Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MTOR	2475	broad.mit.edu	37	1	11217231	11217231	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11217231A>G	uc001asd.2	-	30	4568	c.4447T>C	c.(4447-4449)TGC>CGC	p.C1483R		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1483	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GCCTCGAGGCAGCGCATGCGG	0.527													8	188	---	---	---	---	capture	Missense_Mutation	SNP	11217231	11217231	MTOR	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9864	68
KIF17	57576	broad.mit.edu	37	1	21031072	21031072	+	Missense_Mutation	SNP	G	A	A	rs139912475		TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21031072G>A	uc001bdr.3	-	5	1109	c.991C>T	c.(991-993)CGG>TGG	p.R331W	KIF17_uc001bds.3_Missense_Mutation_p.R331W	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	331					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TTCTTGGCCCGGTTGGCGTAG	0.597													44	78	---	---	---	---	capture	Missense_Mutation	SNP	21031072	21031072	KIF17	1	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	8201	68
ELTD1	64123	broad.mit.edu	37	1	79412033	79412033	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:79412033C>G	uc001diq.3	-	3	407	c.251G>C	c.(250-252)TGT>TCT	p.C84S		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	84	Extracellular (Potential).|EGF-like 2; calcium-binding (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TACACACATACAATAATAACT	0.363													21	21	---	---	---	---	capture	Missense_Mutation	SNP	79412033	79412033	ELTD1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	5039	68
ABCA4	24	broad.mit.edu	37	1	94543367	94543367	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94543367A>T	uc001dqh.2	-	11	1537	c.1433T>A	c.(1432-1434)ATC>AAC	p.I478N	ABCA4_uc010otn.1_Missense_Mutation_p.I478N	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	478	Extracellular.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GAAGTTTAGGATGGCTTCAGC	0.493													129	138	---	---	---	---	capture	Missense_Mutation	SNP	94543367	94543367	ABCA4	1	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	34	68
ATP1A2	477	broad.mit.edu	37	1	160106156	160106156	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160106156G>C	uc001fvc.2	+	18	2691	c.2559G>C	c.(2557-2559)CAG>CAC	p.Q853H	ATP1A2_uc001fvb.2_Missense_Mutation_p.Q853H|ATP1A2_uc001fvd.2_Missense_Mutation_p.Q589H	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	853	Helical; (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCTACGGACAGATCGGTGCGC	0.577													43	71	---	---	---	---	capture	Missense_Mutation	SNP	160106156	160106156	ATP1A2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	1120	68
DUSP27	92235	broad.mit.edu	37	1	167064116	167064116	+	Silent	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167064116G>A	uc001geb.1	+	1	30	c.30G>A	c.(28-30)GAG>GAA	p.E10E		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	10					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						CAGAGGAGGAGCAGGTAGTCC	0.547													12	16	---	---	---	---	capture	Silent	SNP	167064116	167064116	DUSP27	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	4779	68
DUSP27	92235	broad.mit.edu	37	1	167095182	167095182	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167095182C>T	uc001geb.1	+	5	814	c.814C>T	c.(814-816)CGG>TGG	p.R272W		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	272					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						GAAGCAGCTGCGGGAGCTCAA	0.582													45	63	---	---	---	---	capture	Missense_Mutation	SNP	167095182	167095182	DUSP27	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4779	68
NLRP3	114548	broad.mit.edu	37	1	247587535	247587535	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247587535G>T	uc001icr.2	+	5	928	c.790G>T	c.(790-792)GTG>TTG	p.V264L	NLRP3_uc001ics.2_Missense_Mutation_p.V264L|NLRP3_uc001icu.2_Missense_Mutation_p.V264L|NLRP3_uc001icw.2_Missense_Mutation_p.V264L|NLRP3_uc001icv.2_Missense_Mutation_p.V264L|NLRP3_uc010pyw.1_Missense_Mutation_p.V262L|NLRP3_uc001ict.1_Missense_Mutation_p.V262L	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	264	NACHT.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CTGTCGAGAGGTGAGCCTTGT	0.537													69	76	---	---	---	---	capture	Missense_Mutation	SNP	247587535	247587535	NLRP3	1	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	10385	68
MBL2	4153	broad.mit.edu	37	10	54531391	54531391	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:54531391G>T	uc001jjt.2	-	1	70	c.5C>A	c.(4-6)TCC>TAC	p.S2Y		NM_000242	NP_000233	P11226	MBL2_HUMAN	soluble mannose-binding lectin precursor	2					acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding			ovary(1)	1						TGGAAACAGGGACATGGTCCT	0.502													10	6	---	---	---	---	capture	Missense_Mutation	SNP	54531391	54531391	MBL2	10	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	9263	68
PCDH15	65217	broad.mit.edu	37	10	55839114	55839114	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:55839114C>G	uc001jju.1	-	17	2463	c.2068G>C	c.(2068-2070)GCT>CCT	p.A690P	PCDH15_uc010qhq.1_Missense_Mutation_p.A695P|PCDH15_uc010qhr.1_Missense_Mutation_p.A690P|PCDH15_uc010qhs.1_Missense_Mutation_p.A702P|PCDH15_uc010qht.1_Missense_Mutation_p.A697P|PCDH15_uc010qhu.1_Missense_Mutation_p.A690P|PCDH15_uc001jjv.1_Missense_Mutation_p.A668P|PCDH15_uc010qhv.1_Missense_Mutation_p.A690P|PCDH15_uc010qhw.1_Missense_Mutation_p.A653P|PCDH15_uc010qhx.1_Missense_Mutation_p.A619P|PCDH15_uc010qhy.1_Missense_Mutation_p.A695P|PCDH15_uc010qhz.1_Missense_Mutation_p.A690P|PCDH15_uc010qia.1_Missense_Mutation_p.A668P|PCDH15_uc010qib.1_Missense_Mutation_p.A668P|PCDH15_uc001jjw.2_Missense_Mutation_p.A690P	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	690	Cadherin 6.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CCATCTGAAGCTGTGATGATC	0.433										HNSCC(58;0.16)			96	23	---	---	---	---	capture	Missense_Mutation	SNP	55839114	55839114	PCDH15	10	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	11414	68
MGMT	4255	broad.mit.edu	37	10	131506185	131506185	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:131506185C>T	uc001lkh.2	+	3	271	c.245C>T	c.(244-246)GCG>GTG	p.A82V		NM_002412	NP_002403	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase	51										ovary(1)|breast(1)	2		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)		GCCCCCGCTGCGGTTCTCGGA	0.602								Direct_reversal_of_damage					79	13	---	---	---	---	capture	Missense_Mutation	SNP	131506185	131506185	MGMT	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9469	68
PDE3B	5140	broad.mit.edu	37	11	14853295	14853295	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:14853295G>A	uc001mln.2	+	9	2419	c.2066G>A	c.(2065-2067)GGA>GAA	p.G689E	PDE3B_uc010rcr.1_Missense_Mutation_p.G638E	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	689					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						GAAAAGATGGGAGAGAAATCA	0.294													33	31	---	---	---	---	capture	Missense_Mutation	SNP	14853295	14853295	PDE3B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11541	68
HIPK3	10114	broad.mit.edu	37	11	33375092	33375092	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:33375092T>C	uc001mul.1	+	17	3896	c.3626T>C	c.(3625-3627)CTC>CCC	p.L1209P	HIPK3_uc001mum.1_Missense_Mutation_p.L1188P|HIPK3_uc009yjv.1_Missense_Mutation_p.L1188P	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform	1209					anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						CCAACAAAACTCAGCCAGTAT	0.363													13	72	---	---	---	---	capture	Missense_Mutation	SNP	33375092	33375092	HIPK3	11	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	7043	68
OR5AS1	219447	broad.mit.edu	37	11	55798090	55798090	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55798090T>G	uc010riw.1	+	1	196	c.196T>G	c.(196-198)TTA>GTA	p.L66V		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	66	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					TCTTAGCAACTTATCTTTCTT	0.348													48	57	---	---	---	---	capture	Missense_Mutation	SNP	55798090	55798090	OR5AS1	11	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	11050	68
OR5M9	390162	broad.mit.edu	37	11	56229973	56229973	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56229973G>C	uc010rjj.1	-	1	905	c.905C>G	c.(904-906)GCA>GGA	p.A302G		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	302	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					CTTGGTGATTGCTTTGTTGAC	0.378													75	116	---	---	---	---	capture	Missense_Mutation	SNP	56229973	56229973	OR5M9	11	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	11081	68
DTX4	23220	broad.mit.edu	37	11	58949878	58949878	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58949878A>G	uc001nns.2	+	2	1135	c.878A>G	c.(877-879)AAT>AGT	p.N293S	DTX4_uc001nnr.2_Missense_Mutation_p.N187S	NM_015177	NP_055992	Q9Y2E6	DTX4_HUMAN	deltex 4 homolog	293					Notch signaling pathway	cytoplasm	zinc ion binding			lung(2)|central_nervous_system(1)	3		all_epithelial(135;0.125)				GCCACCTTGAATCGTACCAAC	0.612													14	16	---	---	---	---	capture	Missense_Mutation	SNP	58949878	58949878	DTX4	11	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	4752	68
PCNXL3	399909	broad.mit.edu	37	11	65402835	65402835	+	Silent	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65402835G>A	uc001oey.2	+	31	5100	c.5100G>A	c.(5098-5100)GCG>GCA	p.A1700A	PCNXL3_uc001oez.2_Silent_p.A587A	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	1700						integral to membrane					0						CCCTGCTGGCGCTGCGCCATG	0.632													20	22	---	---	---	---	capture	Silent	SNP	65402835	65402835	PCNXL3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11496	68
CACNA1C	775	broad.mit.edu	37	12	2716205	2716205	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2716205C>T	uc009zdu.1	+	27	3638	c.3325C>T	c.(3325-3327)CGC>TGC	p.R1109C	CACNA1C_uc009zdv.1_Missense_Mutation_p.R1086C|CACNA1C_uc001qkb.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkc.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qke.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkf.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qjz.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkd.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkg.2_Missense_Mutation_p.R1089C|CACNA1C_uc009zdw.1_Missense_Mutation_p.R1089C|CACNA1C_uc001qkh.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkl.2_Missense_Mutation_p.R1109C|CACNA1C_uc001qkn.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qko.2_Missense_Mutation_p.R1109C|CACNA1C_uc001qkp.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkr.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qku.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkq.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qks.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qkt.2_Missense_Mutation_p.R1089C|CACNA1C_uc001qka.1_Missense_Mutation_p.R624C|CACNA1C_uc001qki.1_Missense_Mutation_p.R825C|CACNA1C_uc001qkj.1_Missense_Mutation_p.R825C|CACNA1C_uc001qkk.1_Missense_Mutation_p.R825C|CACNA1C_uc001qkm.1_Missense_Mutation_p.R825C	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1109	Extracellular (Potential).|III.|Dihydropyridine binding (By similarity).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CATCCAACCCCGCAGCTGGGA	0.542													36	32	---	---	---	---	capture	Missense_Mutation	SNP	2716205	2716205	CACNA1C	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2516	68
TMTC1	83857	broad.mit.edu	37	12	29669420	29669420	+	Splice_Site	SNP	C	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:29669420C>A	uc001rjb.2	-	15	2320	c.1846_splice	c.e15-1	p.A616_splice	TMTC1_uc001riz.2_Splice_Site_p.A373_splice|TMTC1_uc001rja.2_Splice_Site_p.A460_splice|TMTC1_uc001riy.2_Splice_Site_p.A69_splice	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AAACCTGAGCCTACAAAACCA	0.453													5	81	---	---	---	---	capture	Splice_Site	SNP	29669420	29669420	TMTC1	12	C	A	A	A	1	0	0	0	0	0	0	1	0	312	24	5	4	16143	68
ABCD2	225	broad.mit.edu	37	12	40001468	40001468	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40001468G>A	uc001rmb.2	-	3	1595	c.1169C>T	c.(1168-1170)ACC>ATC	p.T390I		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	390	ABC transmembrane type-1.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						TCGAGCAGTGGTAAAGGCTTC	0.323													42	48	---	---	---	---	capture	Missense_Mutation	SNP	40001468	40001468	ABCD2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	61	68
PCDH20	64881	broad.mit.edu	37	13	61985826	61985826	+	Silent	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:61985826G>A	uc001vid.3	-	2	2770	c.2406C>T	c.(2404-2406)GGC>GGT	p.G802G	PCDH20_uc010thj.1_Silent_p.G802G	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	775	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		AAGTAATGTTGCCAGTTTTAG	0.488													53	70	---	---	---	---	capture	Silent	SNP	61985826	61985826	PCDH20	13	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	11418	68
PCID2	55795	broad.mit.edu	37	13	113854813	113854813	+	Silent	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113854813G>A	uc010tju.1	-	2	135	c.54C>T	c.(52-54)GAC>GAT	p.D18D	PCID2_uc010tjv.1_Silent_p.D18D|PCID2_uc010tjw.1_Silent_p.D18D|PCID2_uc001vte.2_5'UTR|PCID2_uc001vtd.2_5'UTR|PCID2_uc001vtf.2_5'UTR|PCID2_uc001vtg.1_RNA	NM_001127203	NP_001120675	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	18					negative regulation of apoptosis|negative regulation of cysteine-type endopeptidase activity|positive regulation of mitotic cell cycle spindle assembly checkpoint|positive regulation of transcription, DNA-dependent|regulation of mRNA stability|spleen development		protein binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			CATCTCTGCTGTCGATGGCTT	0.418													30	43	---	---	---	---	capture	Silent	SNP	113854813	113854813	PCID2	13	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	11482	68
AHNAK2	113146	broad.mit.edu	37	14	105404844	105404844	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105404844C>T	uc010axc.1	-	7	17064	c.16944G>A	c.(16942-16944)TGG>TGA	p.W5648*	AHNAK2_uc001ypx.2_Nonsense_Mutation_p.W5548*	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5648						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTTTGGAAGCCAAAACCAGA	0.478													31	22	---	---	---	---	capture	Nonsense_Mutation	SNP	105404844	105404844	AHNAK2	14	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	415	68
CEP152	22995	broad.mit.edu	37	15	49054660	49054660	+	Silent	SNP	T	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49054660T>G	uc001zwy.2	-	18	2524	c.2490A>C	c.(2488-2490)ATA>ATC	p.I830I	CEP152_uc001zwz.2_Silent_p.I830I|CEP152_uc001zxa.1_Silent_p.I737I	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	830					centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CCTTGATGGCTATGTCCTTCT	0.358													78	92	---	---	---	---	capture	Silent	SNP	49054660	49054660	CEP152	15	T	G	G	G	1	0	0	0	0	0	0	0	1	680	53	4	4	3216	68
HYDIN	54768	broad.mit.edu	37	16	70913364	70913364	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70913364C>T	uc002ezr.2	-	62	10518	c.10390G>A	c.(10390-10392)GTG>ATG	p.V3464M		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3465										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				ATGTCAAACACGAGGCCTCGG	0.567													21	55	---	---	---	---	capture	Missense_Mutation	SNP	70913364	70913364	HYDIN	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7392	68
SLC4A1	6521	broad.mit.edu	37	17	42330498	42330498	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42330498C>T	uc002igf.3	-	17	2448	c.2299G>A	c.(2299-2301)GCT>ACT	p.A767T		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	767	Helical; (Potential).|Membrane (anion exchange).				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		ACAAGCACAGCGACCAGGAGT	0.637													22	128	---	---	---	---	capture	Missense_Mutation	SNP	42330498	42330498	SLC4A1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14542	68
FBF1	85302	broad.mit.edu	37	17	73914257	73914257	+	Silent	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73914257G>A	uc002jqc.2	-	20	2461	c.2187C>T	c.(2185-2187)GCC>GCT	p.A729A	FBF1_uc002jqa.1_RNA|FBF1_uc010wsp.1_Silent_p.A720A|FBF1_uc002jqd.1_Silent_p.A730A|FBF1_uc002jqb.2_RNA|FBF1_uc010dgr.1_Silent_p.A40A	NM_001080542	NP_001074011	Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	729											0						TGTGGGAGGTGGCACTGGTGG	0.662													14	17	---	---	---	---	capture	Silent	SNP	73914257	73914257	FBF1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	5641	68
AANAT	15	broad.mit.edu	37	17	74465812	74465812	+	Silent	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74465812C>T	uc002jro.2	+	4	618	c.384C>T	c.(382-384)CGC>CGT	p.R128R	AANAT_uc010wte.1_RNA	NM_001088	NP_001079	Q16613	SNAT_HUMAN	arylalkylamine N-acetyltransferase	128	N-acetyltransferase.				circadian rhythm|melatonin biosynthetic process	cytosol	aralkylamine N-acetyltransferase activity				0						CCGTGCACCGCGCCTTCCGGC	0.701													8	11	---	---	---	---	capture	Silent	SNP	74465812	74465812	AANAT	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	18	68
EPB41L3	23136	broad.mit.edu	37	18	5489008	5489008	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5489008G>A	uc002kmt.1	-	2	261	c.175C>T	c.(175-177)CGG>TGG	p.R59W	EPB41L3_uc010wzh.1_Missense_Mutation_p.R59W|EPB41L3_uc002kmu.1_Missense_Mutation_p.R59W|EPB41L3_uc010dkq.1_5'UTR|EPB41L3_uc010dks.1_Missense_Mutation_p.R81W|EPB41L3_uc002kmv.1_5'UTR	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	59					cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						ACCTCCCTCCGCACCGGGGTG	0.562													34	44	---	---	---	---	capture	Missense_Mutation	SNP	5489008	5489008	EPB41L3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	5109	68
LAMA3	3909	broad.mit.edu	37	18	21338466	21338466	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21338466G>A	uc002kuq.2	+	7	1140	c.1054G>A	c.(1054-1056)GAG>AAG	p.E352K	LAMA3_uc010dlv.1_Missense_Mutation_p.E352K|LAMA3_uc002kur.2_Missense_Mutation_p.E352K	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	352	Laminin EGF-like 1.|Domain V.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCAGAGCCACGAGTGTGAAGG	0.647													17	29	---	---	---	---	capture	Missense_Mutation	SNP	21338466	21338466	LAMA3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8527	68
TAF4B	6875	broad.mit.edu	37	18	23873445	23873445	+	Silent	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:23873445A>G	uc002kvu.3	+	9	2271	c.1782A>G	c.(1780-1782)GCA>GCG	p.A594A	TAF4B_uc002kvs.3_RNA|TAF4B_uc002kvt.3_Silent_p.A599A	NM_005640	NP_005631	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding	594					transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleolus|transcription factor TFIID complex	DNA binding|NF-kappaB binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)|skin(1)	3	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			CACTTCAAGCATCTCCTACTC	0.269													21	32	---	---	---	---	capture	Silent	SNP	23873445	23873445	TAF4B	18	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	15415	68
BEST2	54831	broad.mit.edu	37	19	12864093	12864093	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12864093C>T	uc002mux.2	+	2	172	c.172C>T	c.(172-174)CAG>TAG	p.Q58*		NM_017682	NP_060152	Q8NFU1	BEST2_HUMAN	vitelliform macular dystrophy 2-like 1	58	Extracellular (Potential).				membrane depolarization|sensory perception of smell	chloride channel complex|cilium|plasma membrane	chloride channel activity			ovary(1)|pancreas(1)	2						GACCGAAGGGCAGAAGCGCTA	0.567													53	138	---	---	---	---	capture	Nonsense_Mutation	SNP	12864093	12864093	BEST2	19	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	1394	68
OR7A10	390892	broad.mit.edu	37	19	14951796	14951796	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14951796C>A	uc002mzx.1	-	1	894	c.894G>T	c.(892-894)AAG>AAT	p.K298N		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	298	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					TCATAGCACCCTTTATGTGTT	0.468													40	129	---	---	---	---	capture	Missense_Mutation	SNP	14951796	14951796	OR7A10	19	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	11118	68
MAP1S	55201	broad.mit.edu	37	19	17838511	17838511	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17838511G>A	uc002nhe.1	+	5	2327	c.2318G>A	c.(2317-2319)CGG>CAG	p.R773Q	MAP1S_uc010eba.1_Intron|MAP1S_uc002nhf.1_Missense_Mutation_p.R21Q|MAP1S_uc010xpv.1_Missense_Mutation_p.R747Q	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	773	Pro-rich.|Necessary for the microtubule-organizing center localization.|Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						TCACAGGAACGGGCAGGTGGG	0.687													12	31	---	---	---	---	capture	Missense_Mutation	SNP	17838511	17838511	MAP1S	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9148	68
CEACAM5	1048	broad.mit.edu	37	19	42218934	42218934	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42218934G>A	uc002ork.2	+	3	590	c.469G>A	c.(469-471)GTG>ATG	p.V157M	CEACAM5_uc010ehz.1_Missense_Mutation_p.V157M|CEACAM5_uc002orj.1_Missense_Mutation_p.V157M|CEACAM5_uc002orl.2_Missense_Mutation_p.V157M	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	157	Ig-like 2.					anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CTCCAAACCCGTGGAGGACAA	0.562													91	120	---	---	---	---	capture	Missense_Mutation	SNP	42218934	42218934	CEACAM5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3164	68
FUT1	2523	broad.mit.edu	37	19	49253828	49253828	+	Silent	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49253828G>A	uc002pkk.2	-	4	1686	c.711C>T	c.(709-711)GGC>GGT	p.G237G		NM_000148	NP_000139	P19526	FUT1_HUMAN	fucosyltransferase 1	237	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to plasma membrane|membrane fraction	galactoside 2-alpha-L-fucosyltransferase activity			ovary(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		AGGCGCTGTCGCCCACCACAC	0.657													85	103	---	---	---	---	capture	Silent	SNP	49253828	49253828	FUT1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6043	68
NLRP12	91662	broad.mit.edu	37	19	54314476	54314476	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54314476C>T	uc002qch.3	-	3	657	c.437G>A	c.(436-438)CGC>CAC	p.R146H	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.R146H|NLRP12_uc002qcj.3_Missense_Mutation_p.R146H|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.R146H	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	146					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TTCCCCTAGGCGCGCATTGCG	0.567													85	102	---	---	---	---	capture	Missense_Mutation	SNP	54314476	54314476	NLRP12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10381	68
SAPS1	22870	broad.mit.edu	37	19	55742009	55742009	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55742009G>T	uc002qjw.3	-	23	2856	c.2614C>A	c.(2614-2616)CCG>ACG	p.P872T	TMEM86B_uc002qjt.2_5'Flank|TMEM86B_uc002qju.2_5'Flank|SAPS1_uc002qjv.2_Missense_Mutation_p.P934T	NM_014931	NP_055746	Q9UPN7	PP6R1_HUMAN	SAPS domain family, member 1	872	Pro-rich.				regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding				0		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGCCCTTCCGGGGCAGAGCCA	0.677													12	16	---	---	---	---	capture	Missense_Mutation	SNP	55742009	55742009	SAPS1	19	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	13728	68
SLC9A4	389015	broad.mit.edu	37	2	103095456	103095456	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103095456G>A	uc002tbz.3	+	2	872	c.415G>A	c.(415-417)GTT>ATT	p.V139I		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	139	Helical; Name=D/M4; (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GCCACCCATCGTTCTGGAGGG	0.617													49	90	---	---	---	---	capture	Missense_Mutation	SNP	103095456	103095456	SLC9A4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14608	68
ANAPC1	64682	broad.mit.edu	37	2	112541977	112541977	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:112541977C>T	uc002thi.2	-	41	5165	c.4918G>A	c.(4918-4920)GGC>AGC	p.G1640S		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1640					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						CACTGAGTGCCCTTTACAAAT	0.458													12	59	---	---	---	---	capture	Missense_Mutation	SNP	112541977	112541977	ANAPC1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	595	68
TTN	7273	broad.mit.edu	37	2	179542530	179542530	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179542530A>G	uc010zfg.1	-	143	30601	c.30377T>C	c.(30376-30378)GTT>GCT	p.V10126A	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V6787A|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11053							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCAGGTAGAACTTCCTCTTC	0.448													92	126	---	---	---	---	capture	Missense_Mutation	SNP	179542530	179542530	TTN	2	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	16617	68
ALPI	248	broad.mit.edu	37	2	233323014	233323014	+	Missense_Mutation	SNP	C	T	T	rs146257849	byFrequency;by1000genomes	TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233323014C>T	uc002vst.3	+	9	1156	c.1079C>T	c.(1078-1080)GCG>GTG	p.A360V	ALPI_uc002vsu.3_Missense_Mutation_p.A271V	NM_001631	NP_001622	P09923	PPBI_HUMAN	intestinal alkaline phosphatase precursor	360					phosphorylation	anchored to membrane|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding|protein binding			central_nervous_system(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		ATTGAGAGGGCGGGCCAGCTC	0.627													35	50	---	---	---	---	capture	Missense_Mutation	SNP	233323014	233323014	ALPI	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	543	68
PDCD1	5133	broad.mit.edu	37	2	242800933	242800933	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242800933G>A	uc002wcq.3	-	1	126	c.58C>T	c.(58-60)CGG>TGG	p.R20W	PDCD1_uc010fzt.2_RNA	NM_005018	NP_005009	Q15116	PDCD1_HUMAN	programmed cell death 1 precursor	20					apoptosis|humoral immune response|multicellular organismal development|T cell costimulation	integral to membrane	protein tyrosine phosphatase activity|signal transducer activity			ovary(1)	1		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		CATCCTGGCCGCCAGCCCAGT	0.677													5	5	---	---	---	---	capture	Missense_Mutation	SNP	242800933	242800933	PDCD1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	11518	68
C20orf196	149840	broad.mit.edu	37	20	5843987	5843987	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5843987G>T	uc002wmf.2	+	3	583	c.496G>T	c.(496-498)GAC>TAC	p.D166Y		NM_152504	NP_689717	Q8IYI0	CT196_HUMAN	hypothetical protein LOC149840	166											0						GCATTCCAGGGACACCCACTT	0.512													55	130	---	---	---	---	capture	Missense_Mutation	SNP	5843987	5843987	C20orf196	20	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	2083	68
DLGAP4	22839	broad.mit.edu	37	20	35060659	35060659	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35060659G>A	uc002xff.2	+	3	974	c.539G>A	c.(538-540)CGG>CAG	p.R180Q	DLGAP4_uc010zvp.1_Missense_Mutation_p.R180Q	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	180					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GGCAAGGGCCGGAGGGCCAAA	0.647													33	64	---	---	---	---	capture	Missense_Mutation	SNP	35060659	35060659	DLGAP4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4520	68
NFATC2	4773	broad.mit.edu	37	20	50133367	50133367	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50133367G>A	uc002xwd.2	-	3	1508	c.1288C>T	c.(1288-1290)CGA>TGA	p.R430*	NFATC2_uc002xwc.2_Nonsense_Mutation_p.R430*|NFATC2_uc010zyv.1_Nonsense_Mutation_p.R211*|NFATC2_uc010zyw.1_Nonsense_Mutation_p.R211*|NFATC2_uc010zyx.1_Nonsense_Mutation_p.R410*|NFATC2_uc010zyy.1_Nonsense_Mutation_p.R211*|NFATC2_uc010zyz.1_Nonsense_Mutation_p.R211*|NFATC2_uc002xwe.2_Nonsense_Mutation_p.R410*	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	430	RHD.				B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					ACAGCCCCTCGGCTGCCTTCT	0.557													37	126	---	---	---	---	capture	Nonsense_Mutation	SNP	50133367	50133367	NFATC2	20	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	10269	68
COL20A1	57642	broad.mit.edu	37	20	61943349	61943349	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61943349G>A	uc011aau.1	+	14	1845	c.1745G>A	c.(1744-1746)AGG>AAG	p.R582K	COL20A1_uc011aav.1_Missense_Mutation_p.R403K	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	582	Fibronectin type-III 4.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					GGTGCCCCGAGGCCTGTGCGC	0.682													10	30	---	---	---	---	capture	Missense_Mutation	SNP	61943349	61943349	COL20A1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	3644	68
KRTAP10-11	386678	broad.mit.edu	37	21	46066409	46066409	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46066409G>A	uc002zfr.3	+	1	79	c.34G>A	c.(34-36)GCT>ACT	p.A12T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198692	NP_941965	P60412	KR10B_HUMAN	keratin associated protein 10-11	12						keratin filament				ovary(1)	1						CTGCTCCAGCGCTTACTCCGA	0.582													47	50	---	---	---	---	capture	Missense_Mutation	SNP	46066409	46066409	KRTAP10-11	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8427	68
SLC19A1	6573	broad.mit.edu	37	21	46950811	46950811	+	Missense_Mutation	SNP	C	T	T	rs142899279		TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46950811C>T	uc002zhl.1	-	4	1143	c.1024G>A	c.(1024-1026)GTC>ATC	p.V342I	SLC19A1_uc010gpy.1_Missense_Mutation_p.V342I|SLC19A1_uc011aft.1_Missense_Mutation_p.V302I|SLC19A1_uc002zhm.1_Missense_Mutation_p.V342I|SLC19A1_uc010gpz.1_Missense_Mutation_p.V221I	NM_194255	NP_919231	P41440	S19A1_HUMAN	solute carrier family 19 member 1	342	Helical; (Probable).				folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity				0				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)		GTGGCCGTGACGCCCGCGATG	0.697													15	22	---	---	---	---	capture	Missense_Mutation	SNP	46950811	46950811	SLC19A1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14321	68
CCT8L2	150160	broad.mit.edu	37	22	17073274	17073274	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17073274C>T	uc002zlp.1	-	1	427	c.167G>A	c.(166-168)CGG>CAG	p.R56Q		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	56					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GAACTTCTGCCGGCCGTGGGG	0.642													69	94	---	---	---	---	capture	Missense_Mutation	SNP	17073274	17073274	CCT8L2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2932	68
GNB1L	54584	broad.mit.edu	37	22	19799872	19799872	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19799872C>T	uc002zqe.1	-	4	747	c.353G>A	c.(352-354)AGC>AAC	p.S118N	GNB1L_uc002zqd.1_5'UTR|GNB1L_uc002zqf.1_Missense_Mutation_p.S118N	NM_053004	NP_443730	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein	118					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)					CAGGATGCTGCTCCGGCAGAA	0.692													33	25	---	---	---	---	capture	Missense_Mutation	SNP	19799872	19799872	GNB1L	22	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	6452	68
BPIL2	254240	broad.mit.edu	37	22	32833790	32833790	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32833790C>T	uc003amn.2	-	7	704	c.704G>A	c.(703-705)AGT>AAT	p.S235N	BPIL2_uc010gwo.2_Missense_Mutation_p.S49N|BPIL2_uc011amb.1_5'UTR	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	235						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						TTCTGGAGAACTGATTAGGGA	0.353													22	4	---	---	---	---	capture	Missense_Mutation	SNP	32833790	32833790	BPIL2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	1480	68
SYN3	8224	broad.mit.edu	37	22	33402361	33402361	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:33402361A>G	uc003amx.2	-	1	446	c.287T>C	c.(286-288)GTG>GCG	p.V96A	SYN3_uc003amy.2_Missense_Mutation_p.V96A|SYN3_uc003amz.2_Missense_Mutation_p.V96A	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	96	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						ATCATCGATCACCAACAGGAT	0.547													67	17	---	---	---	---	capture	Missense_Mutation	SNP	33402361	33402361	SYN3	22	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	15330	68
ATP2B2	491	broad.mit.edu	37	3	10413514	10413514	+	Silent	SNP	G	A	A	rs148841263	byFrequency;by1000genomes	TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10413514G>A	uc003bvt.2	-	12	2077	c.1638C>T	c.(1636-1638)AGC>AGT	p.S546S	ATP2B2_uc003bvv.2_Silent_p.S501S|ATP2B2_uc003bvw.2_Silent_p.S501S|ATP2B2_uc010hdo.2_Silent_p.S251S	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	546	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						TGGTGTAGGCGCTGTTGATGG	0.547													38	41	---	---	---	---	capture	Silent	SNP	10413514	10413514	ATP2B2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	1131	68
NR2C2	7182	broad.mit.edu	37	3	15070193	15070193	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15070193A>G	uc003bzj.3	+	8	1116	c.899A>G	c.(898-900)CAG>CGG	p.Q300R	NR2C2_uc003bzi.2_Missense_Mutation_p.Q319R	NM_003298	NP_003289	P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	300					cell differentiation|nervous system development|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0						TCAGAAATCCAGCCAGAGGAC	0.542													3	67	---	---	---	---	capture	Missense_Mutation	SNP	15070193	15070193	NR2C2	3	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	10530	68
LRRC3B	116135	broad.mit.edu	37	3	26751737	26751737	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:26751737G>A	uc003cdp.2	+	2	1163	c.574G>A	c.(574-576)GCT>ACT	p.A192T	LRRC3B_uc003cdq.2_Missense_Mutation_p.A192T	NM_052953	NP_443185	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B precursor	192	LRRCT.					integral to membrane				pancreas(2)|ovary(1)|skin(1)	4						TGCCAACGACGCTGACCTTTG	0.468													20	24	---	---	---	---	capture	Missense_Mutation	SNP	26751737	26751737	LRRC3B	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8911	68
MST1R	4486	broad.mit.edu	37	3	49940194	49940194	+	Silent	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49940194A>G	uc003cxy.3	-	1	1113	c.849T>C	c.(847-849)CTT>CTC	p.L283L	MST1R_uc011bdd.1_Silent_p.L283L|MST1R_uc011bde.1_Silent_p.L283L|MST1R_uc011bdf.1_Silent_p.L283L|MST1R_uc011bdg.1_Silent_p.L283L	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	283	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CAGTGGCGCTAAGCCGTGCCA	0.622													95	96	---	---	---	---	capture	Silent	SNP	49940194	49940194	MST1R	3	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	9801	68
ITIH4	3700	broad.mit.edu	37	3	52851043	52851043	+	Silent	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52851043C>T	uc003dfz.2	-	21	2364	c.2328G>A	c.(2326-2328)GAG>GAA	p.E776E	ITIH4_uc011bel.1_Silent_p.E490E|ITIH4_uc003dfy.2_Silent_p.E571E|ITIH4_uc011bem.1_Silent_p.E781E|ITIH4_uc011ben.1_Silent_p.E746E	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	776					acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		ACCCAGCCTTCTCCCTCTCAT	0.592													73	95	---	---	---	---	capture	Silent	SNP	52851043	52851043	ITIH4	3	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	7829	68
ARL6	84100	broad.mit.edu	37	3	97506846	97506846	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97506846G>A	uc003drv.2	+	7	675	c.362G>A	c.(361-363)CGT>CAT	p.R121H	ARL6_uc003drw.2_RNA|ARL6_uc003dru.2_Missense_Mutation_p.R121H|ARL6_uc010hoy.2_Missense_Mutation_p.R121H	NM_177976	NP_816931	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	121					cilium assembly|determination of left/right symmetry|melanosome transport|protein polymerization|protein targeting to membrane|small GTPase mediated signal transduction|visual perception|Wnt receptor signaling pathway	axonemal microtubule|cilium axoneme|cilium membrane|membrane coat|microtubule basal body	GTP binding|metal ion binding|phospholipid binding|protein binding				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		ATTAAACACCGTCGAATTCCA	0.323									Bardet-Biedl_syndrome				21	14	---	---	---	---	capture	Missense_Mutation	SNP	97506846	97506846	ARL6	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	934	68
OR5K1	26339	broad.mit.edu	37	3	98189167	98189167	+	Silent	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98189167A>G	uc003dsm.2	+	1	747	c.747A>G	c.(745-747)TCA>TCG	p.S249S		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						TGTCAGTTTCATTATTCTATG	0.333													66	63	---	---	---	---	capture	Silent	SNP	98189167	98189167	OR5K1	3	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	11070	68
ST3GAL6	10402	broad.mit.edu	37	3	98507190	98507190	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98507190G>C	uc003dsz.2	+	8	875	c.639G>C	c.(637-639)AAG>AAC	p.K213N	ST3GAL6_uc003dsy.2_Missense_Mutation_p.K127N|ST3GAL6_uc003dta.2_Missense_Mutation_p.K95N|ST3GAL6_uc003dtb.2_Missense_Mutation_p.K69N|ST3GAL6_uc003dtc.2_Missense_Mutation_p.K213N|ST3GAL6_uc010hpd.2_Missense_Mutation_p.K266N	NM_006100	NP_006091	Q9Y274	SIA10_HUMAN	alpha2,3-sialyltransferase VI	213	Lumenal (Potential).				amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1						GTTTTTGGAAGAAACCAGCCT	0.323													31	74	---	---	---	---	capture	Missense_Mutation	SNP	98507190	98507190	ST3GAL6	3	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	15109	68
MYLK	4638	broad.mit.edu	37	3	123428617	123428617	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123428617G>C	uc003ego.2	-	14	2210	c.1928C>G	c.(1927-1929)ACT>AGT	p.T643S	MYLK_uc011bjw.1_Missense_Mutation_p.T643S|MYLK_uc003egp.2_Missense_Mutation_p.T574S|MYLK_uc003egq.2_Missense_Mutation_p.T643S|MYLK_uc003egr.2_Missense_Mutation_p.T574S|MYLK_uc003egs.2_Missense_Mutation_p.T467S	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	643	Ig-like C2-type 5.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CACTTGGACAGTCATAGTGAC	0.532													249	308	---	---	---	---	capture	Missense_Mutation	SNP	123428617	123428617	MYLK	3	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	9966	68
TRIM42	287015	broad.mit.edu	37	3	140397090	140397090	+	Missense_Mutation	SNP	G	A	A	rs116143762	by1000genomes	TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140397090G>A	uc003eto.1	+	1	210	c.19G>A	c.(19-21)GTT>ATT	p.V7I		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	7	Cys-rich.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						TGCTATGTGCGTTTGCTGTCC	0.507													155	186	---	---	---	---	capture	Missense_Mutation	SNP	140397090	140397090	TRIM42	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16400	68
ZIC4	84107	broad.mit.edu	37	3	147114065	147114065	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:147114065C>T	uc003ewd.1	-	3	535	c.262G>A	c.(262-264)GCC>ACC	p.A88T	ZIC4_uc003ewc.1_Missense_Mutation_p.A18T|ZIC4_uc011bno.1_Missense_Mutation_p.A138T	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	88	Poly-Ala.					nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GCTGCCAGGGCGTCGCTGCGG	0.701													14	17	---	---	---	---	capture	Missense_Mutation	SNP	147114065	147114065	ZIC4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17561	68
VPS8	23355	broad.mit.edu	37	3	184571960	184571960	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184571960G>A	uc003fpb.1	+	12	1199	c.1028G>A	c.(1027-1029)CGG>CAG	p.R343Q	VPS8_uc010hyd.1_Missense_Mutation_p.R343Q	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	345							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CCCTATGGCCGGGTGAGTACG	0.413													32	35	---	---	---	---	capture	Missense_Mutation	SNP	184571960	184571960	VPS8	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17100	68
MUC4	4585	broad.mit.edu	37	3	195505849	195505849	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505849G>A	uc011bto.1	-	3	12678	c.12218C>T	c.(12217-12219)GCA>GTA	p.A4073V	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.592													3	8	---	---	---	---	capture	Missense_Mutation	SNP	195505849	195505849	MUC4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9888	68
TLR6	10333	broad.mit.edu	37	4	38830788	38830788	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38830788C>T	uc003gtm.2	-	1	373	c.307G>A	c.(307-309)GAA>AAA	p.E103K	TLR6_uc010ifg.1_Missense_Mutation_p.E103K	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	103	LRR 3.|Extracellular (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						TCCAAATATTCTAAATCCTGG	0.363													32	52	---	---	---	---	capture	Missense_Mutation	SNP	38830788	38830788	TLR6	4	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	15840	68
PRDM8	56978	broad.mit.edu	37	4	81123201	81123201	+	Silent	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:81123201C>T	uc010ijo.2	+	8	1424	c.585C>T	c.(583-585)GGC>GGT	p.G195G	PRDM8_uc003hmb.3_Silent_p.G195G|PRDM8_uc003hmc.3_Silent_p.G195G	NM_020226	NP_064611	Q9NQV8	PRDM8_HUMAN	PR domain containing 8	195	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						AACAAggcggcggcgtgggca	0.343											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	134	---	---	---	---	capture	Silent	SNP	81123201	81123201	PRDM8	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12358	68
HHIP	64399	broad.mit.edu	37	4	145580881	145580881	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:145580881G>A	uc003ijs.1	+	4	1377	c.722G>A	c.(721-723)CGT>CAT	p.R241H	HHIP_uc003ijr.1_Missense_Mutation_p.R241H	NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor	241						cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		GGCTCGCAACGTCTCTTCATT	0.453													8	266	---	---	---	---	capture	Missense_Mutation	SNP	145580881	145580881	HHIP	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7017	68
HCN1	348980	broad.mit.edu	37	5	45262309	45262309	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262309T>A	uc003jok.2	-	8	2412	c.2387A>T	c.(2386-2388)GAG>GTG	p.E796V		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	796	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AGTGGACACCTCATGGGGCAG	0.632													39	58	---	---	---	---	capture	Missense_Mutation	SNP	45262309	45262309	HCN1	5	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	6922	68
PJA2	9867	broad.mit.edu	37	5	108680493	108680493	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:108680493C>A	uc003kos.3	-	8	2012	c.1792G>T	c.(1792-1794)GCA>TCA	p.A598S		NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing	598	Interaction with PRKAR1A, PRKAR2A and PRKAR2B.				long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		ACATCCACTGCAAGAGACTCT	0.408													37	66	---	---	---	---	capture	Missense_Mutation	SNP	108680493	108680493	PJA2	5	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	11865	68
PRSS16	10279	broad.mit.edu	37	6	27220721	27220721	+	Silent	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27220721C>T	uc003nja.2	+	9	1155	c.1143C>T	c.(1141-1143)TTC>TTT	p.F381F	PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Silent_p.F124F|PRSS16_uc010jqq.1_Silent_p.F158F|PRSS16_uc010jqr.1_Silent_p.F132F|PRSS16_uc003njc.1_RNA|PRSS16_uc003njd.2_Intron	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	381					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						GTACCGAGTTCGGCTTCTGTA	0.507													95	127	---	---	---	---	capture	Silent	SNP	27220721	27220721	PRSS16	6	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	12511	68
UHRF1BP1	54887	broad.mit.edu	37	6	34838669	34838669	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34838669C>T	uc003oju.3	+	18	3991	c.3757C>T	c.(3757-3759)CAC>TAC	p.H1253Y	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1253										ovary(3)	3						GAAGACTGGCCACATCAGGCC	0.428													41	55	---	---	---	---	capture	Missense_Mutation	SNP	34838669	34838669	UHRF1BP1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	16850	68
EEF1A1	1915	broad.mit.edu	37	6	74227627	74227627	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74227627G>A	uc003phi.2	-	7	1332	c.1295C>T	c.(1294-1296)ACA>ATA	p.T432I	EEF1A1_uc003phd.2_Missense_Mutation_p.T157I|EEF1A1_uc003phe.2_Missense_Mutation_p.T422I|EEF1A1_uc003phf.2_Missense_Mutation_p.T425I|EEF1A1_uc003phg.2_3'UTR|EEF1A1_uc003phh.2_Missense_Mutation_p.T278I|EEF1A1_uc003phj.2_Missense_Mutation_p.T432I|EEF1A1_uc003phk.2_Missense_Mutation_p.T432I|EEF1A1_uc003phl.2_Intron|EEF1A1_uc003phm.1_Intron	NM_001402	NP_001393	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha	432						cytosol|eukaryotic translation elongation factor 1 complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0						CACCGCAACTGTCTGTCTCAT	0.403											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	24	62	---	---	---	---	capture	Missense_Mutation	SNP	74227627	74227627	EEF1A1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4878	68
TMEM30A	55754	broad.mit.edu	37	6	75968538	75968538	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:75968538G>C	uc003phw.2	-	6	1128	c.850C>G	c.(850-852)CCA>GCA	p.P284A	TMEM30A_uc003phx.2_Missense_Mutation_p.P248A	NM_018247	NP_060717	Q9NV96	CC50A_HUMAN	transmembrane protein 30A isoform 1	284						integral to membrane					0						GGTAATGTTGGATGTAAATCA	0.388													24	34	---	---	---	---	capture	Missense_Mutation	SNP	75968538	75968538	TMEM30A	6	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	16036	68
TTK	7272	broad.mit.edu	37	6	80746263	80746263	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:80746263G>C	uc003pjc.2	+	17	2070	c.1996G>C	c.(1996-1998)GGG>CGG	p.G666R	TTK_uc003pjb.3_Missense_Mutation_p.G665R	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	666	Protein kinase.				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AATTGATTTTGGGATTGCAAA	0.323													6	76	---	---	---	---	capture	Missense_Mutation	SNP	80746263	80746263	TTK	6	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	16602	68
MYB	4602	broad.mit.edu	37	6	135514998	135514998	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:135514998C>T	uc003qfc.2	+	7	984	c.785C>T	c.(784-786)CCT>CTT	p.P262L	MYB_uc003qfh.2_Missense_Mutation_p.P262L|MYB_uc003qfi.2_Missense_Mutation_p.P262L|MYB_uc010kgi.2_Missense_Mutation_p.P262L|MYB_uc003qfq.2_Missense_Mutation_p.P262L|MYB_uc010kgj.2_Missense_Mutation_p.P262L|MYB_uc003qfo.2_Missense_Mutation_p.P262L|MYB_uc003qfu.2_Missense_Mutation_p.P262L|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_5'UTR|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_Missense_Mutation_p.P74L|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Missense_Mutation_p.P262L|MYB_uc003qgd.1_Missense_Mutation_p.P74L|MYB_uc003qge.1_5'Flank	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog	262					blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		GTTCCATACCCTGTAGCGTTA	0.453			T	NFIB	adenoid cystic carcinoma								4	159	---	---	---	---	capture	Missense_Mutation	SNP	135514998	135514998	MYB	6	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	9917	68
EGFR	1956	broad.mit.edu	37	7	55221822	55221823	+	Missense_Mutation	DNP	CC	TT	TT	rs149840192		TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822_55221823CC>TT	uc003tqk.2	+	7	1112_1113	c.866_867CC>TT	c.(865-867)GCC>GTT	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTGA	0.594		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			776	39	---	---	---	---	capture	Missense_Mutation	DNP	55221822	55221823	EGFR	7	CC	TT	TT	TT	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	68
GPR85	54329	broad.mit.edu	37	7	112724771	112724771	+	Silent	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:112724771C>T	uc010ljv.2	-	2	523	c.6G>A	c.(4-6)GCG>GCA	p.A2A	GPR85_uc003vgp.1_Silent_p.A2A|GPR85_uc003vgq.2_Silent_p.A2A|GPR85_uc010ljw.1_Silent_p.A2A	NM_001146266	NP_001139738	P60893	GPR85_HUMAN	G protein-coupled receptor 85	2	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)	2						GGCTATAGTTCGCCATAGATG	0.403													15	36	---	---	---	---	capture	Silent	SNP	112724771	112724771	GPR85	7	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	6648	68
DENND2A	27147	broad.mit.edu	37	7	140267052	140267052	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140267052T>C	uc010lnj.2	-	7	1758	c.1613A>G	c.(1612-1614)AAC>AGC	p.N538S	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.N538S|DENND2A_uc003vvw.2_Missense_Mutation_p.N538S|DENND2A_uc003vvx.2_Missense_Mutation_p.N538S	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	538										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					GGACTTCACGTTGACCAGGCG	0.383													18	59	---	---	---	---	capture	Missense_Mutation	SNP	140267052	140267052	DENND2A	7	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	4387	68
GBX1	2636	broad.mit.edu	37	7	150845924	150845924	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150845924A>T	uc011kvg.1	-	2	1076	c.844T>A	c.(844-846)TGC>AGC	p.C282S		NM_001098834	NP_001092304	Q14549	GBX1_HUMAN	gastrulation brain homeo box 1	282	Homeobox.					nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TATTTCTTGCAATGAAATTCC	0.557													61	133	---	---	---	---	capture	Missense_Mutation	SNP	150845924	150845924	GBX1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	6220	68
RPS20	6224	broad.mit.edu	37	8	56985787	56985787	+	Silent	SNP	A	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:56985787A>T	uc003xsn.2	-	4	420	c.222T>A	c.(220-222)TCT>TCA	p.S74S	RPS20_uc003xsm.2_Silent_p.S74S	NM_001023	NP_001014	P60866	RS20_HUMAN	ribosomal protein S20 isoform 2	74					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)			CCCACGTCTTAGAACCTTCAC	0.388													78	78	---	---	---	---	capture	Silent	SNP	56985787	56985787	RPS20	8	A	T	T	T	1	0	0	0	0	0	0	0	1	184	15	4	4	13524	68
EIF2C2	27161	broad.mit.edu	37	8	141570507	141570507	+	Silent	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:141570507C>T	uc003yvn.2	-	5	661	c.621G>A	c.(619-621)CGG>CGA	p.R207R	EIF2C2_uc010men.2_Silent_p.R130R|EIF2C2_uc010meo.2_Silent_p.R207R	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	207					mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)			AGAGAGAAGGCCGGACGGACT	0.622													47	84	---	---	---	---	capture	Silent	SNP	141570507	141570507	EIF2C2	8	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	4961	68
IFNA10	3446	broad.mit.edu	37	9	21206995	21206995	+	Silent	SNP	A	G	G			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21206995A>G	uc003zoq.1	-	1	148	c.102T>C	c.(100-102)AAT>AAC	p.N34N	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	34					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		AGGCCCTCCTATTACCCAGGC	0.512													63	16	---	---	---	---	capture	Silent	SNP	21206995	21206995	IFNA10	9	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	7457	68
KIAA0368	23392	broad.mit.edu	37	9	114188086	114188086	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114188086C>T	uc004bfe.1	-	12	1607	c.1607G>A	c.(1606-1608)GGT>GAT	p.G536D	KIAA0368_uc010muc.1_Missense_Mutation_p.G358D	NM_001080398	NP_001073867			KIAA0368 protein												0						TGTATTTGTACCAAAAAGTCC	0.249													43	52	---	---	---	---	capture	Missense_Mutation	SNP	114188086	114188086	KIAA0368	9	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8093	68
CDK5RAP2	55755	broad.mit.edu	37	9	123156840	123156840	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:123156840A>C	uc004bkf.2	-	36	5709	c.5528T>G	c.(5527-5529)ATG>AGG	p.M1843R	CDK5RAP2_uc010mvi.2_Missense_Mutation_p.M852R|CDK5RAP2_uc004bke.2_Missense_Mutation_p.M1128R|CDK5RAP2_uc004bkg.2_Missense_Mutation_p.M1764R|CDK5RAP2_uc011lxw.1_Missense_Mutation_p.M1108R|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_Missense_Mutation_p.M1108R|CDK5RAP2_uc011lya.1_Missense_Mutation_p.M1108R|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.M1613R	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1843	Interaction with PCNT and AKAP9.				brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						CAAAAGCTTCATGGTGTTTTG	0.423													53	73	---	---	---	---	capture	Missense_Mutation	SNP	123156840	123156840	CDK5RAP2	9	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	3116	68
OR1J1	347168	broad.mit.edu	37	9	125239745	125239745	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125239745G>A	uc011lyu.1	-	1	461	c.461C>T	c.(460-462)GCG>GTG	p.A154V	OR1J2_uc004bmj.1_Intron	NM_001004451	NP_001004451	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J,	154	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						AAGAGCACACGCACAAGCGAT	0.542													27	39	---	---	---	---	capture	Missense_Mutation	SNP	125239745	125239745	OR1J1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10863	68
PCDH11Y	83259	broad.mit.edu	37	Y	5605524	5605524	+	Silent	SNP	C	A	A			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:5605524C>A	uc004fqo.2	+	5	4298	c.3564C>A	c.(3562-3564)CTC>CTA	p.L1188L		NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	1188	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						CCATTGTTCTCTGCCACAGCC	0.582													119	10	---	---	---	---	capture	Silent	SNP	5605524	5605524	PCDH11Y	24	C	A	A	A	1	0	0	0	0	0	0	0	1	405	32	4	4	11412	68
EIF3J	8669	broad.mit.edu	37	15	44829531	44829532	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44829531_44829532insT	uc001ztv.2	+	2	180_181	c.53_54insT	c.(52-54)GCTfs	p.A18fs	uc001ztu.2_5'Flank|EIF3J_uc010ueg.1_Frame_Shift_Ins_p.A18fs|EIF3J_uc001ztw.2_Frame_Shift_Ins_p.A18fs	NM_003758	NP_003749	O75822	EIF3J_HUMAN	eukaryotic translation initiation factor 3,	18	Sufficient for interaction with EIF3B.					cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity				0		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		GACGCCGACGCTTTCTCCGTGG	0.594													3	6	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	44829531	44829532	EIF3J	15	-	T	T	T	1	0	1	1	0	0	0	0	0	364	28	5	5	4975	68
GNPDA1	10007	broad.mit.edu	37	5	141385836	141385838	+	In_Frame_Del	DEL	GAA	-	-			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141385836_141385838delGAA	uc003lmf.3	-	3	1039_1041	c.280_282delTTC	c.(280-282)TTCdel	p.F94del	GNPDA1_uc003lmg.3_In_Frame_Del_p.F94del|GNPDA1_uc010jgh.2_In_Frame_Del_p.F94del|GNPDA1_uc003lmh.3_In_Frame_Del_p.F60del	NM_005471	NP_005462	P46926	GNPI1_HUMAN	glucosamine-6-phosphate deaminase 1	94					generation of precursor metabolites and energy|glucosamine catabolic process|N-acetylglucosamine metabolic process|single fertilization	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity				0		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAATGTGCTTGAAGAAGTTGTTC	0.527													59	108	---	---	---	---	capture_indel	In_Frame_Del	DEL	141385836	141385838	GNPDA1	5	GAA	-	-	-	1	0	1	0	1	0	0	0	0	581	45	5	5	6478	68
CPEB4	80315	broad.mit.edu	37	5	173317554	173317554	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:173317554delA	uc003mcs.3	+	1	2224	c.818delA	c.(817-819)CATfs	p.H273fs	CPEB4_uc010jju.1_Frame_Shift_Del_p.H273fs|CPEB4_uc010jjv.2_Frame_Shift_Del_p.H273fs|CPEB4_uc011dfg.1_Frame_Shift_Del_p.H273fs|CPEB4_uc003mct.3_5'Flank|CPEB4_uc003mcu.3_5'Flank	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	273							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAGCTGCCTCATTTGGCGAAT	0.557													69	376	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	173317554	173317554	CPEB4	5	A	-	-	-	1	0	1	0	1	0	0	0	0	104	8	5	5	3768	68
ARFGEF1	10565	broad.mit.edu	37	8	68140324	68140327	+	Frame_Shift_Del	DEL	TAAT	-	-			TCGA-06-0747-01	TCGA-06-0747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:68140324_68140327delTAAT	uc003xxo.1	-	25	3852_3855	c.3462_3465delATTA	c.(3460-3465)GAATTAfs	p.E1154fs	ARFGEF1_uc003xxl.1_Frame_Shift_Del_p.E608fs|ARFGEF1_uc003xxn.1_Frame_Shift_Del_p.E137fs	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	1154_1155					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCGTGGAAAGTAATTCATCCATAG	0.343													24	46	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	68140324	68140327	ARFGEF1	8	TAAT	-	-	-	1	0	1	0	1	0	0	0	0	738	57	5	5	845	68
