Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ARHGEF10L	55160	broad.mit.edu	37	1	17990973	17990973	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17990973C>T	uc001ban.2	+	26	3051	c.2892C>T	c.(2890-2892)CCC>CCT	p.P964P	ARHGEF10L_uc009vpe.1_Silent_p.P925P|ARHGEF10L_uc001bao.2_Silent_p.P925P|ARHGEF10L_uc001bap.2_Silent_p.P920P|ARHGEF10L_uc001baq.2_Silent_p.P725P|ARHGEF10L_uc010ocs.1_Silent_p.P737P|ARHGEF10L_uc001bar.2_Silent_p.P667P|ARHGEF10L_uc009vpf.2_RNA	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	964					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		AGAGCCCTCCCGTGTGCCTGA	0.692													8	24	---	---	---	---	capture	Silent	SNP	17990973	17990973	ARHGEF10L	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	888	69
NBPF10	100132406	broad.mit.edu	37	1	145311839	145311839	+	Missense_Mutation	SNP	A	T	T	rs58277049		TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145311839A>T	uc001end.3	+	14	1942	c.1907A>T	c.(1906-1908)CAG>CTG	p.Q636L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_5'UTR|NBPF10_uc010oyl.1_5'UTR|NBPF10_uc010oyj.1_5'UTR	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAGGACTCACAGGATAGATGT	0.473													3	53	---	---	---	---	capture	Missense_Mutation	SNP	145311839	145311839	NBPF10	1	A	T	T	T	1	0	0	0	0	1	0	0	0	79	7	4	4	10100	69
FLG	2312	broad.mit.edu	37	1	152276886	152276886	+	Silent	SNP	G	A	A	rs144901359		TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152276886G>A	uc001ezu.1	-	3	10512	c.10476C>T	c.(10474-10476)GAC>GAT	p.D3492D		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3492	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	p.D3492Y(1)		ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGATTGTTCGTCATTACGAG	0.567									Ichthyosis				148	364	---	---	---	---	capture	Silent	SNP	152276886	152276886	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5867	69
LCE2C	353140	broad.mit.edu	37	1	152648777	152648777	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152648777C>A	uc001fah.2	+	2	341	c.286C>A	c.(286-288)CCT>ACT	p.P96T		NM_178429	NP_848516	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	96	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGAGTGAACCTTCTGGGGG	0.662													27	88	---	---	---	---	capture	Missense_Mutation	SNP	152648777	152648777	LCE2C	1	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	8587	69
NUP210L	91181	broad.mit.edu	37	1	154062058	154062058	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154062058G>A	uc001fdw.2	-	16	2272	c.2200C>T	c.(2200-2202)CGA>TGA	p.R734*	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Nonsense_Mutation_p.R734*	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	734						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TTTCCAATTCGGAATGTGAGA	0.423													52	95	---	---	---	---	capture	Nonsense_Mutation	SNP	154062058	154062058	NUP210L	1	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	10668	69
ARHGAP30	257106	broad.mit.edu	37	1	161023102	161023102	+	Missense_Mutation	SNP	C	T	T	rs149577194		TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161023102C>T	uc001fxl.2	-	6	956	c.610G>A	c.(610-612)GTG>ATG	p.V204M	ARHGAP30_uc001fxk.2_Missense_Mutation_p.V204M|ARHGAP30_uc001fxm.2_Missense_Mutation_p.V50M|ARHGAP30_uc009wtx.2_Translation_Start_Site|ARHGAP30_uc001fxn.1_Missense_Mutation_p.V50M	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	204	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			ATGAACTCCACGACGATGGAT	0.562													28	49	---	---	---	---	capture	Missense_Mutation	SNP	161023102	161023102	ARHGAP30	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	872	69
NLRP3	114548	broad.mit.edu	37	1	247607348	247607348	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247607348C>T	uc001icr.2	+	9	2882	c.2744C>T	c.(2743-2745)ACG>ATG	p.T915M	NLRP3_uc001ics.2_Missense_Mutation_p.T858M|NLRP3_uc001icu.2_Missense_Mutation_p.T915M|NLRP3_uc001icw.2_Missense_Mutation_p.T858M|NLRP3_uc001icv.2_Missense_Mutation_p.T801M|NLRP3_uc010pyw.1_Missense_Mutation_p.T893M	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	915	LRR 7.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CAGAATCTCACGCACCTTTAC	0.512													12	63	---	---	---	---	capture	Missense_Mutation	SNP	247607348	247607348	NLRP3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10385	69
OR8K3	219473	broad.mit.edu	37	11	56086620	56086620	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56086620G>T	uc010rjf.1	+	1	838	c.838G>T	c.(838-840)GTT>TTT	p.V280F		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					TTACACCCTGGTTATCCCCAT	0.378													21	68	---	---	---	---	capture	Missense_Mutation	SNP	56086620	56086620	OR8K3	11	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11148	69
OR10W1	81341	broad.mit.edu	37	11	58034677	58034677	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58034677C>A	uc001nmq.1	-	1	1056	c.654G>T	c.(652-654)AAG>AAT	p.K218N		NM_207374	NP_997257	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W,	218	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)				CCGAGTGGATCTTGAGCAGAG	0.572													13	24	---	---	---	---	capture	Missense_Mutation	SNP	58034677	58034677	OR10W1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	10825	69
OR4D5	219875	broad.mit.edu	37	11	123811000	123811000	+	Missense_Mutation	SNP	G	A	A	rs142766960		TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123811000G>A	uc001pzk.1	+	1	677	c.677G>A	c.(676-678)CGA>CAA	p.R226Q		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	226	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GTCATGCTCCGAAGCCACTCA	0.507													94	214	---	---	---	---	capture	Missense_Mutation	SNP	123811000	123811000	OR4D5	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10961	69
LRIG3	121227	broad.mit.edu	37	12	59272793	59272793	+	Silent	SNP	G	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:59272793G>T	uc001sqr.2	-	14	2142	c.1896C>A	c.(1894-1896)CCC>CCA	p.P632P	LRIG3_uc009zqh.2_Silent_p.P572P|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	632	Ig-like C2-type 2.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			AGGCTATCTGGGGGGCTGGGT	0.597													34	95	---	---	---	---	capture	Silent	SNP	59272793	59272793	LRIG3	12	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	8862	69
NAV3	89795	broad.mit.edu	37	12	78582438	78582438	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:78582438A>C	uc001syp.2	+	33	6109	c.5936A>C	c.(5935-5937)GAC>GCC	p.D1979A	NAV3_uc001syo.2_Missense_Mutation_p.D1957A|NAV3_uc010sub.1_Missense_Mutation_p.D1436A|NAV3_uc009zsf.2_Missense_Mutation_p.D788A	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1979						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CTGAGCTCTGACTGCATTGCT	0.388										HNSCC(70;0.22)			5	160	---	---	---	---	capture	Missense_Mutation	SNP	78582438	78582438	NAV3	12	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	10092	69
PLEKHG7	440107	broad.mit.edu	37	12	93148040	93148040	+	Missense_Mutation	SNP	C	T	T	rs115752910	by1000genomes	TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:93148040C>T	uc001tcj.2	+	6	720	c.490C>T	c.(490-492)CGG>TGG	p.R164W		NM_001004330	NP_001004330	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G	164	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1						AAAGTCCATCCGTAAGTCCCT	0.438													18	43	---	---	---	---	capture	Missense_Mutation	SNP	93148040	93148040	PLEKHG7	12	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	11978	69
STAB2	55576	broad.mit.edu	37	12	104014256	104014256	+	Silent	SNP	T	G	G			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104014256T>G	uc001tjw.2	+	4	528	c.342T>G	c.(340-342)GGT>GGG	p.G114G		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	114	Extracellular (Potential).|EGF-like 1.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						AGTGCCCAGGTGGAGCGGGGT	0.493													5	20	---	---	---	---	capture	Silent	SNP	104014256	104014256	STAB2	12	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	15128	69
GPR133	283383	broad.mit.edu	37	12	131622720	131622720	+	Silent	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:131622720G>A	uc001uit.3	+	24	3034	c.2475G>A	c.(2473-2475)TCG>TCA	p.S825S	GPR133_uc010tbm.1_Silent_p.S857S|GPR133_uc009zyo.2_Silent_p.S107S|GPR133_uc009zyp.2_RNA	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	825	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		AGGTCTGGTCGCTCACGAGCA	0.597													8	54	---	---	---	---	capture	Silent	SNP	131622720	131622720	GPR133	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6577	69
FUT8	2530	broad.mit.edu	37	14	66028372	66028372	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:66028372C>T	uc001xin.2	+	3	1288	c.91C>T	c.(91-93)CGA>TGA	p.R31*	FUT8_uc001xio.2_Nonsense_Mutation_p.R31*|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_RNA|FUT8_uc001xip.2_Nonsense_Mutation_p.R31*|FUT8_uc001xiq.2_Intron	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a	31	Lumenal (Potential).				in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		TCACTTGGTACGAGATAATGA	0.458													40	99	---	---	---	---	capture	Nonsense_Mutation	SNP	66028372	66028372	FUT8	14	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	6052	69
AK7	122481	broad.mit.edu	37	14	96917806	96917806	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96917806T>C	uc001yfn.2	+	10	1041	c.997T>C	c.(997-999)TTT>CTT	p.F333L		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	333	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		GGAAGCGCTCTTTGTGAAGGA	0.368													27	64	---	---	---	---	capture	Missense_Mutation	SNP	96917806	96917806	AK7	14	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	444	69
CREBBP	1387	broad.mit.edu	37	16	3842056	3842056	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3842056C>T	uc002cvv.2	-	5	1460	c.1256G>A	c.(1255-1257)TGG>TAG	p.W419*	CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	419	TAZ-type 1.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCAGTTCTTCCAATGAGAGAT	0.428			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				43	105	---	---	---	---	capture	Nonsense_Mutation	SNP	3842056	3842056	CREBBP	16	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	3826	69
CIITA	4261	broad.mit.edu	37	16	11000852	11000852	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:11000852C>T	uc002dai.3	+	11	1636	c.1503C>T	c.(1501-1503)TTC>TTT	p.F501F	CIITA_uc002daj.3_Silent_p.F502F|CIITA_uc002dak.3_Intron|CIITA_uc002dag.2_Silent_p.F501F|CIITA_uc002dah.2_Silent_p.F453F|CIITA_uc010bup.1_Intron	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	501	NACHT.				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						TAGACGGCTTCGAGGAGCTGG	0.647			T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								5	219	---	---	---	---	capture	Silent	SNP	11000852	11000852	CIITA	16	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	3393	69
PRKCB	5579	broad.mit.edu	37	16	24166139	24166139	+	Silent	SNP	G	A	A	rs141827066		TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24166139G>A	uc002dmd.2	+	10	1397	c.1200G>A	c.(1198-1200)CCG>CCA	p.P400P	PRKCB_uc002dme.2_Silent_p.P400P	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	400	Protein kinase.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding	p.P400P(1)		ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CTGGGAAGCCGCCCTTCCTGA	0.567													8	19	---	---	---	---	capture	Silent	SNP	24166139	24166139	PRKCB	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12404	69
LCMT1	51451	broad.mit.edu	37	16	25143735	25143735	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:25143735G>A	uc002dnx.1	+	3	376	c.218G>A	c.(217-219)CGA>CAA	p.R73Q	LCMT1_uc002dny.1_Missense_Mutation_p.R73Q|LCMT1_uc002dnz.1_5'UTR|LCMT1_uc002doa.1_5'UTR	NM_016309	NP_057393	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1 isoform a	73		S-adenosyl-L-methionine.					protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	TATTTTGCTCGAGTCCATGGT	0.488													26	31	---	---	---	---	capture	Missense_Mutation	SNP	25143735	25143735	LCMT1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8598	69
MYH2	4620	broad.mit.edu	37	17	10427836	10427836	+	Missense_Mutation	SNP	C	T	T	rs147813930		TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10427836C>T	uc010coi.2	-	35	5250	c.5122G>A	c.(5122-5124)GCA>ACA	p.A1708T	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.A1708T|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1708	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TCCTGTTCTGCGATTTTTCTG	0.547													36	133	---	---	---	---	capture	Missense_Mutation	SNP	10427836	10427836	MYH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9945	69
KRT16	3868	broad.mit.edu	37	17	39767641	39767641	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39767641C>T	uc002hxg.3	-	3	866	c.727G>A	c.(727-729)GGC>AGC	p.G243S	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	243	Coil 1B.|Rod.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				TCCTTCAGGCCTTCGATCTGC	0.642													51	110	---	---	---	---	capture	Missense_Mutation	SNP	39767641	39767641	KRT16	17	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	8373	69
KIF2B	84643	broad.mit.edu	37	17	51900949	51900949	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51900949C>T	uc002iua.2	+	1	711	c.555C>T	c.(553-555)TAC>TAT	p.Y185Y	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	185					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						ACCCCAACTACGAAATCATGC	0.562													38	99	---	---	---	---	capture	Silent	SNP	51900949	51900949	KIF2B	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8220	69
ANKFN1	162282	broad.mit.edu	37	17	54452045	54452045	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:54452045G>A	uc002iun.1	+	7	924	c.889G>A	c.(889-891)GTC>ATC	p.V297I		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	297	Fibronectin type-III.									large_intestine(1)|ovary(1)	2						GCCTCTTAGCGTCAATGCAGC	0.458													28	127	---	---	---	---	capture	Missense_Mutation	SNP	54452045	54452045	ANKFN1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	622	69
CCDC46	201134	broad.mit.edu	37	17	63848135	63848135	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:63848135C>T	uc002jfl.2	-	21	2400	c.2181G>A	c.(2179-2181)GAG>GAA	p.E727E	CCDC46_uc010deo.2_Silent_p.E469E|CCDC46_uc002jfm.2_Silent_p.E727E|CCDC46_uc010dep.2_Silent_p.E685E	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a	727	Potential.					centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			GAACCTGGGCCTCCATGTCGG	0.284													25	64	---	---	---	---	capture	Silent	SNP	63848135	63848135	CCDC46	17	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	2791	69
MC5R	4161	broad.mit.edu	37	18	13826256	13826256	+	Silent	SNP	C	T	T	rs45575841	byFrequency	TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:13826256C>T	uc010xaf.1	+	1	492	c.492C>T	c.(490-492)GCC>GCT	p.A164A		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	164	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						CCATCATCGCCGGCATCTGGG	0.572													13	413	---	---	---	---	capture	Silent	SNP	13826256	13826256	MC5R	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9280	69
LASS4	79603	broad.mit.edu	37	19	8320541	8320541	+	Silent	SNP	C	G	G			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8320541C>G	uc002mjg.2	+	5	662	c.342C>G	c.(340-342)ACC>ACG	p.T114T	LASS4_uc002mjh.2_Silent_p.T63T|LASS4_uc002mji.2_5'UTR|LASS4_uc010dvz.2_Silent_p.T114T	NM_024552	NP_078828	Q9HA82	CERS4_HUMAN	LAG1 homolog, ceramide synthase 4	114	Homeobox.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1						TGCAGCAGACCCAGCGATGGT	0.652													19	50	---	---	---	---	capture	Silent	SNP	8320541	8320541	LASS4	19	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	8561	69
CYP4F2	8529	broad.mit.edu	37	19	15990424	15990424	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15990424G>A	uc002nbs.1	-	11	1354	c.1304C>T	c.(1303-1305)CCG>CTG	p.P435L	CYP4F2_uc010xot.1_Missense_Mutation_p.P286L	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	435					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						CTCAGGGTCCGGCCACACAGC	0.567													37	188	---	---	---	---	capture	Missense_Mutation	SNP	15990424	15990424	CYP4F2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4148	69
TAF1B	9014	broad.mit.edu	37	2	9994457	9994457	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:9994457C>T	uc002qzz.2	+	5	406	c.306C>T	c.(304-306)AAC>AAT	p.N102N	TAF1B_uc010exc.2_Silent_p.N102N|TAF1B_uc002qzy.3_Silent_p.N102N|TAF1B_uc010yja.1_Translation_Start_Site|TAF1B_uc010exd.2_Translation_Start_Site	NM_005680	NP_005671	Q53T94	TAF1B_HUMAN	TBP-associated factor 1B	102					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)|pancreas(1)	3	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CACCTTAGAACGATGTTTTAC	0.408													21	74	---	---	---	---	capture	Silent	SNP	9994457	9994457	TAF1B	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15408	69
OTOF	9381	broad.mit.edu	37	2	26705441	26705441	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26705441T>C	uc002rhk.2	-	14	1539	c.1412A>G	c.(1411-1413)AAG>AGG	p.K471R		NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	471	Cytoplasmic (Potential).|C2 2.				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATAGCTGCTCTTCTGCACTGA	0.448													39	103	---	---	---	---	capture	Missense_Mutation	SNP	26705441	26705441	OTOF	2	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11207	69
BIRC6	57448	broad.mit.edu	37	2	32695356	32695356	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32695356T>A	uc010ezu.2	+	31	6602	c.6468T>A	c.(6466-6468)CAT>CAA	p.H2156Q		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2156					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TACCCATGCATAGGAGGACAG	0.318													3	8	---	---	---	---	capture	Missense_Mutation	SNP	32695356	32695356	BIRC6	2	T	A	A	A	1	0	0	0	0	1	0	0	0	634	49	4	4	1426	69
POTEE	445582	broad.mit.edu	37	2	132021710	132021710	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:132021710C>T	uc002tsn.2	+	15	2734	c.2682C>T	c.(2680-2682)ACC>ACT	p.T894T	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Silent_p.T494T|POTEE_uc002tsl.2_Silent_p.T476T|POTEE_uc010fmy.1_Silent_p.T358T	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	894	Actin-like.						ATP binding				0						AGATCCTCACCGAGCGTGGCT	0.587													48	153	---	---	---	---	capture	Silent	SNP	132021710	132021710	POTEE	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12165	69
MYO1B	4430	broad.mit.edu	37	2	192275792	192275792	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192275792T>C	uc010fsg.2	+	27	3022	c.2767T>C	c.(2767-2769)TGT>CGT	p.C923R	MYO1B_uc002usq.2_Missense_Mutation_p.C865R|MYO1B_uc002usr.2_Missense_Mutation_p.C923R|MYO1B_uc002usu.2_Missense_Mutation_p.C168R|MYO1B_uc002usv.2_Missense_Mutation_p.C39R	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	923						myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			TATCTCACAGTGTAAAAAATA	0.308													37	65	---	---	---	---	capture	Missense_Mutation	SNP	192275792	192275792	MYO1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	9979	69
MATN4	8785	broad.mit.edu	37	20	43929967	43929967	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43929967A>G	uc002xnn.2	-	4	947	c.760T>C	c.(760-762)TGC>CGC	p.C254R	MATN4_uc002xno.2_Intron|MATN4_uc002xnp.2_Intron|MATN4_uc010zwr.1_Missense_Mutation_p.C202R|MATN4_uc002xnr.1_Missense_Mutation_p.C254R	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	295						extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				TCACCCCTGCAGCTCCTCTGG	0.587											OREG0025977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	237	---	---	---	---	capture	Missense_Mutation	SNP	43929967	43929967	MATN4	20	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9249	69
OPRL1	4987	broad.mit.edu	37	20	62724089	62724089	+	Missense_Mutation	SNP	C	T	T	rs148535906		TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62724089C>T	uc002yic.2	+	3	418	c.16C>T	c.(16-18)CCC>TCC	p.P6S	OPRL1_uc002yid.2_Missense_Mutation_p.P6S|OPRL1_uc002yif.3_Missense_Mutation_p.P6S	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	6	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GCCCCTCTTCCCCGCGCCGTT	0.632													24	81	---	---	---	---	capture	Missense_Mutation	SNP	62724089	62724089	OPRL1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10790	69
KCNJ15	3772	broad.mit.edu	37	21	39671533	39671533	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:39671533C>T	uc002ywv.2	+	4	652	c.350C>T	c.(349-351)GCG>GTG	p.A117V	KCNJ15_uc002yww.2_Missense_Mutation_p.A117V|KCNJ15_uc002ywx.2_Missense_Mutation_p.A117V	NM_002243	NP_002234	Q99712	IRK15_HUMAN	potassium inwardly-rectifying channel J15	117					synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						CTCACTGGGGCGTTTCTCTTT	0.493													61	121	---	---	---	---	capture	Missense_Mutation	SNP	39671533	39671533	KCNJ15	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7971	69
UMODL1	89766	broad.mit.edu	37	21	43522316	43522316	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43522316C>A	uc002zaf.1	+	8	1227	c.1227C>A	c.(1225-1227)CAC>CAA	p.H409Q	UMODL1_uc002zad.1_Missense_Mutation_p.H337Q|UMODL1_uc002zae.1_Missense_Mutation_p.H337Q|UMODL1_uc002zag.1_Missense_Mutation_p.H409Q|UMODL1_uc010gow.1_Missense_Mutation_p.H201Q|UMODL1_uc002zai.1_Missense_Mutation_p.H60Q|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_Missense_Mutation_p.H60Q|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Missense_Mutation_p.H154Q|C21orf128_uc002zak.2_3'UTR	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	409	Extracellular (Potential).|SEA 1.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						TTGTAAACCACAACCTGACGG	0.428													21	84	---	---	---	---	capture	Missense_Mutation	SNP	43522316	43522316	UMODL1	21	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	16862	69
FGD5	152273	broad.mit.edu	37	3	14862751	14862751	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14862751T>A	uc003bzc.2	+	1	2283	c.2173T>A	c.(2173-2175)TAT>AAT	p.Y725N	FGD5_uc011avk.1_Missense_Mutation_p.Y725N	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	725					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CCTCATCTTTTATAGAGATGG	0.577													46	95	---	---	---	---	capture	Missense_Mutation	SNP	14862751	14862751	FGD5	3	T	A	A	A	1	0	0	0	0	1	0	0	0	793	61	4	4	5782	69
DAG1	1605	broad.mit.edu	37	3	49568839	49568839	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49568839A>G	uc003cxc.3	+	3	1313	c.895A>G	c.(895-897)ATC>GTC	p.I299V		NM_004393	NP_004384	Q14118	DAG1_HUMAN	dystroglycan 1 preproprotein	299	Required for laminin recognition.				cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GGGTTGGCACATCGCCAATAA	0.597													32	68	---	---	---	---	capture	Missense_Mutation	SNP	49568839	49568839	DAG1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	4184	69
CASR	846	broad.mit.edu	37	3	121980530	121980530	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121980530C>T	uc003eev.3	+	4	1020	c.648C>T	c.(646-648)GAC>GAT	p.D216D	CASR_uc003eew.3_Silent_p.D216D	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	216	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CAGCTGATGACGACTATGGGC	0.537													55	164	---	---	---	---	capture	Silent	SNP	121980530	121980530	CASR	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2658	69
ADCY5	111	broad.mit.edu	37	3	123038564	123038564	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123038564C>T	uc003egh.1	-	10	2213	c.2213G>A	c.(2212-2214)CGC>CAC	p.R738H	ADCY5_uc003egg.1_Missense_Mutation_p.R371H|ADCY5_uc003egi.1_Missense_Mutation_p.R297H	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	738	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		GAGGAACTTGCGGACGTGCTC	0.587													19	70	---	---	---	---	capture	Missense_Mutation	SNP	123038564	123038564	ADCY5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	297	69
PIGZ	80235	broad.mit.edu	37	3	196675037	196675037	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196675037C>T	uc003fxh.2	-	3	878	c.731G>A	c.(730-732)CGT>CAT	p.R244H		NM_025163	NP_079439	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	244					GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		TGTGGCTCCACGAGTGCCCCA	0.637													6	52	---	---	---	---	capture	Missense_Mutation	SNP	196675037	196675037	PIGZ	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11808	69
ZNF718	255403	broad.mit.edu	37	4	155414	155414	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155414C>T	uc003fzt.3	+	8	1072	c.939C>T	c.(937-939)TGC>TGT	p.C313C	ZNF595_uc003fzu.1_Intron|ZNF718_uc010iaz.2_RNA|ZNF718_uc003fzw.3_Missense_Mutation_p.A93V	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN	zinc finger protein 718	313	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		CCTTCTCATGCGAAGAATGTG	0.373													10	37	---	---	---	---	capture	Silent	SNP	155414	155414	ZNF718	4	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	17996	69
RBM47	54502	broad.mit.edu	37	4	40440359	40440359	+	Silent	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440359G>A	uc003gvc.2	-	4	1262	c.552C>T	c.(550-552)TAC>TAT	p.Y184Y	RBM47_uc003gvd.2_Silent_p.Y184Y|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Silent_p.Y146Y|RBM47_uc003gvg.1_Silent_p.Y184Y	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	184	RRM 2.					nucleus	nucleotide binding|RNA binding			breast(3)	3						CCGCGCTGGCGTAGACGATCA	0.647													54	128	---	---	---	---	capture	Silent	SNP	40440359	40440359	RBM47	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13036	69
ALB	213	broad.mit.edu	37	4	74283995	74283995	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74283995T>A	uc003hgs.3	+	12	1692	c.1619T>A	c.(1618-1620)CTT>CAT	p.L540H	ALB_uc003hgw.3_Missense_Mutation_p.L348H|ALB_uc011cbe.1_Missense_Mutation_p.L219H|ALB_uc003hgt.3_Missense_Mutation_p.L540H|ALB_uc010iii.2_Missense_Mutation_p.L425H|ALB_uc003hgu.3_Missense_Mutation_p.L390H|ALB_uc003hgv.3_Missense_Mutation_p.L219H|ALB_uc011cbf.1_Missense_Mutation_p.L430H|ALB_uc010iij.2_RNA|ALB_uc003hgx.3_Missense_Mutation_p.L219H	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein	540	Albumin 3.				bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	ATATGCACACTTTCTGAGAAG	0.403													4	107	---	---	---	---	capture	Missense_Mutation	SNP	74283995	74283995	ALB	4	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	486	69
PPEF2	5470	broad.mit.edu	37	4	76793227	76793227	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76793227C>T	uc003hix.2	-	13	1957	c.1600G>A	c.(1600-1602)GTG>ATG	p.V534M	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.V534M	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	534	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGATACTGCACAATATGTGGG	0.428													31	105	---	---	---	---	capture	Missense_Mutation	SNP	76793227	76793227	PPEF2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12209	69
ADAMTS12	81792	broad.mit.edu	37	5	33596125	33596125	+	Silent	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33596125G>A	uc003jia.1	-	17	2731	c.2568C>T	c.(2566-2568)CGC>CGT	p.R856R	ADAMTS12_uc010iuq.1_Silent_p.R771R	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	856	TSP type-1 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCACCATCCCGCGGCCCTTCT	0.512										HNSCC(64;0.19)			50	118	---	---	---	---	capture	Silent	SNP	33596125	33596125	ADAMTS12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	257	69
PCDHA10	56139	broad.mit.edu	37	5	140237259	140237259	+	Silent	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140237259G>A	uc003lhx.2	+	1	1626	c.1626G>A	c.(1624-1626)CCG>CCA	p.P542P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Silent_p.P542P	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	542	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGCGTGCCGCCTCTGGGCA	0.697													39	129	---	---	---	---	capture	Silent	SNP	140237259	140237259	PCDHA10	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11423	69
RIPK1	8737	broad.mit.edu	37	6	3104537	3104537	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:3104537C>T	uc010jni.2	+	8	1226	c.994C>T	c.(994-996)CGG>TGG	p.R332W	RIPK1_uc003muv.3_Missense_Mutation_p.R169W|RIPK1_uc003muw.3_Missense_Mutation_p.R267W|RIPK1_uc011dhs.1_Missense_Mutation_p.R286W|RIPK1_uc003mux.2_Missense_Mutation_p.R332W	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine	332	Interaction with SQSTM1.				activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				ACCTTCAAGCCGGTCAAATTC	0.348													24	57	---	---	---	---	capture	Missense_Mutation	SNP	3104537	3104537	RIPK1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	13272	69
OR2H1	26716	broad.mit.edu	37	6	29430405	29430405	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29430405G>A	uc003nmi.2	+	3	1302	c.859G>A	c.(859-861)GTA>ATA	p.V287I	OR2H1_uc003nmj.1_Missense_Mutation_p.V287I|OR2H1_uc010jri.1_Missense_Mutation_p.V209I	NM_030883	NP_112145	Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H,	287	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TAACCCTCTCGTATACACCCT	0.493													38	63	---	---	---	---	capture	Missense_Mutation	SNP	29430405	29430405	OR2H1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10905	69
GABBR1	2550	broad.mit.edu	37	6	29599228	29599228	+	Silent	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29599228G>A	uc003nmt.3	-	3	570	c.234C>T	c.(232-234)GTC>GTT	p.V78V	GABBR1_uc003nmu.3_Silent_p.V78V|GABBR1_uc011dlr.1_5'UTR|GABBR1_uc011dls.1_Silent_p.V78V	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1	78	Sushi 1.|Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	GGCACTTGCGGACCTTGGGCC	0.602													32	121	---	---	---	---	capture	Silent	SNP	29599228	29599228	GABBR1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	6097	69
TNRC18	84629	broad.mit.edu	37	7	5417608	5417608	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5417608G>A	uc003soi.3	-	6	2549	c.2200C>T	c.(2200-2202)CGG>TGG	p.R734W		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	734							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CGTTCCTCCCGGTGTCTGGCC	0.682													11	60	---	---	---	---	capture	Missense_Mutation	SNP	5417608	5417608	TNRC18	7	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16222	69
RAMP3	10268	broad.mit.edu	37	7	45216987	45216987	+	Silent	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45216987C>T	uc003tnb.2	+	2	199	c.138C>T	c.(136-138)GAC>GAT	p.D46D	RAMP3_uc003tnc.2_Silent_p.D14D	NM_005856	NP_005847	O60896	RAMP3_HUMAN	receptor activity modifying protein 3 precursor	46	Extracellular (Potential).				intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane|lysosome	protein transporter activity				0					Pramlintide(DB01278)	CTTTCGCAGACATGATGGGCA	0.607													16	112	---	---	---	---	capture	Silent	SNP	45216987	45216987	RAMP3	7	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	12918	69
EGFR	1956	broad.mit.edu	37	7	55221821	55221821	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221821G>A	uc003tqk.2	+	7	1111	c.865G>A	c.(865-867)GCC>ACC	p.A289T	EGFR_uc003tqh.2_Missense_Mutation_p.A289T|EGFR_uc003tqi.2_Missense_Mutation_p.A289T|EGFR_uc003tqj.2_Missense_Mutation_p.A289T|EGFR_uc010kzg.1_Missense_Mutation_p.A244T|EGFR_uc011kco.1_Missense_Mutation_p.A236T|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289T(3)|p.A289D(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGCTTTGGTGCCACCTGCGT	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			38	117	---	---	---	---	capture	Missense_Mutation	SNP	55221821	55221821	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	69
EGFR	1956	broad.mit.edu	37	7	55249022	55249022	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55249022G>A	uc003tqk.2	+	20	2566	c.2320G>A	c.(2320-2322)GTG>ATG	p.V774M	EGFR_uc010kzg.1_Missense_Mutation_p.V729M|EGFR_uc011kco.1_Missense_Mutation_p.V721M|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	774	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.H773_V774insNPH(12)|p.V774_C775insHV(4)|p.H773_V774insPH(3)|p.H773_V774insH(3)|p.V774M(3)|p.H773_V774insGH(1)|p.H773_V774insG(1)|p.H773_V774>LM(1)|p.V774L(1)|p.H773_V774insGNPH(1)|p.V774del(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAACCCCCACGTGTGCCGCCT	0.632		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			31	216	---	---	---	---	capture	Missense_Mutation	SNP	55249022	55249022	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4922	69
BAIAP2L1	55971	broad.mit.edu	37	7	97935824	97935824	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97935824C>G	uc003upj.2	-	11	1431	c.1168G>C	c.(1168-1170)GGT>CGT	p.G390R	uc003upk.1_5'Flank	NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	390	SH3.				filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			GGGAACCAACCCCTCCTACCG	0.572													3	151	---	---	---	---	capture	Missense_Mutation	SNP	97935824	97935824	BAIAP2L1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	1291	69
MCM7	4176	broad.mit.edu	37	7	99694927	99694927	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99694927G>A	uc003usw.1	-	10	1708	c.1198C>T	c.(1198-1200)CGC>TGC	p.R400C	MCM7_uc003usv.1_Missense_Mutation_p.R224C|MCM7_uc003usx.1_Missense_Mutation_p.R224C	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	400	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	TACTTACTGCGAGGCGCCAGT	0.473													27	81	---	---	---	---	capture	Missense_Mutation	SNP	99694927	99694927	MCM7	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9305	69
ASZ1	136991	broad.mit.edu	37	7	117020042	117020042	+	Silent	SNP	T	C	C			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117020042T>C	uc003vjb.2	-	10	1068	c.1005A>G	c.(1003-1005)GTA>GTG	p.V335V	ASZ1_uc011kno.1_Silent_p.V335V|ASZ1_uc011knp.1_Silent_p.V127V	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper	335					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GTATCTCTTCTACCTGTAGTT	0.308													9	78	---	---	---	---	capture	Silent	SNP	117020042	117020042	ASZ1	7	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	1060	69
HIPK2	28996	broad.mit.edu	37	7	139416214	139416214	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139416214C>T	uc003vvf.3	-	2	794	c.620G>A	c.(619-621)CGA>CAA	p.R207Q	HIPK2_uc003vvd.3_Missense_Mutation_p.R207Q	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	207	ATP (Probable).|Protein kinase.|Transcriptional corepression (By similarity).|Interaction with DAXX.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					AAACGTCCCTCGGCCCAAGAA	0.552													8	156	---	---	---	---	capture	Missense_Mutation	SNP	139416214	139416214	HIPK2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7042	69
CLCN1	1180	broad.mit.edu	37	7	143048733	143048733	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143048733G>A	uc003wcr.1	+	23	2729	c.2642G>A	c.(2641-2643)CGC>CAC	p.R881H	CLCN1_uc011ktc.1_Missense_Mutation_p.R493H	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	881	Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					GTGCAGCTCCGCCCTCCCCTT	0.483													30	90	---	---	---	---	capture	Missense_Mutation	SNP	143048733	143048733	CLCN1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3427	69
KCNB2	9312	broad.mit.edu	37	8	73848914	73848914	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73848914C>T	uc003xzb.2	+	3	1912	c.1324C>T	c.(1324-1326)CGG>TGG	p.R442W		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	442	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			GGCTCTTGAGCGGGCCAAAAG	0.443													49	118	---	---	---	---	capture	Missense_Mutation	SNP	73848914	73848914	KCNB2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	7935	69
KIFC2	90990	broad.mit.edu	37	8	145693119	145693119	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145693119T>C	uc003zcz.2	+	6	703	c.638T>C	c.(637-639)CTG>CCG	p.L213P	CYHR1_uc003zcv.2_5'Flank|CYHR1_uc003zcw.2_5'Flank|CYHR1_uc003zcx.2_5'Flank|CYHR1_uc003zcy.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	213	Potential.|Gln-rich.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AAGCAGCAGCTGGAACAGCAG	0.642											OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	75	---	---	---	---	capture	Missense_Mutation	SNP	145693119	145693119	KIFC2	8	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	8235	69
BNC2	54796	broad.mit.edu	37	9	16419304	16419304	+	Missense_Mutation	SNP	C	T	T	rs143124811	byFrequency	TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:16419304C>T	uc003zml.2	-	7	3123	c.2983G>A	c.(2983-2985)GGG>AGG	p.G995R	BNC2_uc011lmw.1_Missense_Mutation_p.G900R|BNC2_uc003zmm.2_3'UTR|BNC2_uc011lmv.1_3'UTR|BNC2_uc003zmj.2_3'UTR|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Missense_Mutation_p.G782R	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	995					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		TCACTCGCCCCGTCAATGTCA	0.592													26	78	---	---	---	---	capture	Missense_Mutation	SNP	16419304	16419304	BNC2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1463	69
TAF1L	138474	broad.mit.edu	37	9	32631824	32631824	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32631824G>A	uc003zrg.1	-	1	3844	c.3754C>T	c.(3754-3756)CGG>TGG	p.R1252W	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1252					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CGCTTAAGCCGCCTCAGTTGC	0.448													85	61	---	---	---	---	capture	Missense_Mutation	SNP	32631824	32631824	TAF1L	9	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	15411	69
RPL22	6146	broad.mit.edu	37	1	6257784	6257785	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6257784_6257785insT	uc001amd.2	-	2	90_91	c.44_45insA	c.(43-45)AAGfs	p.K15fs	RPL22_uc001ame.2_Frame_Shift_Ins_p.K15fs	NM_000983	NP_000974	P35268	RL22_HUMAN	ribosomal protein L22 proprotein	15					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	heparin binding|RNA binding|structural constituent of ribosome				0	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GAACTTGCTTCTTTTTTTTGCC	0.401			T	RUNX1	AML|CML								14	38	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	6257784	6257785	RPL22	1	-	T	T	T	1	0	1	1	0	0	0	0	0	415	32	5	5	13460	69
PTEN	5728	broad.mit.edu	37	10	89720738	89720738	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720738delG	uc001kfb.2	+	9	1920	c.889delG	c.(889-891)GATfs	p.D297fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	297	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.W274_F341del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAGTCTATGTGATCAAGAAAT	0.318		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			45	52	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89720738	89720738	PTEN	10	G	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	12633	69
ERCC5	2073	broad.mit.edu	37	13	103474461	103474462	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:103474461_103474462insA	uc001vpu.1	+	5	975_976	c.853_854insA	c.(853-855)TATfs	p.Y285fs	BIVM_uc001vps.2_Frame_Shift_Ins_p.Y285fs|BIVM_uc010agc.2_Frame_Shift_Ins_p.Y56fs|BIVM_uc001vpv.2_Frame_Shift_Ins_p.Y56fs	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	Error:Variant_position_missing_in_P28715_after_alignment					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AGGATGCTCTTATGTTCTATAT	0.297			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				37	92	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	103474461	103474462	ERCC5	13	-	A	A	A	1	0	1	1	0	0	0	0	0	793	61	5	5	5171	69
TET3	200424	broad.mit.edu	37	2	74275488	74275489	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74275488_74275489delAC	uc002skb.3	+	1	2039_2040	c.2039_2040delAC	c.(2038-2040)GACfs	p.D680fs	TET3_uc010fez.1_Frame_Shift_Del_p.D680fs	NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	680							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AGTCTGCTGGACACACCTGCCA	0.604													7	44	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	74275488	74275489	TET3	2	AC	-	-	-	1	0	1	0	1	0	0	0	0	130	10	5	5	15656	69
PCDHB5	26167	broad.mit.edu	37	5	140517047	140517052	+	In_Frame_Del	DEL	GGCCCA	-	-			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140517047_140517052delGGCCCA	uc003liq.2	+	1	2248_2253	c.2031_2036delGGCCCA	c.(2029-2037)CCGGCCCAG>CCG	p.AQ680del		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	680_681	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCGGCCCCGGCCCAGGCCCAGGCC	0.694													30	230	---	---	---	---	capture_indel	In_Frame_Del	DEL	140517047	140517052	PCDHB5	5	GGCCCA	-	-	-	1	0	1	0	1	0	0	0	0	496	39	5	5	11448	69
PCLO	27445	broad.mit.edu	37	7	82582186	82582186	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82582186delA	uc003uhx.2	-	5	8372	c.8083delT	c.(8083-8085)TCCfs	p.S2695fs	PCLO_uc003uhv.2_Frame_Shift_Del_p.S2695fs|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2626					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						ATTGTTATGGAAATGCTGCTG	0.413													23	66	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	82582186	82582186	PCLO	7	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	11486	69
STAG2	10735	broad.mit.edu	37	X	123205046	123205047	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-06-0749-01	TCGA-06-0749-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123205046_123205047delTA	uc004etz.3	+	24	2745_2746	c.2406_2407delTA	c.(2404-2409)ATTATGfs	p.I802fs	STAG2_uc004eua.2_Frame_Shift_Del_p.I802fs|STAG2_uc004eub.2_Frame_Shift_Del_p.I802fs|STAG2_uc004euc.2_Frame_Shift_Del_p.I802fs|STAG2_uc004eud.2_Frame_Shift_Del_p.I802fs|STAG2_uc004eue.2_Frame_Shift_Del_p.I802fs	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	802_803					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						GCCATCAGATTATGTCAGGAGG	0.376													116	77	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	123205046	123205047	STAG2	23	TA	-	-	-	1	0	1	0	1	0	0	0	0	783	61	5	5	15133	69
