Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ARID4B	51742	broad.mit.edu	37	1	235345495	235345495	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235345495A>T	uc001hwq.2	-	20	3237	c.2739T>A	c.(2737-2739)GAT>GAA	p.D913E	ARID4B_uc001hwr.2_Missense_Mutation_p.D827E|ARID4B_uc001hws.3_Missense_Mutation_p.D827E|ARID4B_uc001hwp.2_RNA|ARID4B_uc001hwt.3_Missense_Mutation_p.D594E	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	913					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			GAAGTCTTTCATCAGAGTTAT	0.373													90	94	---	---	---	---	capture	Missense_Mutation	SNP	235345495	235345495	ARID4B	1	A	T	T	T	1	0	0	0	0	1	0	0	0	102	8	4	4	913	66
RIC8A	60626	broad.mit.edu	37	11	209578	209578	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:209578G>A	uc001log.2	+	3	629	c.304G>A	c.(304-306)GAG>AAG	p.E102K	BET1L_uc001loe.2_5'Flank|BET1L_uc001lod.2_5'Flank|RIC8A_uc001lof.2_Missense_Mutation_p.E102K|RIC8A_uc001loh.2_Missense_Mutation_p.E95K	NM_021932	NP_068751	Q9NPQ8	RIC8A_HUMAN	resistance to inhibitors of cholinesterase 8	102						cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity				0		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTCTGTCTCTGAGGGGTCCGT	0.617													39	49	---	---	---	---	capture	Missense_Mutation	SNP	209578	209578	RIC8A	11	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	13247	66
GALNTL4	374378	broad.mit.edu	37	11	11398782	11398782	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:11398782G>A	uc001mjo.2	-	5	1345	c.924C>T	c.(922-924)TAC>TAT	p.Y308Y		NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	308	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		GGGGATTTAGGTAGCGGCACC	0.532													39	64	---	---	---	---	capture	Silent	SNP	11398782	11398782	GALNTL4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	6163	66
C11orf41	25758	broad.mit.edu	37	11	33564672	33564672	+	Silent	SNP	A	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:33564672A>G	uc001mup.3	+	1	796	c.672A>G	c.(670-672)CCA>CCG	p.P224P	C11orf41_uc001mun.1_Silent_p.P224P	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	224						integral to membrane				ovary(2)	2						CTCCTGTGCCAGAAATGCCCA	0.537											OREG0020868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	148	---	---	---	---	capture	Silent	SNP	33564672	33564672	C11orf41	11	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	1626	66
OR4A47	403253	broad.mit.edu	37	11	48510526	48510526	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48510526T>C	uc010rhx.1	+	1	182	c.182T>C	c.(181-183)CTT>CCT	p.L61P		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TACTTCTTTCTTGCTGGCTTA	0.408													48	62	---	---	---	---	capture	Missense_Mutation	SNP	48510526	48510526	OR4A47	11	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	10946	66
OR5I1	10798	broad.mit.edu	37	11	55703856	55703856	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55703856G>C	uc010ris.1	-	1	21	c.21C>G	c.(19-21)AAC>AAG	p.N7K		NM_006637	NP_006628	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCAACGTGTAGTTTCTATCTG	0.323													19	11	---	---	---	---	capture	Missense_Mutation	SNP	55703856	55703856	OR5I1	11	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	11068	66
SLC22A8	9376	broad.mit.edu	37	11	62767306	62767306	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62767306C>T	uc001nwo.2	-	4	582	c.446G>A	c.(445-447)CGC>CAC	p.R149H	SLC22A8_uc001nwn.1_5'Flank|SLC22A8_uc001nwp.2_Missense_Mutation_p.R149H|SLC22A8_uc009yom.2_Missense_Mutation_p.R26H|SLC22A8_uc010rmm.1_Missense_Mutation_p.R58H|SLC22A8_uc009yon.2_Missense_Mutation_p.R149H	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8	149	Cytoplasmic (Potential).				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						GATGGGCCTGCGGCCAAACCT	0.627													14	15	---	---	---	---	capture	Missense_Mutation	SNP	62767306	62767306	SLC22A8	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14352	66
HTR3A	3359	broad.mit.edu	37	11	113860380	113860380	+	Silent	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113860380C>T	uc010rxb.1	+	8	1679	c.1446C>T	c.(1444-1446)CGC>CGT	p.R482R	HTR3A_uc010rxa.1_Silent_p.R450R|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.R429R	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	444	HA-stretch.|Cytoplasmic (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	ACTGGCTGCGCGTGGGCTCCG	0.612													25	50	---	---	---	---	capture	Silent	SNP	113860380	113860380	HTR3A	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7369	66
C2CD2L	9854	broad.mit.edu	37	11	118984640	118984640	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118984640G>A	uc001pvo.2	+	12	1924	c.1565G>A	c.(1564-1566)CGG>CAG	p.R522Q	C2CD2L_uc001pvn.2_Missense_Mutation_p.R523Q	NM_014807	NP_055622	O14523	C2C2L_HUMAN	transmembrane protein 24	522						integral to membrane					0						CCCAGTGGGCGGGTGGCCAAG	0.587													49	49	---	---	---	---	capture	Missense_Mutation	SNP	118984640	118984640	C2CD2L	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2133	66
OR6M1	390261	broad.mit.edu	37	11	123676407	123676407	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123676407G>A	uc010rzz.1	-	1	651	c.651C>T	c.(649-651)TAC>TAT	p.Y217Y		NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M,	217	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		TAGAAATTATGTACACGTAGG	0.493													23	36	---	---	---	---	capture	Silent	SNP	123676407	123676407	OR6M1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	11109	66
OR10G9	219870	broad.mit.edu	37	11	123894514	123894514	+	Silent	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123894514C>T	uc010sad.1	+	1	795	c.795C>T	c.(793-795)GAC>GAT	p.D265D		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GCTCCAGGGACGTCGTGGATG	0.517													98	136	---	---	---	---	capture	Silent	SNP	123894514	123894514	OR10G9	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10808	66
OR10G7	390265	broad.mit.edu	37	11	123908977	123908977	+	Silent	SNP	A	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123908977A>G	uc001pzq.1	-	1	732	c.732T>C	c.(730-732)TGT>TGC	p.C244C		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	244	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGACCACGATACAGTGGGAGG	0.567													3	147	---	---	---	---	capture	Silent	SNP	123908977	123908977	OR10G7	11	A	G	G	G	1	0	0	0	0	0	0	0	1	180	14	3	3	10806	66
TSPAN9	10867	broad.mit.edu	37	12	3388164	3388164	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:3388164A>G	uc001qlp.2	+	5	409	c.262A>G	c.(262-264)ATC>GTC	p.I88V		NM_006675	NP_006666	O75954	TSN9_HUMAN	tetraspanin 9	88	Helical; (Potential).					integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			CCAGTTTTTCATCGTCCTGTT	0.552													38	50	---	---	---	---	capture	Missense_Mutation	SNP	3388164	3388164	TSPAN9	12	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	16537	66
PSMB11	122706	broad.mit.edu	37	14	23511816	23511816	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23511816G>A	uc010ake.1	+	1	441	c.382G>A	c.(382-384)GCT>ACT	p.A128T		NM_001099780	NP_001093250	A5LHX3	PSB11_HUMAN	proteasome beta 11 subunit precursor	128					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		TGTGGCCAGTGCTGCCAAGCT	0.622													42	41	---	---	---	---	capture	Missense_Mutation	SNP	23511816	23511816	PSMB11	14	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	12571	66
ARHGAP5	394	broad.mit.edu	37	14	32561267	32561267	+	Silent	SNP	A	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:32561267A>G	uc001wrl.2	+	2	1631	c.1392A>G	c.(1390-1392)AAA>AAG	p.K464K	ARHGAP5_uc001wrm.2_Silent_p.K464K|ARHGAP5_uc001wrn.2_Silent_p.K464K|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	464	FF 3.				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AAGCCTACAAATATATCACTG	0.373													3	90	---	---	---	---	capture	Silent	SNP	32561267	32561267	ARHGAP5	14	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	879	66
ARHGAP5	394	broad.mit.edu	37	14	32561946	32561946	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:32561946A>T	uc001wrl.2	+	2	2310	c.2071A>T	c.(2071-2073)ATG>TTG	p.M691L	ARHGAP5_uc001wrm.2_Missense_Mutation_p.M691L|ARHGAP5_uc001wrn.2_Missense_Mutation_p.M691L|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	691					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGATAAATACATGGCTAATCT	0.358													3	88	---	---	---	---	capture	Missense_Mutation	SNP	32561946	32561946	ARHGAP5	14	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	879	66
LRFN5	145581	broad.mit.edu	37	14	42360832	42360832	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:42360832G>A	uc001wvm.2	+	4	2963	c.1765G>A	c.(1765-1767)GTG>ATG	p.V589M	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	589	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GCCCCAGTCCGTGTCCAAACA	0.463										HNSCC(30;0.082)			38	56	---	---	---	---	capture	Missense_Mutation	SNP	42360832	42360832	LRFN5	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8857	66
CDC42BPB	9578	broad.mit.edu	37	14	103440447	103440447	+	Missense_Mutation	SNP	G	A	A	rs149124468		TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:103440447G>A	uc001ymi.1	-	12	1779	c.1547C>T	c.(1546-1548)GCG>GTG	p.A516V		NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	516	Potential.				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TTGGCGAAGCGCCACTGTGTC	0.537													14	17	---	---	---	---	capture	Missense_Mutation	SNP	103440447	103440447	CDC42BPB	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3044	66
AHNAK2	113146	broad.mit.edu	37	14	105409046	105409046	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105409046G>A	uc010axc.1	-	7	12862	c.12742C>T	c.(12742-12744)CCC>TCC	p.P4248S	AHNAK2_uc001ypx.2_Missense_Mutation_p.P4148S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4248						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCGCCTTGGGGCCTTTCAGG	0.647													135	187	---	---	---	---	capture	Missense_Mutation	SNP	105409046	105409046	AHNAK2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	415	66
OR4N4	283694	broad.mit.edu	37	15	22383070	22383070	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:22383070G>A	uc001yuc.1	+	7	1579	c.598G>A	c.(598-600)GTC>ATC	p.V200I	LOC727924_uc001yub.1_Intron|OR4N4_uc010tzv.1_Missense_Mutation_p.V200I	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	200	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		GCTTCTAATGGTCTTCAACAG	0.522													51	109	---	---	---	---	capture	Missense_Mutation	SNP	22383070	22383070	OR4N4	15	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	10982	66
SYNM	23336	broad.mit.edu	37	15	99672043	99672043	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99672043C>A	uc002bup.2	+	6	3598	c.3478C>A	c.(3478-3480)CAG>AAG	p.Q1160K	SYNM_uc002buo.2_Intron|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	1160	Tail.|Interaction with TLN1 and VCL.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						TGACCTAAGTCAGGCAGCGAG	0.587													21	34	---	---	---	---	capture	Missense_Mutation	SNP	99672043	99672043	SYNM	15	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	15343	66
ERN2	10595	broad.mit.edu	37	16	23718180	23718180	+	Missense_Mutation	SNP	G	A	A	rs148177655	byFrequency	TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23718180G>A	uc002dma.3	-	6	695	c.526C>T	c.(526-528)CGG>TGG	p.R176W	ERN2_uc010bxp.2_Missense_Mutation_p.R176W|ERN2_uc010bxq.1_5'UTR	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	128	Lumenal (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TCCTGCTTCCGGCCTGTGGAG	0.592													27	36	---	---	---	---	capture	Missense_Mutation	SNP	23718180	23718180	ERN2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5193	66
TP53	7157	broad.mit.edu	37	17	7578394	7578394	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578394T>C	uc002gim.2	-	5	730	c.536A>G	c.(535-537)CAT>CGT	p.H179R	TP53_uc002gig.1_Missense_Mutation_p.H179R|TP53_uc002gih.2_Missense_Mutation_p.H179R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H47R|TP53_uc010cng.1_Missense_Mutation_p.H47R|TP53_uc002gii.1_Missense_Mutation_p.H47R|TP53_uc010cnh.1_Missense_Mutation_p.H179R|TP53_uc010cni.1_Missense_Mutation_p.H179R|TP53_uc002gij.2_Missense_Mutation_p.H179R|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.H86R|TP53_uc002gio.2_Missense_Mutation_p.H47R|TP53_uc010vug.1_Missense_Mutation_p.H140R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	179	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	H -> Q (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H179R(99)|p.H179Y(74)|p.H179L(31)|p.H179Q(17)|p.H179N(13)|p.H179D(10)|p.P177_C182delPHHERC(8)|p.0?(7)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.R175_E180delRCPHHE(3)|p.H179fs*68(2)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.K164_P219del(1)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.E171fs*1(1)|p.R174fs*3(1)|p.H178_H179>QY(1)|p.E171fs*61(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCAGCGCTCATGGTGGGGGCA	0.642		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			41	43	---	---	---	---	capture	Missense_Mutation	SNP	7578394	7578394	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	16264	66
LAMA1	284217	broad.mit.edu	37	18	7037694	7037694	+	Silent	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7037694C>T	uc002knm.2	-	12	1714	c.1620G>A	c.(1618-1620)CCG>CCA	p.P540P	LAMA1_uc010wzj.1_Silent_p.P16P	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	540	Laminin IV type A 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTTGCTGAGACGGGATCTTCC	0.507													42	41	---	---	---	---	capture	Silent	SNP	7037694	7037694	LAMA1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	8525	66
SIGLEC15	284266	broad.mit.edu	37	18	43418924	43418924	+	Silent	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43418924C>T	uc002lbl.1	+	4	887	c.738C>T	c.(736-738)TCC>TCT	p.S246S	SIGLEC15_uc010xcp.1_RNA	NM_213602	NP_998767	Q6ZMC9	SIG15_HUMAN	sialic acid binding Ig-like lectin 15 precursor	246	Extracellular (Potential).|Ig-like C2-type.					integral to membrane					0						TGGGCCGCTCCGAGGCCAGCG	0.711													3	8	---	---	---	---	capture	Silent	SNP	43418924	43418924	SIGLEC15	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14203	66
SERPINB4	6318	broad.mit.edu	37	18	61307011	61307011	+	Splice_Site	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61307011C>T	uc002ljf.2	-	6	556	c.470_splice	c.e6-1	p.E157_splice	SERPINB4_uc002lje.2_Splice_Site_p.E157_splice|SERPINB4_uc002ljg.2_Intron	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade						immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						TTAATTTTTTCTGCAAGGGAA	0.373													39	58	---	---	---	---	capture	Splice_Site	SNP	61307011	61307011	SERPINB4	18	C	T	T	T	1	0	0	0	0	0	0	1	0	416	32	5	2	13996	66
ZNF493	284443	broad.mit.edu	37	19	21606942	21606942	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:21606942G>A	uc002npx.2	+	2	1377	c.1097G>A	c.(1096-1098)TGT>TAT	p.C366Y	ZNF493_uc002npw.2_Missense_Mutation_p.C494Y|ZNF493_uc002npy.2_Missense_Mutation_p.C366Y	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	366	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGTGAAGAATGTGGCAAAGCT	0.328													24	54	---	---	---	---	capture	Missense_Mutation	SNP	21606942	21606942	ZNF493	19	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	17823	66
ZNF99	7652	broad.mit.edu	37	19	22941129	22941129	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22941129T>G	uc010xrh.1	-	5	1309	c.1309A>C	c.(1309-1311)AAG>CAG	p.K437Q		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGAATTATCTTATGTTTTCTA	0.333													3	83	---	---	---	---	capture	Missense_Mutation	SNP	22941129	22941129	ZNF99	19	T	G	G	G	1	0	0	0	0	1	0	0	0	793	61	4	4	18080	66
ZNF99	7652	broad.mit.edu	37	19	22941154	22941154	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22941154C>G	uc010xrh.1	-	5	1284	c.1284G>C	c.(1282-1284)AAG>AAC	p.K428N		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CTGAGAAATGCTTAAAAGCTT	0.353													3	93	---	---	---	---	capture	Missense_Mutation	SNP	22941154	22941154	ZNF99	19	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	18080	66
CCDC8	83987	broad.mit.edu	37	19	46914965	46914965	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46914965C>T	uc002pep.2	-	1	1955	c.1103G>A	c.(1102-1104)AGG>AAG	p.R368K		NM_032040	NP_114429	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	368						plasma membrane				ovary(3)	3				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GGCCTCTGCCCTCTGATTATC	0.612													57	214	---	---	---	---	capture	Missense_Mutation	SNP	46914965	46914965	CCDC8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	2827	66
ZNF534	147658	broad.mit.edu	37	19	52942423	52942423	+	Missense_Mutation	SNP	T	A	A	rs112113280		TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52942423T>A	uc002pzk.2	+	4	1810	c.1749T>A	c.(1747-1749)AAT>AAA	p.N583K	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.N570K	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	583	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GACATAGGAATATTCATACTG	0.438													3	23	---	---	---	---	capture	Missense_Mutation	SNP	52942423	52942423	ZNF534	19	T	A	A	A	1	0	0	0	0	1	0	0	0	634	49	4	4	17852	66
A1BG	1	broad.mit.edu	37	19	58863692	58863692	+	Silent	SNP	G	A	A	rs138577019		TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58863692G>A	uc002qsd.3	-	4	632	c.570C>T	c.(568-570)GGC>GGT	p.G190G	NCRNA00181_uc002qse.2_Intron|A1BG_uc002qsf.1_RNA|NCRNA00181_uc002qsg.2_RNA	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor	190	Ig-like V-type 2.					extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CAGAGAGGGCGCCTTCCCCAT	0.622													58	119	---	---	---	---	capture	Silent	SNP	58863692	58863692	A1BG	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1	66
ZNF638	27332	broad.mit.edu	37	2	71651040	71651040	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71651040G>A	uc002shx.2	+	22	4715	c.4396G>A	c.(4396-4398)GGA>AGA	p.G1466R	ZNF638_uc010yqw.1_Missense_Mutation_p.G1045R|ZNF638_uc002shy.2_Missense_Mutation_p.G1466R|ZNF638_uc002shz.2_Missense_Mutation_p.G1466R|ZNF638_uc002sia.2_Missense_Mutation_p.G1466R|ZNF638_uc002sib.1_Intron|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Missense_Mutation_p.G563R|ZNF638_uc002sid.2_Intron	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	1466					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						TCTTACCAGAGGAGGCAGTGG	0.463													24	24	---	---	---	---	capture	Missense_Mutation	SNP	71651040	71651040	ZNF638	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	17933	66
C2orf78	388960	broad.mit.edu	37	2	74042973	74042973	+	Silent	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74042973C>T	uc002sjr.1	+	3	1744	c.1623C>T	c.(1621-1623)AGC>AGT	p.S541S		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	541										ovary(2)	2						TCAGTAACAGCGCTTCTGTGA	0.502													23	22	---	---	---	---	capture	Silent	SNP	74042973	74042973	C2orf78	2	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	2175	66
C2orf89	129293	broad.mit.edu	37	2	85051153	85051153	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85051153G>A	uc010ysl.1	-	6	1347	c.1258C>T	c.(1258-1260)CGG>TGG	p.R420W	C2orf89_uc002sou.3_Missense_Mutation_p.R371W	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN	hypothetical protein LOC129293 precursor	420	Extracellular (Potential).					integral to membrane				ovary(1)	1						CGCTTCTTCCGGAACCTCTGT	0.667													6	9	---	---	---	---	capture	Missense_Mutation	SNP	85051153	85051153	C2orf89	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	2183	66
RGPD4	285190	broad.mit.edu	37	2	108489249	108489249	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108489249G>A	uc010ywk.1	+	20	4871	c.4789G>A	c.(4789-4791)GTG>ATG	p.V1597M	RGPD4_uc002tdu.2_Missense_Mutation_p.V784M|RGPD4_uc010ywl.1_RNA	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1597					intracellular transport		binding			skin(2)	2						TGAAAGCAAAGTGGAACCTAA	0.378													19	265	---	---	---	---	capture	Missense_Mutation	SNP	108489249	108489249	RGPD4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	13181	66
TTN	7273	broad.mit.edu	37	2	179412923	179412923	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179412923G>A	uc010zfg.1	-	288	85950	c.85726C>T	c.(85726-85728)CGG>TGG	p.R28576W	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R22271W|TTN_uc010zfi.1_Missense_Mutation_p.R22204W|TTN_uc010zfj.1_Missense_Mutation_p.R22079W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29503							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGTGATCCGGCTGCCTCCA	0.493													84	103	---	---	---	---	capture	Missense_Mutation	SNP	179412923	179412923	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16617	66
SPEG	10290	broad.mit.edu	37	2	220309407	220309407	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220309407G>A	uc010fwg.2	+	2	421	c.421G>A	c.(421-423)GTG>ATG	p.V141M	SPEG_uc002vlm.2_RNA|SPEG_uc010fwh.1_Translation_Start_Site|SPEG_uc002vln.1_Translation_Start_Site	NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	141					muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CATCAGCGATGTGCAGGGAAC	0.622													31	40	---	---	---	---	capture	Missense_Mutation	SNP	220309407	220309407	SPEG	2	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14928	66
DOCK10	55619	broad.mit.edu	37	2	225706579	225706579	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:225706579T>C	uc010fwz.1	-	23	2842	c.2603A>G	c.(2602-2604)CAA>CGA	p.Q868R	DOCK10_uc002vob.2_Missense_Mutation_p.Q862R	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	868	DHR-1.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CTCTCTTTTTTGGCACTCTTG	0.383													74	102	---	---	---	---	capture	Missense_Mutation	SNP	225706579	225706579	DOCK10	2	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	4641	66
DGKD	8527	broad.mit.edu	37	2	234368926	234368926	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234368926G>A	uc002vui.1	+	24	2928	c.2916G>A	c.(2914-2916)ATG>ATA	p.M972I	DGKD_uc002vuj.1_Missense_Mutation_p.M928I|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	972					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	ACCCGGAGATGCTGTCCGAGG	0.617													41	57	---	---	---	---	capture	Missense_Mutation	SNP	234368926	234368926	DGKD	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4425	66
MSL3L2	151507	broad.mit.edu	37	2	234775617	234775617	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234775617G>A	uc010znf.1	-	2	463	c.225C>T	c.(223-225)AAC>AAT	p.N75N		NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						TATAAGGCACGTTCATGCTGG	0.438													41	51	---	---	---	---	capture	Silent	SNP	234775617	234775617	MSL3L2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9790	66
VPS16	64601	broad.mit.edu	37	20	2846921	2846921	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2846921G>A	uc002whe.2	+	23	2383	c.2335G>A	c.(2335-2337)GTG>ATG	p.V779M	VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|VPS16_uc002whf.2_Missense_Mutation_p.V635M|VPS16_uc002whd.2_RNA|VPS16_uc002whg.2_Missense_Mutation_p.V465M|VPS16_uc002whi.2_Missense_Mutation_p.V263M	NM_022575	NP_072097	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 isoform 1	779					intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome				ovary(2)|pancreas(1)|skin(1)	4						TGCTTCCCGCGTGGGTCCCGA	0.552													3	77	---	---	---	---	capture	Missense_Mutation	SNP	2846921	2846921	VPS16	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17075	66
RALGAPA2	57186	broad.mit.edu	37	20	20475882	20475882	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:20475882C>A	uc002wrz.2	-	36	5389	c.5246G>T	c.(5245-5247)TGG>TTG	p.W1749L	RALGAPA2_uc010gcx.2_Missense_Mutation_p.W1453L|RALGAPA2_uc010zsg.1_Missense_Mutation_p.W1197L|RALGAPA2_uc002wsa.1_Missense_Mutation_p.W521L	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1749	Rap-GAP.				activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						GTGTTCAGACCAGACGATATG	0.438													4	138	---	---	---	---	capture	Missense_Mutation	SNP	20475882	20475882	RALGAPA2	20	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	12909	66
CHRNA4	1137	broad.mit.edu	37	20	61978100	61978100	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61978100C>T	uc002yes.2	-	6	2052	c.1874G>A	c.(1873-1875)GGC>GAC	p.G625D	CHRNA4_uc002yet.1_Missense_Mutation_p.G449D|CHRNA4_uc011aaw.1_RNA|CHRNA4_uc010gke.1_Missense_Mutation_p.G554D|CHRNA4_uc002yev.1_Missense_Mutation_p.G449D|CHRNA4_uc010gkf.1_Missense_Mutation_p.G449D	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit	625					B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)	CTAGATCATGCCAGCCAGCCA	0.677													10	14	---	---	---	---	capture	Missense_Mutation	SNP	61978100	61978100	CHRNA4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3350	66
RFPL2	10739	broad.mit.edu	37	22	32589175	32589175	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32589175G>A	uc003amg.3	-	4	1206	c.270C>T	c.(268-270)GAC>GAT	p.D90D	RFPL2_uc003ame.3_Silent_p.D29D|RFPL2_uc003amf.3_5'UTR|RFPL2_uc003amh.3_5'UTR	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2	90							zinc ion binding			skin(1)	1						GTGCAGCCATGTCCACTGCCA	0.478													39	11	---	---	---	---	capture	Silent	SNP	32589175	32589175	RFPL2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	13149	66
IQCF3	401067	broad.mit.edu	37	3	51863721	51863721	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51863721G>A	uc010hlx.1	+	4	400	c.59G>A	c.(58-60)CGG>CAG	p.R20Q	IQCF1_uc003dbq.3_Intron|IQCF3_uc010hlw.1_RNA|IQCF3_uc011bdw.1_RNA	NM_001085479	NP_001078948	P0C7M6	IQCF3_HUMAN	IQ motif containing F3	20										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGACAGAGGCGGCAGAAGGTA	0.522													14	15	---	---	---	---	capture	Missense_Mutation	SNP	51863721	51863721	IQCF3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7732	66
POU1F1	5449	broad.mit.edu	37	3	87325559	87325559	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:87325559G>A	uc003dqq.1	-	1	179	c.54C>T	c.(52-54)GAC>GAT	p.D18D	POU1F1_uc010hoj.1_Silent_p.D18D	NM_000306	NP_000297	P28069	PIT1_HUMAN	pituitary specific transcription factor 1	18					negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)|skin(1)	2	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		TTGCAGAGGCGTCAGAATTCA	0.478													42	34	---	---	---	---	capture	Silent	SNP	87325559	87325559	POU1F1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12170	66
UROC1	131669	broad.mit.edu	37	3	126219669	126219669	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126219669G>C	uc003eiz.1	-	11	1046	c.1014C>G	c.(1012-1014)GAC>GAG	p.D338E	UROC1_uc010hsi.1_Missense_Mutation_p.D398E	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1	338					histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		CTGACCCCAGGTCCACCAAGC	0.632													35	58	---	---	---	---	capture	Missense_Mutation	SNP	126219669	126219669	UROC1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	16910	66
ATR	545	broad.mit.edu	37	3	142280158	142280158	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142280158C>T	uc003eux.3	-	5	1398	c.1276G>A	c.(1276-1278)GGA>AGA	p.G426R		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	426					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						GGTGATATTCCATCACTATTA	0.418								Other_conserved_DNA_damage_response_genes					43	75	---	---	---	---	capture	Missense_Mutation	SNP	142280158	142280158	ATR	3	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	1195	66
MAP3K13	9175	broad.mit.edu	37	3	185165672	185165672	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:185165672C>A	uc010hyf.2	+	6	1213	c.947C>A	c.(946-948)ACG>AAG	p.T316K	MAP3K13_uc011brt.1_Missense_Mutation_p.T109K|MAP3K13_uc003fph.3_Missense_Mutation_p.T84K|MAP3K13_uc011bru.1_Missense_Mutation_p.T172K|MAP3K13_uc003fpi.2_Missense_Mutation_p.T316K|MAP3K13_uc010hyg.2_Missense_Mutation_p.T6K	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	316	Protein kinase.				activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TTTGCTGGCACGGTCGCATGG	0.443													3	62	---	---	---	---	capture	Missense_Mutation	SNP	185165672	185165672	MAP3K13	3	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	9161	66
KNG1	3827	broad.mit.edu	37	3	186457116	186457116	+	Splice_Site	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186457116G>A	uc011bsa.1	+	9	1251	c.1039_splice	c.e9-1	p.Q347_splice	KNG1_uc003fqr.2_Splice_Site_p.Q347_splice	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1						blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	TTCATGGATAGCAAAGCCTAG	0.373													23	32	---	---	---	---	capture	Splice_Site	SNP	186457116	186457116	KNG1	3	G	A	A	A	1	0	0	0	0	0	0	1	0	442	34	5	2	8347	66
TP63	8626	broad.mit.edu	37	3	189582120	189582120	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189582120G>A	uc003fry.2	+	5	768	c.679G>A	c.(679-681)GCC>ACC	p.A227T	TP63_uc003frx.2_Missense_Mutation_p.A227T|TP63_uc003frz.2_Missense_Mutation_p.A227T|TP63_uc010hzc.1_Missense_Mutation_p.A227T|TP63_uc003fsa.2_Missense_Mutation_p.A133T|TP63_uc003fsb.2_Missense_Mutation_p.A133T|TP63_uc003fsc.2_Missense_Mutation_p.A133T|TP63_uc003fsd.2_Missense_Mutation_p.A133T|TP63_uc010hzd.1_Missense_Mutation_p.A48T|TP63_uc003fse.1_Missense_Mutation_p.A108T	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	227					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TGTTATCCGCGCCATGCCTGT	0.517									Hay-Wells_syndrome	HNSCC(45;0.13)			4	158	---	---	---	---	capture	Missense_Mutation	SNP	189582120	189582120	TP63	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16275	66
JAKMIP1	152789	broad.mit.edu	37	4	6107274	6107274	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:6107274G>A	uc003giu.3	-	3	826	c.550C>T	c.(550-552)CGT>TGT	p.R184C	JAKMIP1_uc010idb.1_Missense_Mutation_p.R184C|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Missense_Mutation_p.R184C|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Missense_Mutation_p.R184C|JAKMIP1_uc010ide.2_Missense_Mutation_p.R184C	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	184	Potential.|Mediates association with microtubules.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						TAGGCGGCACGCAGGTCGGCT	0.682													3	18	---	---	---	---	capture	Missense_Mutation	SNP	6107274	6107274	JAKMIP1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7863	66
CENPE	1062	broad.mit.edu	37	4	104079809	104079809	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104079809C>T	uc003hxb.1	-	23	2926	c.2836G>A	c.(2836-2838)GAC>AAC	p.D946N	CENPE_uc003hxc.1_Missense_Mutation_p.D921N	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	946	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTGAGTTGGTCCCTCTCAATT	0.333													24	34	---	---	---	---	capture	Missense_Mutation	SNP	104079809	104079809	CENPE	4	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	3198	66
EXOSC9	5393	broad.mit.edu	37	4	122735086	122735086	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:122735086G>C	uc003iea.2	+	10	1148	c.1040G>C	c.(1039-1041)TGG>TCG	p.W347S	EXOSC9_uc003idz.2_Missense_Mutation_p.W347S|EXOSC9_uc003ieb.2_Missense_Mutation_p.W331S|EXOSC9_uc010inp.1_RNA	NM_005033	NP_005024	Q06265	EXOS9_HUMAN	exosome component 9 isoform 2	347					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|immune response|nuclear mRNA surveillance|nuclear polyadenylation-dependent rRNA catabolic process|positive regulation of cell growth|rRNA processing	cytosol|nuclear exosome (RNase complex)|nucleolus|nucleolus|nucleus	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0						GAAAACTCCTGGGGTGATCTT	0.413													41	50	---	---	---	---	capture	Missense_Mutation	SNP	122735086	122735086	EXOSC9	4	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	5276	66
GYPA	2993	broad.mit.edu	37	4	145038021	145038021	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:145038021G>A	uc003ijo.3	-	5	459	c.343C>T	c.(343-345)CGC>TGC	p.R115C	GYPA_uc003ijn.2_Intron|GYPA_uc011cia.1_RNA|GYPA_uc011cib.1_Missense_Mutation_p.R82C|GYPA_uc003ijp.3_Missense_Mutation_p.R83C|GYPA_uc010ioq.2_Missense_Mutation_p.R102C|GYPA_uc010ior.2_Missense_Mutation_p.R50C|GYPA_uc010ios.1_RNA	NM_002099	NP_002090	P02724	GLPA_HUMAN	glycophorin A precursor	115	Cytoplasmic.				interspecies interaction between organisms	membrane fraction	receptor activity			central_nervous_system(2)	2	all_hematologic(180;0.15)					ATCAGTCGGCGAATACCGTAA	0.368													39	70	---	---	---	---	capture	Missense_Mutation	SNP	145038021	145038021	GYPA	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6837	66
ADAM29	11086	broad.mit.edu	37	4	175897195	175897195	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175897195C>A	uc003iuc.2	+	5	1189	c.519C>A	c.(517-519)TGC>TGA	p.C173*	ADAM29_uc003iud.2_Nonsense_Mutation_p.C173*|ADAM29_uc010irr.2_Nonsense_Mutation_p.C173*|ADAM29_uc011cki.1_Nonsense_Mutation_p.C173*	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	173					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AAATAACATGCCGAATGGAAT	0.368													45	61	---	---	---	---	capture	Nonsense_Mutation	SNP	175897195	175897195	ADAM29	4	C	A	A	A	1	0	0	0	0	0	1	0	0	337	26	5	4	247	66
CCDC110	256309	broad.mit.edu	37	4	186381243	186381243	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186381243G>A	uc003ixu.3	-	6	574	c.498C>T	c.(496-498)TCC>TCT	p.S166S	CCDC110_uc003ixv.3_Silent_p.S129S|CCDC110_uc011ckt.1_Silent_p.S166S	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	166						nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		ATGTGTCCTCGGAATGTATCT	0.348													32	62	---	---	---	---	capture	Silent	SNP	186381243	186381243	CCDC110	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2721	66
ADCY2	108	broad.mit.edu	37	5	7743842	7743842	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:7743842G>A	uc003jdz.1	+	15	2000	c.1933G>A	c.(1933-1935)GTC>ATC	p.V645I	ADCY2_uc011cmo.1_Missense_Mutation_p.V465I	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	645	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CATCCTCTTCGTCTGCTTTGC	0.478													5	250	---	---	---	---	capture	Missense_Mutation	SNP	7743842	7743842	ADCY2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	294	66
PDZD2	23037	broad.mit.edu	37	5	31995769	31995769	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:31995769C>T	uc003jhl.2	+	4	1454	c.1066C>T	c.(1066-1068)CGC>TGC	p.R356C	PDZD2_uc003jhm.2_Missense_Mutation_p.R356C|PDZD2_uc011cnx.1_Missense_Mutation_p.R182C	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	356	PDZ 2.				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						AGGATCAAAGCGCTCACCTCA	0.423													3	57	---	---	---	---	capture	Missense_Mutation	SNP	31995769	31995769	PDZD2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11604	66
ADAMTS12	81792	broad.mit.edu	37	5	33576992	33576992	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33576992C>T	uc003jia.1	-	19	3302	c.3139G>A	c.(3139-3141)GCA>ACA	p.A1047T	ADAMTS12_uc010iuq.1_Missense_Mutation_p.A962T	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1047	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CTGCTGATTGCTGGAGTGCTT	0.552										HNSCC(64;0.19)			53	65	---	---	---	---	capture	Missense_Mutation	SNP	33576992	33576992	ADAMTS12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	257	66
ADAMTS12	81792	broad.mit.edu	37	5	33684033	33684033	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33684033G>A	uc003jia.1	-	4	925	c.762C>T	c.(760-762)GCC>GCT	p.A254A	ADAMTS12_uc010iuq.1_Silent_p.A254A	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	254	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCTTTGTGTCGGCCACCACCA	0.547										HNSCC(64;0.19)			49	67	---	---	---	---	capture	Silent	SNP	33684033	33684033	ADAMTS12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	257	66
OSMR	9180	broad.mit.edu	37	5	38924670	38924670	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:38924670C>T	uc003jln.1	+	14	2384	c.2017C>T	c.(2017-2019)CCA>TCA	p.P673S	OSMR_uc011cpj.1_5'UTR	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor	673	Fibronectin type-III 4.|Extracellular (Potential).				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					GCAGTGCCACCCACGATTTGA	0.358													46	103	---	---	---	---	capture	Missense_Mutation	SNP	38924670	38924670	OSMR	5	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	11196	66
CMYA5	202333	broad.mit.edu	37	5	79035031	79035031	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79035031G>A	uc003kgc.2	+	2	10515	c.10443G>A	c.(10441-10443)TTG>TTA	p.L3481L		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3481						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAAAAGAGTTGGGCAGCGAGA	0.403													15	12	---	---	---	---	capture	Silent	SNP	79035031	79035031	CMYA5	5	G	A	A	A	1	0	0	0	0	0	0	0	1	607	47	2	2	3555	66
CTNNA1	1495	broad.mit.edu	37	5	138253458	138253458	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:138253458G>A	uc003ldh.2	+	11	1512	c.1417G>A	c.(1417-1419)GCA>ACA	p.A473T	CTNNA1_uc011cyx.1_Missense_Mutation_p.A370T|CTNNA1_uc011cyy.1_Missense_Mutation_p.A350T|CTNNA1_uc003ldi.2_Missense_Mutation_p.A171T|CTNNA1_uc003ldj.2_Missense_Mutation_p.A473T|CTNNA1_uc003ldl.2_Missense_Mutation_p.A103T	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	473				A -> P (in Ref. 3; AAA86430/AAA18949).	adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GGCTTTAGCAGCAAAACCACA	0.388													4	165	---	---	---	---	capture	Missense_Mutation	SNP	138253458	138253458	CTNNA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	3975	66
PCDHA8	56140	broad.mit.edu	37	5	140222780	140222780	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140222780G>T	uc003lhs.2	+	1	1874	c.1874G>T	c.(1873-1875)GGG>GTG	p.G625V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.G625V	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	625	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCGCGTGGGGCTGTACACG	0.652													61	49	---	---	---	---	capture	Missense_Mutation	SNP	140222780	140222780	PCDHA8	5	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	11433	66
PCDHB7	56129	broad.mit.edu	37	5	140554382	140554382	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140554382G>A	uc003lit.2	+	1	2140	c.1966G>A	c.(1966-1968)GCC>ACC	p.A656T		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	656	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGGCCACCGCCACGCTGCA	0.706													37	87	---	---	---	---	capture	Missense_Mutation	SNP	140554382	140554382	PCDHB7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11450	66
NMUR2	56923	broad.mit.edu	37	5	151771915	151771915	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151771915C>T	uc003luv.2	-	4	1251	c.1085G>A	c.(1084-1086)CGG>CAG	p.R362Q		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	362	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			GAAGATGTTCCGCTGGGCAGG	0.532													70	25	---	---	---	---	capture	Missense_Mutation	SNP	151771915	151771915	NMUR2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10414	66
TRIM40	135644	broad.mit.edu	37	6	30114887	30114887	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30114887G>A	uc003npk.2	+	4	953	c.567G>A	c.(565-567)GCG>GCA	p.A189A	TRIM40_uc003npm.2_Silent_p.A160A	NM_138700	NP_619645	Q6P9F5	TRI40_HUMAN	tripartite motif-containing 40	189						intracellular	zinc ion binding			ovary(1)	1						CAGCAGAAGCGGCCAGAATCC	0.597													25	28	---	---	---	---	capture	Silent	SNP	30114887	30114887	TRIM40	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16398	66
TRIM10	10107	broad.mit.edu	37	6	30127012	30127012	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30127012T>C	uc003npo.3	-	2	516	c.440A>G	c.(439-441)CAT>CGT	p.H147R	TRIM10_uc003npn.2_Missense_Mutation_p.H147R	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	147						cytoplasm	zinc ion binding				0						AAGACACTTATGGATTTGTTC	0.403													27	32	---	---	---	---	capture	Missense_Mutation	SNP	30127012	30127012	TRIM10	6	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	16369	66
GPR115	221393	broad.mit.edu	37	6	47681719	47681719	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47681719C>A	uc003oza.1	+	6	996	c.738C>A	c.(736-738)CAC>CAA	p.H246Q	GPR115_uc003oyz.1_Missense_Mutation_p.H303Q|GPR115_uc003ozb.1_Missense_Mutation_p.H244Q	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	246	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						AAGGGTTTCACATCAACCATA	0.393													53	55	---	---	---	---	capture	Missense_Mutation	SNP	47681719	47681719	GPR115	6	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	6566	66
DOPEY1	23033	broad.mit.edu	37	6	83830474	83830474	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:83830474C>T	uc003pjs.1	+	10	1323	c.1063C>T	c.(1063-1065)CGC>TGC	p.R355C	DOPEY1_uc011dyy.1_Missense_Mutation_p.R346C|DOPEY1_uc010kbl.1_Missense_Mutation_p.R346C	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	355					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AAAGCCTTTTCGCATTTTAAT	0.368													13	24	---	---	---	---	capture	Missense_Mutation	SNP	83830474	83830474	DOPEY1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4663	66
AIM1	202	broad.mit.edu	37	6	106978130	106978130	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:106978130A>C	uc003prh.2	+	6	3921	c.3434A>C	c.(3433-3435)GAA>GCA	p.E1145A		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1145	Beta/gamma crystallin 'Greek key' 3.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GATGATACTGAAGAAATGCAG	0.328													3	151	---	---	---	---	capture	Missense_Mutation	SNP	106978130	106978130	AIM1	6	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	430	66
ELMO1	9844	broad.mit.edu	37	7	37253052	37253052	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37253052C>T	uc003tfk.1	-	12	1149	c.842G>A	c.(841-843)CGA>CAA	p.R281Q	ELMO1_uc011kbc.1_Missense_Mutation_p.R185Q|ELMO1_uc010kxg.1_Missense_Mutation_p.R281Q	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	281					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						CCGCTGGGCTCGGATGACATG	0.433													62	30	---	---	---	---	capture	Missense_Mutation	SNP	37253052	37253052	ELMO1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5020	66
ELMO1	9844	broad.mit.edu	37	7	37298915	37298915	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37298915G>A	uc003tfk.1	-	6	591	c.284C>T	c.(283-285)TCG>TTG	p.S95L	ELMO1_uc011kbc.1_5'UTR|ELMO1_uc010kxg.1_Missense_Mutation_p.S95L	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	95					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						ATCCATACTCGAGGACTGGAT	0.522													25	60	---	---	---	---	capture	Missense_Mutation	SNP	37298915	37298915	ELMO1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5020	66
WBSCR17	64409	broad.mit.edu	37	7	70881029	70881029	+	Silent	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:70881029C>T	uc003tvy.2	+	4	744	c.744C>T	c.(742-744)CAC>CAT	p.H248H	WBSCR17_uc003tvz.2_Translation_Start_Site	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	248	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TTGATGCCCACGTGGAATTCA	0.567													20	73	---	---	---	---	capture	Silent	SNP	70881029	70881029	WBSCR17	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17145	66
NSUN5	55695	broad.mit.edu	37	7	72721634	72721634	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72721634G>A	uc003txw.2	-	3	373	c.337C>T	c.(337-339)CGG>TGG	p.R113W	FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Missense_Mutation_p.R113W|NSUN5_uc003txx.2_Missense_Mutation_p.R75W|NSUN5_uc011kev.1_Missense_Mutation_p.R113W	NM_018044	NP_060514	Q96P11	NSUN5_HUMAN	NOL1/NOP2/Sun domain family, member 5 isoform 2	113							methyltransferase activity				0		Lung NSC(55;0.163)				CTCACACCCCGATGAACCTTG	0.637													18	56	---	---	---	---	capture	Missense_Mutation	SNP	72721634	72721634	NSUN5	7	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	10588	66
SAMD9	54809	broad.mit.edu	37	7	92734204	92734204	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92734204C>A	uc003umf.2	-	3	1463	c.1207G>T	c.(1207-1209)GAT>TAT	p.D403Y	SAMD9_uc003umg.2_Missense_Mutation_p.D403Y	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	403						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TCTAACAAATCTTGATTTCCT	0.323													18	64	---	---	---	---	capture	Missense_Mutation	SNP	92734204	92734204	SAMD9	7	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	13718	66
PON1	5444	broad.mit.edu	37	7	94931534	94931534	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94931534T>A	uc003uns.2	-	8	989	c.892A>T	c.(892-894)AAT>TAT	p.N298Y	PON1_uc011kih.1_Missense_Mutation_p.N298Y	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	298					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	GCAGGAGGATTCTCTGAGTCA	0.398													29	71	---	---	---	---	capture	Missense_Mutation	SNP	94931534	94931534	PON1	7	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	12150	66
MUC17	140453	broad.mit.edu	37	7	100675948	100675948	+	Silent	SNP	T	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100675948T>C	uc003uxp.1	+	3	1304	c.1251T>C	c.(1249-1251)CCT>CCC	p.P417P	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	417	Extracellular (Potential).|59 X approximate tandem repeats.|4.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACAATTCCTGTTGACTCCA	0.458													127	327	---	---	---	---	capture	Silent	SNP	100675948	100675948	MUC17	7	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	9884	66
ARHGEF35	445328	broad.mit.edu	37	7	143884194	143884194	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143884194A>T	uc003wdz.1	-	2	1401	c.1283T>A	c.(1282-1284)CTC>CAC	p.L428H		NM_001003702	NP_001003702	A5YM69	ARG35_HUMAN	Rho guanine nucleotide exchange factor (GEF)	428											0						CTGAGTCACGAGATATGAGGC	0.572													21	57	---	---	---	---	capture	Missense_Mutation	SNP	143884194	143884194	ARHGEF35	7	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	898	66
GALNT11	63917	broad.mit.edu	37	7	151805176	151805176	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151805176C>G	uc010lqg.1	+	6	996	c.766C>G	c.(766-768)CAG>GAG	p.Q256E	GALNT11_uc011kvm.1_Missense_Mutation_p.Q175E|GALNT11_uc003wku.2_Missense_Mutation_p.Q256E|GALNT11_uc011kvn.1_RNA|GALNT11_uc003wkw.1_Missense_Mutation_p.Q4E	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	N-acetylgalactosaminyltransferase 11	256	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		GATGTGGCTGCAGCCCTTGCT	0.582													5	35	---	---	---	---	capture	Missense_Mutation	SNP	151805176	151805176	GALNT11	7	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	6149	66
DOCK5	80005	broad.mit.edu	37	8	25167952	25167952	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25167952G>A	uc003xeg.2	+	13	1359	c.1222G>A	c.(1222-1224)GGT>AGT	p.G408S	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.G122S|DOCK5_uc003xei.2_5'UTR	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	408						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GCTCTTGCCCGGTGACCTCAC	0.408													26	47	---	---	---	---	capture	Missense_Mutation	SNP	25167952	25167952	DOCK5	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4646	66
RAB11FIP1	80223	broad.mit.edu	37	8	37730005	37730005	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:37730005G>A	uc003xkm.1	-	4	2359	c.2315C>T	c.(2314-2316)GCG>GTG	p.A772V	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Missense_Mutation_p.A101V|RAB11FIP1_uc003xko.1_Missense_Mutation_p.A101V|RAB11FIP1_uc003xkp.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	772					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			AAGAGGGGGCGCCACTTCTTC	0.567													71	78	---	---	---	---	capture	Missense_Mutation	SNP	37730005	37730005	RAB11FIP1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12788	66
PGCP	10404	broad.mit.edu	37	8	97797551	97797551	+	Silent	SNP	T	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:97797551T>A	uc003yhw.2	+	2	592	c.426T>A	c.(424-426)CCT>CCA	p.P142P	PGCP_uc010mbe.2_Silent_p.P142P	NM_016134	NP_057218	Q9Y646	PGCP_HUMAN	plasma glutamate carboxypeptidase precursor	142					peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)					TTGGGACTCCTCCAGAAGGTA	0.398													17	21	---	---	---	---	capture	Silent	SNP	97797551	97797551	PGCP	8	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	11689	66
RIMS2	9699	broad.mit.edu	37	8	105001597	105001597	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105001597C>T	uc003yls.2	+	15	2567	c.2326C>T	c.(2326-2328)CGA>TGA	p.R776*	RIMS2_uc003ylp.2_Nonsense_Mutation_p.R998*|RIMS2_uc003ylw.2_Nonsense_Mutation_p.R790*|RIMS2_uc003ylq.2_Nonsense_Mutation_p.R790*|RIMS2_uc003ylr.2_Nonsense_Mutation_p.R837*	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1060					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TACAATTAGCCGAATGGACAG	0.368										HNSCC(12;0.0054)			59	77	---	---	---	---	capture	Nonsense_Mutation	SNP	105001597	105001597	RIMS2	8	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	13260	66
ENPP2	5168	broad.mit.edu	37	8	120569920	120569920	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120569920G>A	uc003yot.1	-	25	2519	c.2433C>T	c.(2431-2433)GAC>GAT	p.D811D	ENPP2_uc011lic.1_Silent_p.D349D|ENPP2_uc003yor.1_Silent_p.D446D|ENPP2_uc003yos.1_Silent_p.D863D|ENPP2_uc010mdd.1_Silent_p.D836D	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	811					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATTTTGATTCGTCCTCTGAGC	0.453													5	152	---	---	---	---	capture	Silent	SNP	120569920	120569920	ENPP2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5085	66
GLI4	2738	broad.mit.edu	37	8	144358513	144358513	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144358513T>G	uc003yxx.2	+	4	755	c.670T>G	c.(670-672)TCG>GCG	p.S224A	ZFP41_uc003yxv.2_RNA	NM_138465	NP_612474	P10075	GLI4_HUMAN	GLI-Kruppel family member GLI4	224	C2H2-type 2.					nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CCGCGGCTGGTCGGGCTTCAT	0.652													5	21	---	---	---	---	capture	Missense_Mutation	SNP	144358513	144358513	GLI4	8	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	6376	66
EPPK1	83481	broad.mit.edu	37	8	144940380	144940380	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144940380C>T	uc003zaa.1	-	2	15065	c.15052G>A	c.(15052-15054)GTC>ATC	p.V5018I		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	5018	Plectin 64.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGGTCGATGACGCCGCCCGTG	0.697													22	449	---	---	---	---	capture	Missense_Mutation	SNP	144940380	144940380	EPPK1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5145	66
TAF1L	138474	broad.mit.edu	37	9	32630560	32630560	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32630560G>C	uc003zrg.1	-	1	5108	c.5018C>G	c.(5017-5019)ACA>AGA	p.T1673R	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1673					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ACTGAGGGATGTGTTGGTATC	0.473													7	175	---	---	---	---	capture	Missense_Mutation	SNP	32630560	32630560	TAF1L	9	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	15411	66
FAM75C1	441452	broad.mit.edu	37	9	90536517	90536517	+	Silent	SNP	A	G	G			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90536517A>G	uc010mqi.2	+	4	1724	c.1695A>G	c.(1693-1695)TCA>TCG	p.S565S	FAM75C1_uc004apq.3_Silent_p.S548S	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						GGAGTGACTCAGGAAGTGATT	0.507													74	77	---	---	---	---	capture	Silent	SNP	90536517	90536517	FAM75C1	9	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	5569	66
C9orf156	51531	broad.mit.edu	37	9	100672419	100672419	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100672419C>A	uc004axv.1	-	4	966	c.889G>T	c.(889-891)GTC>TTC	p.V297F	C9orf156_uc004axw.1_Missense_Mutation_p.V194F|C9orf156_uc004axx.1_Missense_Mutation_p.V151F|C9orf156_uc010msq.1_Missense_Mutation_p.V194F	NM_016481	NP_057565	Q9BU70	NAP1_HUMAN	Nef associated protein 1	297					interspecies interaction between organisms		hydrolase activity				0		Acute lymphoblastic leukemia(62;0.158)				CCTTGCAAGACTGCTGCTCCT	0.562													35	47	---	---	---	---	capture	Missense_Mutation	SNP	100672419	100672419	C9orf156	9	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	2442	66
ANKS6	203286	broad.mit.edu	37	9	101530447	101530447	+	Silent	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101530447C>T	uc004ayu.2	-	11	2079	c.2058G>A	c.(2056-2058)CGG>CGA	p.R686R	ANKS6_uc004ayt.2_Silent_p.R385R|ANKS6_uc004ayv.1_Silent_p.R148R|ANKS6_uc004ayw.1_Silent_p.R268R|ANKS6_uc004ayx.1_RNA|ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	686	Ser-rich.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)				CAGGGCTTGACCGATGGCTGG	0.577													19	30	---	---	---	---	capture	Silent	SNP	101530447	101530447	ANKS6	9	C	T	T	T	1	0	0	0	0	0	0	0	1	223	18	2	2	686	66
GRIN3A	116443	broad.mit.edu	37	9	104499635	104499635	+	Silent	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:104499635G>A	uc004bbp.1	-	1	1228	c.627C>T	c.(625-627)CTC>CTT	p.L209L	GRIN3A_uc004bbq.1_Silent_p.L209L	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	209	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	TGACCAAGTCGAGCTCCATCA	0.597													32	10	---	---	---	---	capture	Silent	SNP	104499635	104499635	GRIN3A	9	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	6716	66
OR13C5	138799	broad.mit.edu	37	9	107361108	107361108	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107361108T>A	uc011lvp.1	-	1	587	c.587A>T	c.(586-588)GAG>GTG	p.E196V		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CAGGATGAACTCATTGCCTGA	0.383													4	187	---	---	---	---	capture	Missense_Mutation	SNP	107361108	107361108	OR13C5	9	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	10841	66
KCNT1	57582	broad.mit.edu	37	9	138671275	138671275	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138671275G>A	uc011mdq.1	+	24	2874	c.2800G>A	c.(2800-2802)GCC>ACC	p.A934T	KCNT1_uc011mdr.1_Missense_Mutation_p.A761T|KCNT1_uc010nbf.2_Missense_Mutation_p.A889T|KCNT1_uc004cgo.1_Missense_Mutation_p.A683T	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	934						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GCAGTTCCGCGCCAAGGACAG	0.622													14	213	---	---	---	---	capture	Missense_Mutation	SNP	138671275	138671275	KCNT1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8013	66
CXorf57	55086	broad.mit.edu	37	X	105881005	105881005	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105881005C>T	uc004emi.3	+	8	1575	c.1424C>T	c.(1423-1425)CCG>CTG	p.P475L	CXorf57_uc004emj.3_Missense_Mutation_p.P475L|CXorf57_uc004emh.2_Missense_Mutation_p.P475L	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	475										ovary(1)|lung(1)|breast(1)	3						AGAGGCCAGCCGTATACGTAT	0.368													28	5	---	---	---	---	capture	Missense_Mutation	SNP	105881005	105881005	CXorf57	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4073	66
ZNF286B	729288	broad.mit.edu	37	17	18566092	18566093	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18566092_18566093insT	uc010vyd.1	-	5	977_978	c.726_727insA	c.(724-729)AAACCTfs	p.K242fs		NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B	242_243					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CATTTATGAGGTTTTTTCTCTT	0.366													12	24	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	18566092	18566093	ZNF286B	17	-	T	T	T	1	0	1	1	0	0	0	0	0	572	44	5	5	17704	66
HDHD2	84064	broad.mit.edu	37	18	44635107	44635110	+	Frame_Shift_Del	DEL	TAAG	-	-			TCGA-06-0744-01	TCGA-06-0744-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44635107_44635110delTAAG	uc002lcs.2	-	7	856_859	c.723_726delCTTA	c.(721-726)TACTTAfs	p.Y241fs	HDHD2_uc002lct.2_Frame_Shift_Del_p.Y151fs	NM_032124	NP_115500	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain	241_242							hydrolase activity				0						TCTCACAAGTTAAGTAAGGAGGTG	0.407													33	45	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44635107	44635110	HDHD2	18	TAAG	-	-	-	1	0	1	0	1	0	0	0	0	790	61	5	5	6950	66
