORCS1_uc001kyo.2_Missense_Mutation_p.S181C	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	181	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GTTGTGGCCAGACCAGTGGAC	0.562													22	8	---	---	---	---	capture	Missense_Mutation	SNP	108923743	108923743	SORCS1	10	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	14822	65
SMC3	9126	broad.mit.edu	37	10	112344031	112344031	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112344031G>T	uc001kze.2	+	13	1308	c.1182G>T	c.(1180-1182)TGG>TGT	p.W394C		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	394	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GGGATAAGTGGATTAAAAAGG	0.383													48	26	---	---	---	---	capture	Missense_Mutation	SNP	112344031	112344031	SMC3	10	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	14676	65
DMBT1	1755	broad.mit.edu	37	10	124399762	124399762	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124399762C>T	uc001lgk.1	+	52	6868	c.6762C>T	c.(6760-6762)GAC>GAT	p.D2254D	DMBT1_uc001lgl.1_Silent_p.D2244D|DMBT1_uc001lgm.1_Silent_p.D1626D|DMBT1_uc009xzz.1_Silent_p.D2253D|DMBT1_uc010qtx.1_Silent_p.D974D|DMBT1_uc009yab.1_Silent_p.D957D|DMBT1_uc009yac.1_Silent_p.D548D	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	2254	ZP.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GCAATTTTGACGTGAACATTT	0.463													27	71	---	---	---	---	capture	Silent	SNP	124399762	124399762	DMBT1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4535	65
MUC5B	727897	broad.mit.edu	37	11	1267425	1267425	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1267425C>T	uc009ycr.1	+	49	11190	c.11064C>T	c.(11062-11064)ACC>ACT	p.T3688T	MUC5B_uc001ltb.2_Silent_p.T3108T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3105	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACCCACACCTCCACAGTGC	0.637													4	51	---	---	---	---	capture	Silent	SNP	1267425	1267425	MUC5B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	9889	65
MUC5B	727897	broad.mit.edu	37	11	1267929	1267929	+	Silent	SNP	T	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1267929T>C	uc009ycr.1	+	49	11694	c.11568T>C	c.(11566-11568)ACT>ACC	p.T3856T	MUC5B_uc001ltb.2_Silent_p.T3276T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3273	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTCCAGAGACTGTCCACACCT	0.642													4	31	---	---	---	---	capture	Silent	SNP	1267929	1267929	MUC5B	11	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	9889	65
MUC5B	727897	broad.mit.edu	37	11	1271196	1271196	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1271196C>T	uc009ycr.1	+	51	14631	c.14505C>T	c.(14503-14505)ACC>ACT	p.T4835T	MUC5B_uc001ltb.2_Silent_p.T4365T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	4362	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACCCACACCTCCACAGTGC	0.652													20	68	---	---	---	---	capture	Silent	SNP	1271196	1271196	MUC5B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	9889	65
PAMR1	25891	broad.mit.edu	37	11	35454286	35454286	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:35454286G>A	uc001mwg.2	-	11	1824	c.1781C>T	c.(1780-1782)TCC>TTC	p.S594F	PAMR1_uc001mwf.2_Missense_Mutation_p.S611F|PAMR1_uc010rew.1_Missense_Mutation_p.S483F|PAMR1_uc010rex.1_Missense_Mutation_p.S554F	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN	regeneration associated muscle protease isoform	594	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						AGTGATGTGGGACTCCTGGAA	0.607													35	34	---	---	---	---	capture	Missense_Mutation	SNP	35454286	35454286	PAMR1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11317	65
LRP4	4038	broad.mit.edu	37	11	46880763	46880763	+	Missense_Mutation	SNP	C	T	T	rs146864522		TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46880763C>T	uc001ndn.3	-	38	5635	c.5489G>A	c.(5488-5490)CGA>CAA	p.R1830Q	uc001ndl.2_Intron|LRP4_uc001ndm.3_Missense_Mutation_p.R72Q	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1830	Cytoplasmic (Potential).				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		CCGTGAGCTTCGCAGTTGCTT	0.572													5	109	---	---	---	---	capture	Missense_Mutation	SNP	46880763	46880763	LRP4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8875	65
UNC93B1	81622	broad.mit.edu	37	11	67765211	67765211	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67765211C>T	uc001omw.1	-	7	920	c.840G>A	c.(838-840)CCG>CCA	p.P280P		NM_030930	NP_112192	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1	280					innate immune response|intracellular protein transport|response to virus|toll-like receptor 3 signaling pathway|toll-like receptor 7 signaling pathway|toll-like receptor 9 signaling pathway	early phagosome|endoplasmic reticulum membrane|endosome|integral to membrane|lysosome					0						TTCCGCTCCGCGGGAGCGTCC	0.647													10	10	---	---	---	---	capture	Silent	SNP	67765211	67765211	UNC93B1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16879	65
CNTN5	53942	broad.mit.edu	37	11	100126601	100126601	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:100126601C>A	uc001pga.2	+	17	2454	c.2115C>A	c.(2113-2115)AAC>AAA	p.N705K	CNTN5_uc001pfz.2_Missense_Mutation_p.N705K|CNTN5_uc001pgb.2_Missense_Mutation_p.N631K|CNTN5_uc010ruk.1_5'UTR	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	705	Fibronectin type-III 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CCTCCTACAACCTTCAAGCTC	0.507													37	47	---	---	---	---	capture	Missense_Mutation	SNP	100126601	100126601	CNTN5	11	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	3609	65
CACNA2D4	93589	broad.mit.edu	37	12	1992139	1992139	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:1992139G>A	uc001qjp.2	-	13	1610	c.1379C>T	c.(1378-1380)GCG>GTG	p.A460V	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.A348V	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	460	VWFA.|Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CTGGGTGTCCGCCAGCGTTGA	0.632													14	9	---	---	---	---	capture	Missense_Mutation	SNP	1992139	1992139	CACNA2D4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2527	65
PTPRO	5800	broad.mit.edu	37	12	15654855	15654855	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:15654855C>T	uc001rcv.1	+	5	1137	c.963C>T	c.(961-963)TAC>TAT	p.Y321Y	PTPRO_uc001rcw.1_Silent_p.Y321Y|PTPRO_uc001rcu.1_Silent_p.Y321Y	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	321	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				CCATGGAATACGAAAATAACA	0.448													23	59	---	---	---	---	capture	Silent	SNP	15654855	15654855	PTPRO	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12704	65
MLL2	8085	broad.mit.edu	37	12	49416373	49416373	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49416373C>G	uc001rta.3	-	51	16338	c.16338G>C	c.(16336-16338)CAG>CAC	p.Q5446H		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5446	SET.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CAGCTCATACCTGCTCTTCGT	0.542			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			8	262	---	---	---	---	capture	Missense_Mutation	SNP	49416373	49416373	MLL2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	9533	65
MLL2	8085	broad.mit.edu	37	12	49432216	49432216	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49432216G>A	uc001rta.3	-	34	8923	c.8923C>T	c.(8923-8925)CGC>TGC	p.R2975C		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2975	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GGATTGGGGCGGCCAAGCTCA	0.577			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			44	68	---	---	---	---	capture	Missense_Mutation	SNP	49432216	49432216	MLL2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9533	65
KCNH3	23416	broad.mit.edu	37	12	49935518	49935518	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49935518G>A	uc001ruh.1	+	3	676	c.416G>A	c.(415-417)CGA>CAA	p.R139Q	KCNH3_uc010smj.1_Missense_Mutation_p.R79Q	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H	139	PAC.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity				0						ACCAAGAACCGAGGGGGCCCC	0.592													10	295	---	---	---	---	capture	Missense_Mutation	SNP	49935518	49935518	KCNH3	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7955	65
CRADD	8738	broad.mit.edu	37	12	94243772	94243772	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:94243772C>A	uc001tda.2	+	3	429	c.325C>A	c.(325-327)CAC>AAC	p.H109N	CRADD_uc010sur.1_Intron|CRADD_uc010sus.1_Intron	NM_003805	NP_003796	P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with	109					apoptosis|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|signal transduction	intracellular	death domain binding|protease binding|protein binding, bridging			ovary(1)	1						GATCCCCTCGCACATCCTCAA	0.562													36	46	---	---	---	---	capture	Missense_Mutation	SNP	94243772	94243772	CRADD	12	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	3810	65
CUX2	23316	broad.mit.edu	37	12	111748245	111748245	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111748245G>A	uc001tsa.1	+	15	1812	c.1659G>A	c.(1657-1659)CTG>CTA	p.L553L		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	553	CUT 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						AGGAGCAGCTGGACACGGCAG	0.701													24	34	---	---	---	---	capture	Silent	SNP	111748245	111748245	CUX2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	4025	65
GPR133	283383	broad.mit.edu	37	12	131487822	131487822	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:131487822C>T	uc001uit.3	+	10	1678	c.1119C>T	c.(1117-1119)ACC>ACT	p.T373T	GPR133_uc010tbm.1_Silent_p.T405T	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	373	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCCAGGTCACCGTGGAGGGCT	0.612													57	62	---	---	---	---	capture	Silent	SNP	131487822	131487822	GPR133	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6577	65
TPTE2	93492	broad.mit.edu	37	13	20039688	20039688	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20039688G>A	uc001umd.2	-	9	740	c.529C>T	c.(529-531)CGA>TGA	p.R177*	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Nonsense_Mutation_p.R66*|TPTE2_uc001ume.2_Nonsense_Mutation_p.R100*|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	177						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTAGAAGTCGAACTAAATGT	0.289													17	31	---	---	---	---	capture	Nonsense_Mutation	SNP	20039688	20039688	TPTE2	13	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	16314	65
SPERT	220082	broad.mit.edu	37	13	46287387	46287387	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:46287387C>T	uc001van.1	+	3	307	c.227C>T	c.(226-228)GCC>GTC	p.A76V	SPERT_uc001vao.2_Missense_Mutation_p.A40V	NM_152719	NP_689932	Q8NA61	SPERT_HUMAN	spermatid associated	76						cytoplasmic membrane-bounded vesicle				central_nervous_system(1)|pancreas(1)	2		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		CAGCAGGCCGCCCTGCCCCGG	0.662													14	64	---	---	---	---	capture	Missense_Mutation	SNP	46287387	46287387	SPERT	13	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14931	65
STRN3	29966	broad.mit.edu	37	14	31425409	31425409	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31425409C>A	uc001wqu.2	-	2	538	c.322G>T	c.(322-324)GAG>TAG	p.E108*	STRN3_uc001wqv.2_Nonsense_Mutation_p.E108*|STRN3_uc010tpj.1_RNA	NM_001083893	NP_001077362	Q13033	STRN3_HUMAN	nuclear autoantigen isoform 1	108	Potential.				negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		TTCAGGTTCTCTTGACCTTTT	0.328													39	62	---	---	---	---	capture	Nonsense_Mutation	SNP	31425409	31425409	STRN3	14	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	15220	65
MAX	4149	broad.mit.edu	37	14	65543330	65543330	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65543330G>A	uc001xif.1	-	5	517	c.347C>T	c.(346-348)CCC>CTC	p.P116L	MAX_uc001xic.1_Intron|MAX_uc001xie.1_3'UTR|MAX_uc010aql.1_Missense_Mutation_p.P30S|MAX_uc001xig.1_Missense_Mutation_p.P107L|MAX_uc001xih.1_RNA	NM_002382	NP_002373	P61244	MAX_HUMAN	MAX protein isoform a	116					transcription from RNA polymerase II promoter	cytoplasm|MLL1 complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(1)	1				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)		GTCTGAGGAGGGGTAGTTGGT	0.587													82	158	---	---	---	---	capture	Missense_Mutation	SNP	65543330	65543330	MAX	14	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9252	65
PIF1	80119	broad.mit.edu	37	15	65114493	65114493	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65114493G>A	uc002ant.2	-	4	855	c.789C>T	c.(787-789)ATC>ATT	p.I263I	PIF1_uc002anr.2_5'Flank|PIF1_uc002ans.2_5'Flank|PIF1_uc010uiq.1_Silent_p.I263I|PIF1_uc002anu.2_3'UTR	NM_025049	NP_079325	Q9H611	PIF1_HUMAN	DNA helicase homolog PIF1	263	Hydrolyzes ATP in the presence of both magnesium and single-stranded DNA; weak activity in the presence of RNA or double-stranded DNA; No unwinding activity.				negative regulation of telomerase activity|regulation of telomere maintenance|viral genome replication	nuclear chromosome, telomeric region	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' DNA/RNA helicase activity|magnesium ion binding|single-stranded DNA-dependent ATP-dependent DNA helicase activity|telomeric DNA binding				0						TGGTGCCCCCGATGTGGCAGG	0.612													29	65	---	---	---	---	capture	Silent	SNP	65114493	65114493	PIF1	15	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	11786	65
PPL	5493	broad.mit.edu	37	16	4937215	4937215	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4937215G>A	uc002cyd.1	-	21	2618	c.2528C>T	c.(2527-2529)GCC>GTC	p.A843V		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	843	Spectrin 4.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GAACTTGGCGGCAAGTGCTGC	0.483													4	188	---	---	---	---	capture	Missense_Mutation	SNP	4937215	4937215	PPL	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12235	65
GLG1	2734	broad.mit.edu	37	16	74542799	74542799	+	Missense_Mutation	SNP	G	C	C	rs142819854		TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:74542799G>C	uc002fcy.3	-	3	546	c.496C>G	c.(496-498)CTA>GTA	p.L166V	GLG1_uc002fcx.2_Missense_Mutation_p.L166V|GLG1_uc002fcw.3_Missense_Mutation_p.L155V|GLG1_uc002fcz.3_5'UTR	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	166	Cys-rich GLG1 2.|Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						TCTGTAGTTAGGTTCAGCTTA	0.328													27	53	---	---	---	---	capture	Missense_Mutation	SNP	74542799	74542799	GLG1	16	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	6372	65
CBFA2T3	863	broad.mit.edu	37	16	88945844	88945844	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88945844C>T	uc002fmm.1	-	11	1682	c.1496G>A	c.(1495-1497)CGG>CAG	p.R499Q	CBFA2T3_uc002fml.1_Missense_Mutation_p.R413Q|CBFA2T3_uc002fmk.1_5'UTR	NM_005187	NP_005178	O75081	MTG16_HUMAN	myeloid translocation gene on chromosome 16	499	Mediates interaction with PRKAR2A.|Potential.				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CATGGCCTGCCGCTTCACCTC	0.647			T	RUNX1	AML								17	31	---	---	---	---	capture	Missense_Mutation	SNP	88945844	88945844	CBFA2T3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2674	65
P2RX5	5026	broad.mit.edu	37	17	3582918	3582918	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3582918C>T	uc002fwi.2	-	11	1509	c.1225G>A	c.(1225-1227)GGA>AGA	p.G409R	P2RX5_uc002fwd.2_RNA|P2RX5_uc002fwh.1_Missense_Mutation_p.G408R|P2RX5_uc010vrx.1_Missense_Mutation_p.G349R|P2RX5_uc002fwj.2_Missense_Mutation_p.G384R|P2RX5_uc002fwk.2_Missense_Mutation_p.G408R|P2RX5_uc002fwl.2_Missense_Mutation_p.G385R	NM_002561	NP_002552	Q93086	P2RX5_HUMAN	purinergic receptor P2X5 isoform A	409	Cytoplasmic (Potential).				nervous system development|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						CACACAGATCCGTTCCCCTTC	0.672													19	47	---	---	---	---	capture	Missense_Mutation	SNP	3582918	3582918	P2RX5	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11247	65
RABEP1	9135	broad.mit.edu	37	17	5238607	5238607	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5238607G>A	uc002gbm.3	+	4	720	c.496G>A	c.(496-498)GAG>AAG	p.E166K	RABEP1_uc010clc.1_Missense_Mutation_p.E166K|RABEP1_uc010cld.1_Missense_Mutation_p.E123K|RABEP1_uc010vsw.1_Missense_Mutation_p.E123K|RABEP1_uc002gbl.3_Missense_Mutation_p.E166K|RABEP1_uc002gbj.2_Missense_Mutation_p.E166K|RABEP1_uc002gbk.2_Missense_Mutation_p.E166K	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	166	Potential.				apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						TGAAGGTCAAGAGGAGGAAAA	0.383													4	52	---	---	---	---	capture	Missense_Mutation	SNP	5238607	5238607	RABEP1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	12856	65
TP53	7157	broad.mit.edu	37	17	7578394	7578394	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578394T>C	uc002gim.2	-	5	730	c.536A>G	c.(535-537)CAT>CGT	p.H179R	TP53_uc002gig.1_Missense_Mutation_p.H179R|TP53_uc002gih.2_Missense_Mutation_p.H179R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H47R|TP53_uc010cng.1_Missense_Mutation_p.H47R|TP53_uc002gii.1_Missense_Mutation_p.H47R|TP53_uc010cnh.1_Missense_Mutation_p.H179R|TP53_uc010cni.1_Missense_Mutation_p.H179R|TP53_uc002gij.2_Missense_Mutation_p.H179R|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.H86R|TP53_uc002gio.2_Missense_Mutation_p.H47R|TP53_uc010vug.1_Missense_Mutation_p.H140R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	179	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	H -> Q (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H179R(99)|p.H179Y(74)|p.H179L(31)|p.H179Q(17)|p.H179N(13)|p.H179D(10)|p.P177_C182delPHHERC(8)|p.0?(7)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.R175_E180delRCPHHE(3)|p.H179fs*68(2)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.K164_P219del(1)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.E171fs*1(1)|p.R174fs*3(1)|p.H178_H179>QY(1)|p.E171fs*61(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCAGCGCTCATGGTGGGGGCA	0.642		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			27	56	---	---	---	---	capture	Missense_Mutation	SNP	7578394	7578394	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	16264	65
PEX12	5193	broad.mit.edu	37	17	33904306	33904306	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33904306G>C	uc002hjp.2	-	2	1047	c.431C>G	c.(430-432)TCT>TGT	p.S144C		NM_000286	NP_000277	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	144	Cytoplasmic (Potential).				protein import into peroxisome matrix	integral to peroxisomal membrane	protein C-terminus binding|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGATGAATAGAATATTCATC	0.453													102	89	---	---	---	---	capture	Missense_Mutation	SNP	33904306	33904306	PEX12	17	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	11643	65
KRTAP4-11	653240	broad.mit.edu	37	17	39274206	39274206	+	Missense_Mutation	SNP	C	T	T	rs79388709		TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274206C>T	uc002hvz.2	-	1	401	c.362G>A	c.(361-363)AGA>AAA	p.R121K		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	20.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcactggggtctgcagcagct	0.100													4	54	---	---	---	---	capture	Missense_Mutation	SNP	39274206	39274206	KRTAP4-11	17	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8469	65
KRT38	8687	broad.mit.edu	37	17	39593757	39593757	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39593757G>A	uc002hwq.1	-	7	1701	c.1278C>T	c.(1276-1278)TGC>TGT	p.C426C		NM_006771	NP_006762	O76015	KRT38_HUMAN	keratin 38	426	Tail.					intermediate filament	structural molecule activity			skin(2)	2		Breast(137;0.000496)				GGGCAGTCACGCAGGAGGGAG	0.617													5	15	---	---	---	---	capture	Silent	SNP	39593757	39593757	KRT38	17	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	8395	65
CCBE1	147372	broad.mit.edu	37	18	57106776	57106776	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:57106776T>G	uc002lib.2	-	9	1020	c.950A>C	c.(949-951)AAG>ACG	p.K317T	CCBE1_uc010dpq.2_Missense_Mutation_p.K46T|CCBE1_uc002lia.2_Missense_Mutation_p.K170T	NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	317	Collagen-like 2.				lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				AAGGCTTACCTTAGAACCATC	0.348													102	177	---	---	---	---	capture	Missense_Mutation	SNP	57106776	57106776	CCBE1	18	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	2705	65
ADNP2	22850	broad.mit.edu	37	18	77896514	77896514	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77896514T>C	uc002lnw.2	+	4	3673	c.3218T>C	c.(3217-3219)ATA>ACA	p.I1073T		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	1073	Homeobox.				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		AAAAAGGAAATAGAACTGTTG	0.313													57	73	---	---	---	---	capture	Missense_Mutation	SNP	77896514	77896514	ADNP2	18	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	324	65
ADNP2	22850	broad.mit.edu	37	18	77896534	77896534	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77896534T>C	uc002lnw.2	+	4	3693	c.3238T>C	c.(3238-3240)TTT>CTT	p.F1080L		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	1080	Homeobox.				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GTCCTCACTCTTTTGGGTGTG	0.328													61	64	---	---	---	---	capture	Missense_Mutation	SNP	77896534	77896534	ADNP2	18	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	324	65
GCDH	2639	broad.mit.edu	37	19	13008135	13008135	+	Silent	SNP	A	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13008135A>T	uc002mvq.2	+	10	1052	c.975A>T	c.(973-975)CCA>CCT	p.P325P	GCDH_uc010xms.1_Silent_p.P292P|GCDH_uc002mvp.2_Silent_p.P325P|GCDH_uc010xmt.1_Silent_p.P159P|GCDH_uc010xmu.1_Silent_p.P281P	NM_000159	NP_000150	Q92947	GCDH_HUMAN	glutaryl-Coenzyme A dehydrogenase isoform a	325					lysine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|glutaryl-CoA dehydrogenase activity|protein binding				0						TTGGTGTCCCACTGGCCAGGA	0.627													15	44	---	---	---	---	capture	Silent	SNP	13008135	13008135	GCDH	19	A	T	T	T	1	0	0	0	0	0	0	0	1	67	6	4	4	6227	65
PDE4C	5143	broad.mit.edu	37	19	18327614	18327614	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18327614G>A	uc010xqc.1	-	12	1902	c.1422C>T	c.(1420-1422)TGC>TGT	p.C474C	PDE4C_uc002nik.3_Silent_p.C474C|PDE4C_uc002nil.3_Silent_p.C474C|PDE4C_uc002nif.3_Silent_p.C243C|PDE4C_uc002nig.3_Silent_p.C189C|PDE4C_uc002nih.3_Silent_p.C244C|PDE4C_uc010ebk.2_Silent_p.C368C|PDE4C_uc002nii.3_Silent_p.C442C|PDE4C_uc010ebl.2_Silent_p.C188C|PDE4C_uc010xqd.1_Silent_p.C243C	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	474					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	GGAAGATATCGCAGTTCTCTG	0.602													37	112	---	---	---	---	capture	Silent	SNP	18327614	18327614	PDE4C	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	11544	65
CILP2	148113	broad.mit.edu	37	19	19653191	19653191	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19653191C>T	uc002nmv.3	+	5	685	c.600C>T	c.(598-600)AGC>AGT	p.S200S	CILP2_uc002nmw.3_Silent_p.S206S	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	200						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						CAGGGTGCAGCCTTGACACCT	0.582													15	39	---	---	---	---	capture	Silent	SNP	19653191	19653191	CILP2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	3395	65
ZNF208	7757	broad.mit.edu	37	19	22154854	22154854	+	Silent	SNP	A	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22154854A>T	uc002nqp.2	-	6	2747	c.2598T>A	c.(2596-2598)ATT>ATA	p.I866I	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTCCAGTATGAATTACCTTAT	0.348													35	95	---	---	---	---	capture	Silent	SNP	22154854	22154854	ZNF208	19	A	T	T	T	1	0	0	0	0	0	0	0	1	112	9	4	4	17646	65
MLL4	9757	broad.mit.edu	37	19	36222840	36222840	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36222840C>T	uc010eei.2	+	28	5469	c.5469C>T	c.(5467-5469)GAC>GAT	p.D1823D		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1823					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCCACTGGACACAGATGTTC	0.627													15	28	---	---	---	---	capture	Silent	SNP	36222840	36222840	MLL4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	9535	65
MEGF8	1954	broad.mit.edu	37	19	42873137	42873137	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42873137C>T	uc002otl.3	+	36	7058	c.6423C>T	c.(6421-6423)ACC>ACT	p.T2141T	MEGF8_uc002otm.3_Silent_p.T1749T|MEGF8_uc002otn.3_5'Flank	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2208	Extracellular (Potential).|EGF-like 5.					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				GCTGCAAGACCGGCTATACCA	0.637													22	56	---	---	---	---	capture	Silent	SNP	42873137	42873137	MEGF8	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9376	65
ZNF813	126017	broad.mit.edu	37	19	53994332	53994332	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53994332G>A	uc002qbu.2	+	4	974	c.846G>A	c.(844-846)CAG>CAA	p.Q282Q	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	282	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		CTTTCAGTCAGACGTATTCCC	0.418													44	125	---	---	---	---	capture	Silent	SNP	53994332	53994332	ZNF813	19	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	18051	65
IL1F8	27177	broad.mit.edu	37	2	113780342	113780342	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113780342C>T	uc002tiq.1	-	6	508	c.404G>A	c.(403-405)TGG>TAG	p.W135*		NM_014438	NP_055253	Q9NZH7	IL36B_HUMAN	interleukin 1 family, member 8 isoform 1	135					immune response	extracellular space	cytokine activity|interleukin-1 receptor binding			ovary(1)	1						GGAACTCTTCCACTTCTTTCT	0.438													29	43	---	---	---	---	capture	Nonsense_Mutation	SNP	113780342	113780342	IL1F8	2	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	7579	65
GALNT5	11227	broad.mit.edu	37	2	158165160	158165160	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158165160G>A	uc002tzg.2	+	9	2857	c.2602G>A	c.(2602-2604)GTA>ATA	p.V868I	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	868	Lumenal (Potential).|Ricin B-type lectin.				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						TAAAGGAGCCGTAAGGCTGCA	0.408													76	112	---	---	---	---	capture	Missense_Mutation	SNP	158165160	158165160	GALNT5	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6156	65
TTN	7273	broad.mit.edu	37	2	179553840	179553840	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179553840C>T	uc010zfg.1	-	122	28527	c.28303G>A	c.(28303-28305)GTC>ATC	p.V9435I	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V6096I|TTN_uc010fre.1_Missense_Mutation_p.V546I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10362							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTCTGGGACGGGTTTCTTA	0.428													21	57	---	---	---	---	capture	Missense_Mutation	SNP	179553840	179553840	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	65
CCDC108	255101	broad.mit.edu	37	2	219892442	219892442	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219892442C>T	uc002vjl.1	-	13	2225	c.2141G>A	c.(2140-2142)CGC>CAC	p.R714H	CCDC108_uc010fwa.1_Missense_Mutation_p.R157H|CCDC108_uc010zkp.1_Missense_Mutation_p.R703H|CCDC108_uc010zkq.1_Missense_Mutation_p.R649H	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	714						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAAGTGCAGGCGCATGGCCAT	0.597													36	63	---	---	---	---	capture	Missense_Mutation	SNP	219892442	219892442	CCDC108	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2717	65
COL6A3	1293	broad.mit.edu	37	2	238289831	238289831	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238289831C>T	uc002vwl.2	-	5	1909	c.1624G>A	c.(1624-1626)GGC>AGC	p.G542S	COL6A3_uc002vwo.2_Missense_Mutation_p.G336S|COL6A3_uc010znj.1_Missense_Mutation_p.G135S|COL6A3_uc002vwq.2_Missense_Mutation_p.G336S|COL6A3_uc002vwr.2_Missense_Mutation_p.G135S|COL6A3_uc010znk.1_Missense_Mutation_p.G542S	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	542	VWFA 3.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCCCGGTAGCCGGCTGAACTC	0.557													67	81	---	---	---	---	capture	Missense_Mutation	SNP	238289831	238289831	COL6A3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3666	65
PER2	8864	broad.mit.edu	37	2	239161798	239161798	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239161798G>A	uc002vyc.2	-	19	3103	c.2866C>T	c.(2866-2868)CCC>TCC	p.P956S	PER2_uc010znv.1_Missense_Mutation_p.P956S	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	956	Pro-rich.				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GGCTGTCTGGGGATCGAGGTC	0.667													28	58	---	---	---	---	capture	Missense_Mutation	SNP	239161798	239161798	PER2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11633	65
AQP12A	375318	broad.mit.edu	37	2	241631371	241631371	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241631371C>T	uc002vzu.2	+	1	110	c.41C>T	c.(40-42)ACC>ATC	p.T14I	AQP12A_uc002vzv.2_Intron	NM_198998	NP_945349	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	14	Helical; Name=1; (Potential).					integral to membrane	transporter activity				0		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		TTCTTTGCCACCTTCGCCCTC	0.677													51	116	---	---	---	---	capture	Missense_Mutation	SNP	241631371	241631371	AQP12A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	817	65
SRXN1	140809	broad.mit.edu	37	20	629466	629466	+	Silent	SNP	G	A	A	rs140166119		TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:629466G>A	uc002wea.2	-	2	367	c.306C>T	c.(304-306)TAC>TAT	p.Y102Y	SRXN1_uc002web.2_RNA	NM_080725	NP_542763	Q9BYN0	SRXN1_HUMAN	sulfiredoxin 1 homolog	102					response to oxidative stress	cytosol	antioxidant activity|ATP binding|DNA binding|sulfiredoxin activity			ovary(1)	1						GGTAGGCCGCGTAGCGGTGGC	0.617													72	60	---	---	---	---	capture	Silent	SNP	629466	629466	SRXN1	20	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15065	65
PROKR2	128674	broad.mit.edu	37	20	5282783	5282783	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5282783C>T	uc010zqw.1	-	2	1058	c.1058G>A	c.(1057-1059)CGT>CAT	p.R353H	PROKR2_uc010zqx.1_Missense_Mutation_p.R353H|PROKR2_uc010zqy.1_Missense_Mutation_p.R353H	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	353	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CTGGGAGGGACGCCAGTGCAG	0.557										HNSCC(71;0.22)			42	91	---	---	---	---	capture	Missense_Mutation	SNP	5282783	5282783	PROKR2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12449	65
SEL1L2	80343	broad.mit.edu	37	20	13899669	13899669	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13899669T>A	uc010gcf.2	-	4	466	c.384A>T	c.(382-384)GAA>GAT	p.E128D	SEL1L2_uc002woq.3_Translation_Start_Site|SEL1L2_uc010zrl.1_Missense_Mutation_p.E128D|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	128	Extracellular (Potential).|Sel1-like 1.					integral to membrane	binding			ovary(2)	2						AGACTTACTCTTCTTTTTGTT	0.343													37	108	---	---	---	---	capture	Missense_Mutation	SNP	13899669	13899669	SEL1L2	20	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	13904	65
SPAG4	6676	broad.mit.edu	37	20	34206899	34206899	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34206899G>A	uc002xdb.1	+	8	889	c.772G>A	c.(772-774)GAC>AAC	p.D258N	SPAG4_uc010zvi.1_Missense_Mutation_p.D181N	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	258					spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			GCGGAAGCCCGACTATGCTTT	0.468													20	65	---	---	---	---	capture	Missense_Mutation	SNP	34206899	34206899	SPAG4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14872	65
PLCG1	5335	broad.mit.edu	37	20	39795447	39795447	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39795447T>G	uc002xjp.1	+	19	2370	c.2249T>G	c.(2248-2250)ATG>AGG	p.M750R	PLCG1_uc002xjo.1_Missense_Mutation_p.M750R|PLCG1_uc010zwe.1_Missense_Mutation_p.M376R|PLCG1_uc010ggf.2_Missense_Mutation_p.M100R	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	750	SH2 2.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				TACCGCAAGATGAAGCTGCGC	0.572													57	118	---	---	---	---	capture	Missense_Mutation	SNP	39795447	39795447	PLCG1	20	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	11938	65
PLCG1	5335	broad.mit.edu	37	20	39795453	39795453	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39795453T>A	uc002xjp.1	+	19	2376	c.2255T>A	c.(2254-2256)CTG>CAG	p.L752Q	PLCG1_uc002xjo.1_Missense_Mutation_p.L752Q|PLCG1_uc010zwe.1_Missense_Mutation_p.L378Q|PLCG1_uc010ggf.2_Missense_Mutation_p.L102Q	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	752	SH2 2.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				AAGATGAAGCTGCGCTATCCC	0.567													52	116	---	---	---	---	capture	Missense_Mutation	SNP	39795453	39795453	PLCG1	20	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	11938	65
ERG	2078	broad.mit.edu	37	21	39795357	39795357	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:39795357G>A	uc010gnw.2	-	5	679	c.384C>T	c.(382-384)AAC>AAT	p.N128N	ERG_uc002yxa.2_Silent_p.N121N|ERG_uc011aek.1_Silent_p.N29N|ERG_uc010gnv.2_Silent_p.N29N|ERG_uc010gnx.2_Silent_p.N128N|ERG_uc011ael.1_Silent_p.N128N|ERG_uc002yxb.2_Silent_p.N128N|ERG_uc011aem.1_Silent_p.N121N|ERG_uc002yxc.3_Silent_p.N128N	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4	128	PNT.				cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				CTCTGCGCTCGTTCGTGGTCA	0.602													17	31	---	---	---	---	capture	Silent	SNP	39795357	39795357	ERG	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5177	65
UBASH3A	53347	broad.mit.edu	37	21	43867265	43867265	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43867265C>T	uc002zbe.2	+	15	1983	c.1947C>T	c.(1945-1947)AAC>AAT	p.N649N	UBASH3A_uc002zbf.2_Silent_p.N611N|UBASH3A_uc010gpc.2_RNA|UBASH3A_uc010gpd.2_RNA|UBASH3A_uc010gpe.2_3'UTR	NM_018961	NP_061834	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing,	649	Phosphatase-like.					cytosol|nucleus				ovary(3)	3						ACGGGGCGAACGCAGCATTTA	0.527													5	223	---	---	---	---	capture	Silent	SNP	43867265	43867265	UBASH3A	21	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16721	65
GAL3ST1	9514	broad.mit.edu	37	22	30951882	30951882	+	Silent	SNP	G	A	A	rs112070427	byFrequency;by1000genomes	TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30951882G>A	uc003aig.1	-	4	470	c.330C>T	c.(328-330)AAC>AAT	p.N110N	GAL3ST1_uc003aih.1_Silent_p.N110N|GAL3ST1_uc003aii.1_Silent_p.N110N|GAL3ST1_uc010gvz.1_Silent_p.N110N	NM_004861	NP_004852	Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	110	Lumenal (Potential).				protein N-linked glycosylation	Golgi membrane|integral to plasma membrane|membrane fraction	galactosylceramide sulfotransferase activity				0						CATTGCGGCCGTTAGGGAAGG	0.597													16	115	---	---	---	---	capture	Silent	SNP	30951882	30951882	GAL3ST1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6137	65
PLCD1	5333	broad.mit.edu	37	3	38050824	38050824	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38050824C>A	uc003chn.2	-	10	1669	c.1545G>T	c.(1543-1545)CAG>CAT	p.Q515H	PLCD1_uc003chm.2_Missense_Mutation_p.Q536H	NM_006225	NP_006216	P51178	PLCD1_HUMAN	phospholipase C, delta 1 isoform 2	515	PI-PLC Y-box.				intracellular signal transduction|lipid catabolic process|phospholipid metabolic process	cytoplasm	calcium ion binding|GTPase activating protein binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CGTAGAAGGCCTGTCCAGGGG	0.577													49	63	---	---	---	---	capture	Missense_Mutation	SNP	38050824	38050824	PLCD1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	11934	65
SCN10A	6336	broad.mit.edu	37	3	38783979	38783979	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38783979T>A	uc003ciq.2	-	13	1909	c.1909A>T	c.(1909-1911)AGC>TGC	p.S637C		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	637					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	TGAGACAAGCTGGTCAAGCAG	0.468													66	133	---	---	---	---	capture	Missense_Mutation	SNP	38783979	38783979	SCN10A	3	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	13805	65
ITIH3	3699	broad.mit.edu	37	3	52842629	52842629	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52842629G>A	uc003dfv.2	+	22	2641	c.2605G>A	c.(2605-2607)GTC>ATC	p.V869I	ITIH3_uc011bek.1_Missense_Mutation_p.V677I	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	869					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTGCTGGTTCGTCCACAACAA	0.537													21	39	---	---	---	---	capture	Missense_Mutation	SNP	52842629	52842629	ITIH3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7828	65
ALG1L	200810	broad.mit.edu	37	3	125651539	125651539	+	Silent	SNP	A	C	C	rs147593769	by1000genomes	TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:125651539A>C	uc003eig.1	-	3	278	c.114T>G	c.(112-114)CTT>CTG	p.L38L		NM_001015050	NP_001015050	Q6GMV1	ALG1L_HUMAN	asparagine-linked glycosylation 1-like	38							transferase activity, transferring glycosyl groups				0						CATCAAGAGTAAGTTGTTCAA	0.353													3	123	---	---	---	---	capture	Silent	SNP	125651539	125651539	ALG1L	3	A	C	C	C	1	0	0	0	0	0	0	0	1	158	13	4	4	517	65
NAALADL2	254827	broad.mit.edu	37	3	174951943	174951943	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:174951943C>G	uc003fit.2	+	3	855	c.768C>G	c.(766-768)AGC>AGG	p.S256R	NAALADL2_uc003fiu.1_Missense_Mutation_p.S249R|NAALADL2_uc010hwy.1_Missense_Mutation_p.S78R	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	256	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		AAGATAGCAGCCAAGACCTGC	0.463													35	73	---	---	---	---	capture	Missense_Mutation	SNP	174951943	174951943	NAALADL2	3	C	G	G	G	1	0	0	0	0	1	0	0	0	337	26	4	4	10040	65
YEATS2	55689	broad.mit.edu	37	3	183470006	183470006	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183470006C>T	uc003fly.2	+	10	1310	c.1115C>T	c.(1114-1116)TCA>TTA	p.S372L		NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	372					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATAAAGCAGTCACATGAGCCA	0.478													99	129	---	---	---	---	capture	Missense_Mutation	SNP	183470006	183470006	YEATS2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	17353	65
VPS8	23355	broad.mit.edu	37	3	184714255	184714255	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184714255C>T	uc003fpb.1	+	43	3967	c.3796C>T	c.(3796-3798)CGC>TGC	p.R1266C	VPS8_uc010hyd.1_Missense_Mutation_p.R1176C|VPS8_uc010hye.1_Missense_Mutation_p.R695C	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	1268	RING-type; atypical.						zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GTACAAGAGACGCCAAGAAAT	0.413													40	67	---	---	---	---	capture	Missense_Mutation	SNP	184714255	184714255	VPS8	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17100	65
DGKQ	1609	broad.mit.edu	37	4	956607	956607	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:956607C>T	uc003gbw.2	-	17	2062	c.1988G>A	c.(1987-1989)CGA>CAA	p.R663Q	DGKQ_uc010ibn.2_Missense_Mutation_p.R650Q	NM_001347	NP_001338	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta	663	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding			kidney(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCAGGCCAGTCGGTACCGTGT	0.687													3	10	---	---	---	---	capture	Missense_Mutation	SNP	956607	956607	DGKQ	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4431	65
KLHL5	51088	broad.mit.edu	37	4	39116882	39116882	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39116882G>A	uc003gts.2	+	10	2218	c.2143G>A	c.(2143-2145)GGG>AGG	p.G715R	KLHL5_uc003gtp.2_Missense_Mutation_p.G669R|KLHL5_uc003gtq.2_Missense_Mutation_p.G528R|KLHL5_uc003gtr.1_Missense_Mutation_p.G715R|KLHL5_uc003gtt.2_Missense_Mutation_p.G654R	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN	kelch-like 5 isoform 1	715	Kelch 6.					cytoplasm|cytoskeleton	actin binding			ovary(1)	1						TGCTGTTGGGGGGTATGATGG	0.458													30	47	---	---	---	---	capture	Missense_Mutation	SNP	39116882	39116882	KLHL5	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	8312	65
IGJ	3512	broad.mit.edu	37	4	71527860	71527860	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71527860C>T	uc003hfn.3	-	2	278	c.137G>A	c.(136-138)CGT>CAT	p.R46H	IGJ_uc010ihz.2_Missense_Mutation_p.R62H	NM_144646	NP_653247	P01591	IGJ_HUMAN	immunoglobulin J chain	46					immune response	extracellular region	antigen binding				0			Lung(101;0.235)			TTCGGAAGAACGGATGATCCT	0.383													59	77	---	---	---	---	capture	Missense_Mutation	SNP	71527860	71527860	IGJ	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7516	65
CXXC4	80319	broad.mit.edu	37	4	105412449	105412449	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:105412449G>A	uc003hxg.2	-	1	19	c.4C>T	c.(4-6)CAC>TAC	p.H2Y	uc003hxh.1_Intron|CXXC4_uc010ilo.2_Intron	NM_025212	NP_079488	Q9H2H0	CXXC4_HUMAN	CXXC finger 4	2					negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway|zygotic specification of dorsal/ventral axis		DNA binding|PDZ domain binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		TTTCGGTGGTGCATGCTGGTC	0.378													46	77	---	---	---	---	capture	Missense_Mutation	SNP	105412449	105412449	CXXC4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4058	65
CDH18	1016	broad.mit.edu	37	5	19747216	19747216	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19747216G>T	uc003jgc.2	-	3	735	c.358C>A	c.(358-360)CAG>AAG	p.Q120K	CDH18_uc003jgd.2_Missense_Mutation_p.Q120K|CDH18_uc011cnm.1_Missense_Mutation_p.Q120K	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	120	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TGGGTCTTCTGCTCTCTGTCT	0.433													52	88	---	---	---	---	capture	Missense_Mutation	SNP	19747216	19747216	CDH18	5	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	3074	65
PRDM9	56979	broad.mit.edu	37	5	23523414	23523414	+	Silent	SNP	A	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23523414A>G	uc003jgo.2	+	9	1079	c.897A>G	c.(895-897)AGA>AGG	p.R299R		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	299	SET.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						CCAAGGGGAGAAACTGCTATG	0.428										HNSCC(3;0.000094)			28	45	---	---	---	---	capture	Silent	SNP	23523414	23523414	PRDM9	5	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	12359	65
ADAMTS12	81792	broad.mit.edu	37	5	33615934	33615934	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33615934T>C	uc003jia.1	-	15	2550	c.2387A>G	c.(2386-2388)CAG>CGG	p.Q796R	ADAMTS12_uc010iuq.1_Missense_Mutation_p.Q711R	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	796	Spacer 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CTGCATTACCTGGATCCACAC	0.473										HNSCC(64;0.19)			61	84	---	---	---	---	capture	Missense_Mutation	SNP	33615934	33615934	ADAMTS12	5	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	257	65
MAP3K1	4214	broad.mit.edu	37	5	56168509	56168509	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56168509C>T	uc003jqw.3	+	8	1966	c.1465C>T	c.(1465-1467)CCC>TCC	p.P489S		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	489	RING-type.				cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TTTAATATGTCCCCTTTGTAG	0.279													10	80	---	---	---	---	capture	Missense_Mutation	SNP	56168509	56168509	MAP3K1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9157	65
FAM81B	153643	broad.mit.edu	37	5	94749771	94749771	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94749771C>T	uc003kla.1	+	4	460	c.414C>T	c.(412-414)GAC>GAT	p.D138D	FAM81B_uc010jbe.1_5'UTR	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	138										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		TCAAGGAGGACATCTCTGCTT	0.522													52	63	---	---	---	---	capture	Silent	SNP	94749771	94749771	FAM81B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	5575	65
PCDHA7	56141	broad.mit.edu	37	5	140215715	140215715	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140215715C>T	uc003lhq.2	+	1	1747	c.1747C>T	c.(1747-1749)CGG>TGG	p.R583W	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.R583W	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	583	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTGTGCCGCGGTCTGTGGG	0.657													19	110	---	---	---	---	capture	Missense_Mutation	SNP	140215715	140215715	PCDHA7	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11432	65
NMUR2	56923	broad.mit.edu	37	5	151784353	151784353	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151784353G>A	uc003luv.2	-	1	488	c.322C>T	c.(322-324)CGC>TGC	p.R108C		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	108	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			GGGTAGTTGCGCCACATCTCA	0.587													51	91	---	---	---	---	capture	Missense_Mutation	SNP	151784353	151784353	NMUR2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10414	65
TIMD4	91937	broad.mit.edu	37	5	156349123	156349123	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156349123C>T	uc003lwh.2	-	7	1056	c.999G>A	c.(997-999)GCG>GCA	p.A333A	TIMD4_uc010jii.2_Silent_p.A305A|TIMD4_uc003lwg.2_Silent_p.A35A	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	333	Helical; (Potential).					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCAGGAGAAACGCCACAAACA	0.517													16	28	---	---	---	---	capture	Silent	SNP	156349123	156349123	TIMD4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	15788	65
MYLIP	29116	broad.mit.edu	37	6	16143302	16143302	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:16143302A>C	uc003nbq.2	+	4	753	c.516A>C	c.(514-516)GAA>GAC	p.E172D	MYLIP_uc003nbr.2_5'UTR	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting	172	FERM.				cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			CTTCAGCTGAATACCAAGTTT	0.463													38	36	---	---	---	---	capture	Missense_Mutation	SNP	16143302	16143302	MYLIP	6	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	9965	65
FKSG83	83954	broad.mit.edu	37	6	27293586	27293586	+	Silent	SNP	A	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27293586A>G	uc010jqt.2	+	1	1009	c.525A>G	c.(523-525)AGA>AGG	p.R175R	FKSG83_uc010jqs.1_3'UTR	NM_032030	NP_114419	Q3KNW7	Q3KNW7_HUMAN	FKSG83	175						integral to membrane	pheromone receptor activity				0						TGCATCAAAGAAATCCTGATA	0.244													13	7	---	---	---	---	capture	Silent	SNP	27293586	27293586	FKSG83	6	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	5863	65
SLC22A7	10864	broad.mit.edu	37	6	43267438	43267438	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43267438G>A	uc003out.2	+	4	676	c.577G>A	c.(577-579)GTC>ATC	p.V193I	SLC22A7_uc010jyl.1_Missense_Mutation_p.V191I|SLC22A7_uc003ous.2_Missense_Mutation_p.V191I	NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	solute carrier family 22 member 7 isoform b	193	Helical; (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TGCAGCCTCCGTCAGCTATGT	0.587													79	102	---	---	---	---	capture	Missense_Mutation	SNP	43267438	43267438	SLC22A7	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14351	65
MEP1A	4224	broad.mit.edu	37	6	46806843	46806843	+	Silent	SNP	C	T	T	rs139598232	byFrequency	TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46806843C>T	uc010jzh.1	+	14	2253	c.2211C>T	c.(2209-2211)ATC>ATT	p.I737I	MEP1A_uc011dwg.1_Silent_p.I459I|MEP1A_uc011dwh.1_Silent_p.I765I|MEP1A_uc011dwi.1_Silent_p.I637I	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	737	Helical; (Potential).				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			TCTCCATCATCGCCATCCTTT	0.602													44	55	---	---	---	---	capture	Silent	SNP	46806843	46806843	MEP1A	6	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	9388	65
C6orf221	154288	broad.mit.edu	37	6	74073290	74073290	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74073290G>A	uc003pgt.3	+	3	414	c.361G>A	c.(361-363)GCC>ACC	p.A121T		NM_001017361	NP_001017361	Q587J8	ECAT1_HUMAN	hypothetical protein LOC154288	121										skin(2)	2						CTCAGGAAAGGCCCTCGCCCA	0.617													33	47	---	---	---	---	capture	Missense_Mutation	SNP	74073290	74073290	C6orf221	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	2332	65
MACC1	346389	broad.mit.edu	37	7	20198221	20198221	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20198221G>A	uc003sus.3	-	5	2072	c.1763C>T	c.(1762-1764)GCT>GTT	p.A588V	MACC1_uc010kug.2_Missense_Mutation_p.A588V	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	588	SH3.				positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						CTGACCAATAGCTTTTACCTT	0.418													40	316	---	---	---	---	capture	Missense_Mutation	SNP	20198221	20198221	MACC1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	9058	65
EGFR	1956	broad.mit.edu	37	7	55214352	55214352	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55214352G>A	uc003tqk.2	+	4	724	c.478G>A	c.(478-480)GAG>AAG	p.E160K	EGFR_uc003tqh.2_Missense_Mutation_p.E160K|EGFR_uc003tqi.2_Missense_Mutation_p.E160K|EGFR_uc003tqj.2_Missense_Mutation_p.E160K|EGFR_uc010kzg.1_Intron|EGFR_uc011kco.1_Missense_Mutation_p.E107K	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	160	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGCAACGTGGAGAGCATCCA	0.552		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			14	831	---	---	---	---	capture	Missense_Mutation	SNP	55214352	55214352	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4922	65
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			218	719	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	65
COL1A2	1278	broad.mit.edu	37	7	94056341	94056341	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94056341G>C	uc003ung.1	+	47	3598	c.3127G>C	c.(3127-3129)GCT>CCT	p.A1043P	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1043					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGATCAAGGTGCTCCTGGCTC	0.458										HNSCC(75;0.22)			18	49	---	---	---	---	capture	Missense_Mutation	SNP	94056341	94056341	COL1A2	7	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	3643	65
NPTX2	4885	broad.mit.edu	37	7	98254262	98254262	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98254262G>A	uc003upl.2	+	3	849	c.672G>A	c.(670-672)GCG>GCA	p.A224A		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	224					synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CACCAGATGCGTTCAAGGTGT	0.602													133	384	---	---	---	---	capture	Silent	SNP	98254262	98254262	NPTX2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10510	65
TRRAP	8295	broad.mit.edu	37	7	98528341	98528341	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98528341G>T	uc003upp.2	+	25	3688	c.3479G>T	c.(3478-3480)GGT>GTT	p.G1160V	TRRAP_uc011kis.1_Missense_Mutation_p.G1160V|TRRAP_uc003upr.2_Missense_Mutation_p.G852V	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	1160					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AAGCTGGGGGGTGTGGTGTCT	0.517													64	198	---	---	---	---	capture	Missense_Mutation	SNP	98528341	98528341	TRRAP	7	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	16484	65
IFRD1	3475	broad.mit.edu	37	7	112112859	112112859	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:112112859C>T	uc003vgh.2	+	12	1652	c.1209C>T	c.(1207-1209)CCC>CCT	p.P403P	IFRD1_uc011kmn.1_Silent_p.P353P|IFRD1_uc003vgj.2_Silent_p.P403P|IFRD1_uc011kmo.1_RNA|IFRD1_uc011kmp.1_Silent_p.P353P|IFRD1_uc003vgk.2_Silent_p.P120P	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	403				LGPPVMLDAAT -> TWTPSDALMLQR (in Ref. 1; CAA71366).	multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						AACTTGGACCCCCAGTGATGC	0.353													26	128	---	---	---	---	capture	Silent	SNP	112112859	112112859	IFRD1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7478	65
GIMAP6	474344	broad.mit.edu	37	7	150324938	150324938	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150324938C>T	uc003whn.2	-	3	1172	c.748G>A	c.(748-750)GAA>AAA	p.E250K	GIMAP6_uc003whm.2_Missense_Mutation_p.E170K	NM_024711	NP_078987	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	250							GTP binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACTTGCCTTTCCTGTAGTTCT	0.493													78	203	---	---	---	---	capture	Missense_Mutation	SNP	150324938	150324938	GIMAP6	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6322	65
ABP1	26	broad.mit.edu	37	7	150558161	150558161	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150558161C>T	uc003why.1	+	6	6338	c.2120C>T	c.(2119-2121)TCC>TTC	p.S707F	ABP1_uc003whz.1_Missense_Mutation_p.S707F|ABP1_uc003wia.1_Missense_Mutation_p.S726F	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	707					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	GAGGACCCCTCCCTGGCATCC	0.622													37	69	---	---	---	---	capture	Missense_Mutation	SNP	150558161	150558161	ABP1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	98	65
ZMAT4	79698	broad.mit.edu	37	8	40554861	40554861	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:40554861G>T	uc003xnr.2	-	4	398	c.252C>A	c.(250-252)TTC>TTA	p.F84L	ZMAT4_uc003xns.2_Missense_Mutation_p.F84L	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a	84	Matrin-type 2.					nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CCGCTGAAGTGAATGACATGT	0.498													54	76	---	---	---	---	capture	Missense_Mutation	SNP	40554861	40554861	ZMAT4	8	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	17574	65
MCM4	4173	broad.mit.edu	37	8	48874694	48874694	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:48874694G>C	uc003xqk.1	+	4	412	c.317G>C	c.(316-318)GGT>GCT	p.G106A	PRKDC_uc003xqi.2_5'Flank|PRKDC_uc003xqj.2_5'Flank|PRKDC_uc011ldh.1_5'Flank|MCM4_uc003xql.1_Missense_Mutation_p.G106A|MCM4_uc011ldi.1_Missense_Mutation_p.G93A|MCM4_uc010lxw.1_Intron	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	106					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				CCAAGAAGTGGTGTTAGGGGC	0.527													3	67	---	---	---	---	capture	Missense_Mutation	SNP	48874694	48874694	MCM4	8	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	9302	65
VPS13B	157680	broad.mit.edu	37	8	100568723	100568723	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:100568723C>T	uc003yiv.2	+	31	4977	c.4866C>T	c.(4864-4866)ATC>ATT	p.I1622I	VPS13B_uc003yiw.2_Silent_p.I1597I	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1622					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GATCAGAAATCGAAGACAGAC	0.398													14	25	---	---	---	---	capture	Silent	SNP	100568723	100568723	VPS13B	8	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	17072	65
CSMD3	114788	broad.mit.edu	37	8	113702122	113702122	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113702122C>T	uc003ynu.2	-	14	2289	c.2130G>A	c.(2128-2130)TGG>TGA	p.W710*	CSMD3_uc003yns.2_5'UTR|CSMD3_uc003ynt.2_Nonsense_Mutation_p.W670*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.W606*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	710	Extracellular (Potential).|Sushi 3.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGTTTGCAGACCATTGGTTAT	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			33	39	---	---	---	---	capture	Nonsense_Mutation	SNP	113702122	113702122	CSMD3	8	C	T	T	T	1	0	0	0	0	0	1	0	0	234	18	5	2	3911	65
DENND4C	55667	broad.mit.edu	37	9	19360386	19360386	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19360386A>G	uc003znq.2	+	24	4483	c.4450A>G	c.(4450-4452)ATC>GTC	p.I1484V	DENND4C_uc011lnc.1_Missense_Mutation_p.I814V|DENND4C_uc011lnd.1_Missense_Mutation_p.I772V|DENND4C_uc003znr.2_Missense_Mutation_p.I772V|DENND4C_uc003zns.2_Missense_Mutation_p.I666V	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1484						integral to membrane				ovary(1)|skin(1)	2						TCAACATCCAATCATTTTCTG	0.388													5	87	---	---	---	---	capture	Missense_Mutation	SNP	19360386	19360386	DENND4C	9	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	4393	65
C9orf84	158401	broad.mit.edu	37	9	114462255	114462255	+	Silent	SNP	G	A	A			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114462255G>A	uc004bfr.2	-	22	3105	c.2970C>T	c.(2968-2970)AAC>AAT	p.N990N	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_Silent_p.N951N|C9orf84_uc010mug.2_Silent_p.N901N	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	990										ovary(2)	2						GTTCTTCAGAGTTTAGCCCAA	0.313													41	64	---	---	---	---	capture	Silent	SNP	114462255	114462255	C9orf84	9	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	2476	65
P2RY8	286530	broad.mit.edu	37	X	1584686	1584686	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1584686C>T	uc004cpz.2	-	2	1014	c.766G>A	c.(766-768)GTG>ATG	p.V256M		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	256	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCAGGAGCACGAAGTTGTTG	0.647			T	CRLF2	B-ALL|Downs associated ALL								25	27	---	---	---	---	capture	Missense_Mutation	SNP	1584686	1584686	P2RY8	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11259	65
FOXR2	139628	broad.mit.edu	37	X	55650462	55650462	+	Silent	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55650462C>T	uc004duo.2	+	1	630	c.318C>T	c.(316-318)AAC>AAT	p.N106N		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	106					embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						ATCTGACAAACATTTCTCCTT	0.542													42	0	---	---	---	---	capture	Silent	SNP	55650462	55650462	FOXR2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	5976	65
AGTR2	186	broad.mit.edu	37	X	115304521	115304521	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115304521C>T	uc004eqh.3	+	3	1195	c.988C>T	c.(988-990)CGC>TGC	p.R330C		NM_000686	NP_000677	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	330	Cytoplasmic (Potential).				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity			ovary(2)|lung(1)	3						ACAGAAGCTCCGCAGTGTGTT	0.463													86	29	---	---	---	---	capture	Missense_Mutation	SNP	115304521	115304521	AGTR2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	402	65
MAGEC3	139081	broad.mit.edu	37	X	140966989	140966989	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140966989G>C	uc011mwp.1	+	3	287	c.287G>C	c.(286-288)GGT>GCT	p.G96A		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	96										skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GGGTCCCCAGGTTTACAACTT	0.582													3	15	---	---	---	---	capture	Missense_Mutation	SNP	140966989	140966989	MAGEC3	23	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	9096	65
FLNA	2316	broad.mit.edu	37	X	153588445	153588445	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153588445C>T	uc004fkk.2	-	22	3967	c.3718G>A	c.(3718-3720)GTG>ATG	p.V1240M	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Missense_Mutation_p.V1240M	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1240	Filamin 10.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAGTTGGGCACGGGCTGGCCG	0.627													9	32	---	---	---	---	capture	Missense_Mutation	SNP	153588445	153588445	FLNA	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5877	65
PCDH11Y	83259	broad.mit.edu	37	Y	5605460	5605460	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:5605460G>T	uc004fqo.2	+	5	4234	c.3500G>T	c.(3499-3501)AGC>ATC	p.S1167I		NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	1167	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						CTATGCCACAGCCCACCACTG	0.552													27	11	---	---	---	---	capture	Missense_Mutation	SNP	5605460	5605460	PCDH11Y	24	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	11412	65
PTEN	5728	broad.mit.edu	37	10	89720847	89720847	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720847delC	uc001kfb.2	+	9	2029	c.998delC	c.(997-999)GCCfs	p.A333fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	333	C2 tensin-type.			KANKDKANR->AAGADAANA: Reduces growth suppression activity and promotes anchorage-independent growth. Reduces binding to phospholipid membranes in vitro; phosphatase activity towards PtdIns(3,4,5)P3 is not affected.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.W274_F341del(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAGACAAAGCCAACCGATAC	0.328		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			13	36	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89720847	89720847	PTEN	10	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	12633	65
OR10H1	26539	broad.mit.edu	37	19	15917903	15917903	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15917903delA	uc002nbq.2	-	1	1034	c.945delT	c.(943-945)AATfs	p.N315fs		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	315	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACATCATTACATTTTTTTCTG	0.363													40	139	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	15917903	15917903	OR10H1	19	A	-	-	-	1	0	1	0	1	0	0	0	0	102	8	5	5	10809	65
AARS2	57505	broad.mit.edu	37	6	44270876	44270876	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44270876delC	uc010jza.1	-	16	2185	c.2182delG	c.(2182-2184)GTGfs	p.V728fs	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	alanyl-tRNA synthetase 2, mitochondrial	728					alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			ovary(1)	1	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		L-Alanine(DB00160)	GCCACGGGCACCCCCACTGAT	0.602													9	61	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44270876	44270876	AARS2	6	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	20	65
RPL7	6129	broad.mit.edu	37	8	74205020	74205022	+	In_Frame_Del	DEL	CTT	-	-	rs151181576		TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:74205020_74205022delCTT	uc003xzg.2	-	2	47_49	c.25_27delAAG	c.(25-27)AAGdel	p.K9del	RPL7_uc003xzh.1_5'UTR|RDH10_uc003xzi.2_5'Flank	NM_000971	NP_000962	P18124	RL7_HUMAN	ribosomal protein L7	9	1.|4 X 12 AA tandem repeats.				endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	DNA binding|mRNA binding|protein homodimerization activity|structural constituent of ribosome				0	Breast(64;0.0954)		Epithelial(68;0.0193)|all cancers(69;0.0766)|BRCA - Breast invasive adenocarcinoma(89;0.134)			CAGGAACCTCCTTCTTCTTCTCT	0.414													13	66	---	---	---	---	capture_indel	In_Frame_Del	DEL	74205020	74205022	RPL7	8	CTT	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	13491	65
MUM1L1	139221	broad.mit.edu	37	X	105450617	105450617	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0743-01	TCGA-06-0743-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105450617delT	uc004emf.1	+	4	1841	c.1192delT	c.(1192-1194)TTTfs	p.F398fs	MUM1L1_uc004emg.1_Frame_Shift_Del_p.F398fs	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	398	PWWP.									ovary(2)|pancreas(1)|skin(1)	4						GATAGTCTGGTTTAAATATCA	0.358													10	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	105450617	105450617	MUM1L1	23	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	9896	65
