Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SCNN1D	6339	broad.mit.edu	37	1	1222331	1222331	+	Silent	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1222331C>T	uc001adu.1	+	7	1227	c.603C>T	c.(601-603)AGC>AGT	p.S201S	SCNN1D_uc001adt.1_Silent_p.S365S|SCNN1D_uc001adw.2_Silent_p.S267S|SCNN1D_uc001adx.2_5'UTR|SCNN1D_uc001adv.2_Silent_p.S201S	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		ACTCGGGCAGCCGGGTCAGAG	0.697													33	34	---	---	---	---	capture	Silent	SNP	1222331	1222331	SCNN1D	1	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	13822	70
SYDE2	84144	broad.mit.edu	37	1	85656020	85656020	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85656020C>A	uc009wcm.2	-	2	1210	c.1161G>T	c.(1159-1161)TTG>TTT	p.L387F	SYDE2_uc001dku.3_Missense_Mutation_p.L387F	NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	387					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		CACCAAAACTCAAGGCACTTG	0.448													9	74	---	---	---	---	capture	Missense_Mutation	SNP	85656020	85656020	SYDE2	1	C	A	A	A	1	0	0	0	0	1	0	0	0	376	29	4	4	15324	70
FLG	2312	broad.mit.edu	37	1	152281389	152281389	+	Silent	SNP	C	T	T	rs138652718	byFrequency	TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152281389C>T	uc001ezu.1	-	3	6009	c.5973G>A	c.(5971-5973)GCG>GCA	p.A1991A		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1991	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGGGATGACGCAGCCTGTC	0.572									Ichthyosis				204	689	---	---	---	---	capture	Silent	SNP	152281389	152281389	FLG	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5867	70
KLHL20	27252	broad.mit.edu	37	1	173744944	173744944	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173744944G>T	uc001gjc.2	+	10	1780	c.1601G>T	c.(1600-1602)TGG>TTG	p.W534L	KLHL20_uc010pmr.1_Missense_Mutation_p.W345L|KLHL20_uc009wwf.2_Missense_Mutation_p.W516L	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20	534	Kelch 5.				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						ACCAACCAGTGGTCTCCAGTG	0.378													44	102	---	---	---	---	capture	Missense_Mutation	SNP	173744944	173744944	KLHL20	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	8295	70
PHLDA2	7262	broad.mit.edu	37	11	2950491	2950491	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2950491C>T	uc001lxa.1	-	1	160	c.104G>A	c.(103-105)CGC>CAC	p.R35H		NM_003311	NP_003302	Q53GA4	PHLA2_HUMAN	pleckstrin homology-like domain family A member	35	PH.				apoptosis	cytoplasm|membrane					0		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGGCTCAGGCGGTCGGAGGT	0.667													17	33	---	---	---	---	capture	Missense_Mutation	SNP	2950491	2950491	PHLDA2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11752	70
OR52J3	119679	broad.mit.edu	37	11	5068409	5068409	+	Silent	SNP	G	A	A	rs148600962		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5068409G>A	uc010qyv.1	+	1	654	c.654G>A	c.(652-654)TCG>TCA	p.S218S		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	218	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGGCATCTCGTATGTTTACA	0.448													104	202	---	---	---	---	capture	Silent	SNP	5068409	5068409	OR52J3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11026	70
OR5P2	120065	broad.mit.edu	37	11	7818191	7818191	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7818191G>A	uc001mfp.1	-	1	299	c.299C>T	c.(298-300)GCG>GTG	p.A100V		NM_153444	NP_703145	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P,	100	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAAGAAAGCCGCTGAACCAAG	0.483													74	132	---	---	---	---	capture	Missense_Mutation	SNP	7818191	7818191	OR5P2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11082	70
OR5W2	390148	broad.mit.edu	37	11	55681318	55681318	+	Silent	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55681318C>T	uc010rir.1	-	1	741	c.741G>A	c.(739-741)GCG>GCA	p.A247A		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	247	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AAATTGCAACCGCAGATAAGT	0.403													21	67	---	---	---	---	capture	Silent	SNP	55681318	55681318	OR5W2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11089	70
OR5T2	219464	broad.mit.edu	37	11	55999905	55999905	+	Missense_Mutation	SNP	C	T	T	rs146086539		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55999905C>T	uc010rjc.1	-	1	757	c.757G>A	c.(757-759)GTT>ATT	p.V253I		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	253	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GAGATCAGAACAATCAGGATA	0.448													6	223	---	---	---	---	capture	Missense_Mutation	SNP	55999905	55999905	OR5T2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	11086	70
PDE2A	5138	broad.mit.edu	37	11	72293532	72293532	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72293532A>G	uc010rrc.1	-	21	2050	c.1807T>C	c.(1807-1809)TTC>CTC	p.F603L	PDE2A_uc001oso.2_Missense_Mutation_p.F582L|PDE2A_uc010rra.1_Missense_Mutation_p.F596L|PDE2A_uc001osn.2_Missense_Mutation_p.F347L|PDE2A_uc010rrb.1_Missense_Mutation_p.F594L|PDE2A_uc010rrd.1_Missense_Mutation_p.F488L	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1	603					platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	GTATAGGTGAAACTTGCAAAA	0.537													27	54	---	---	---	---	capture	Missense_Mutation	SNP	72293532	72293532	PDE2A	11	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	11539	70
OR8B4	283162	broad.mit.edu	37	11	124294255	124294255	+	Silent	SNP	G	A	A	rs146995996	byFrequency	TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124294255G>A	uc010sak.1	-	1	513	c.513C>T	c.(511-513)AAC>AAT	p.N171N		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	171	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GGTCAATGACGTTGGAATCAC	0.512													26	33	---	---	---	---	capture	Silent	SNP	124294255	124294255	OR8B4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11133	70
SRPR	6734	broad.mit.edu	37	11	126134309	126134309	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:126134309C>A	uc001qdh.2	-	12	1702	c.1651G>T	c.(1651-1653)GGA>TGA	p.G551*	SRPR_uc010sbm.1_Nonsense_Mutation_p.G523*	NM_003139	NP_003130	P08240	SRPR_HUMAN	signal recognition particle receptor	551					SRP-dependent cotranslational protein targeting to membrane	integral to membrane|signal recognition particle receptor complex	GTP binding|GTPase activity|receptor activity|signal recognition particle binding				0	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		AAGGCTTCTCCTACAAACAGC	0.517													37	70	---	---	---	---	capture	Nonsense_Mutation	SNP	126134309	126134309	SRPR	11	C	A	A	A	1	0	0	0	0	0	1	0	0	312	24	5	4	15054	70
ZFC3H1	196441	broad.mit.edu	37	12	72057129	72057129	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:72057129G>A	uc001swo.2	-	1	621	c.262C>T	c.(262-264)CGC>TGC	p.R88C	ZFC3H1_uc010sts.1_Missense_Mutation_p.R88C|ZFC3H1_uc001swp.2_Missense_Mutation_p.R88C|THAP2_uc001swq.2_5'Flank	NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	88	Ser-rich.				RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						TGCCGCGAGCGTGAGAAATTC	0.652											OREG0021993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	85	132	---	---	---	---	capture	Missense_Mutation	SNP	72057129	72057129	ZFC3H1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17513	70
NR1H4	9971	broad.mit.edu	37	12	100904745	100904745	+	Missense_Mutation	SNP	G	A	A	rs113431969		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100904745G>A	uc001tht.1	+	2	327	c.299G>A	c.(298-300)CGT>CAT	p.R100H	NR1H4_uc001thp.1_Missense_Mutation_p.R90H|NR1H4_uc001thq.1_Missense_Mutation_p.R90H|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.R90H|NR1H4_uc010svk.1_Missense_Mutation_p.R90H|NR1H4_uc001ths.1_Missense_Mutation_p.R100H	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	100					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						GAACTCAGGCGTATGCCAGCT	0.522													55	93	---	---	---	---	capture	Missense_Mutation	SNP	100904745	100904745	NR1H4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10526	70
GABRA5	2558	broad.mit.edu	37	15	27114460	27114460	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:27114460T>C	uc001zbd.1	+	4	404	c.65T>C	c.(64-66)ATG>ACG	p.M22T	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	22					gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGTATTTCCATGAACTTATCC	0.388													67	114	---	---	---	---	capture	Missense_Mutation	SNP	27114460	27114460	GABRA5	15	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	6106	70
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	Splice_Site	SNP	G	A	A	rs112615235	by1000genomes	TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:30938316G>A	uc010azv.1	+	11		c.1127_splice	c.e11-1		ARHGAP11B_uc001zeu.2_Splice_Site			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TTCCTTGGCAGTGGATAAGTT	0.393													9	42	---	---	---	---	capture	Splice_Site	SNP	30938316	30938316	ARHGAP11B	15	G	A	A	A	1	0	0	0	0	0	0	1	0	456	36	5	2	857	70
CHSY1	22856	broad.mit.edu	37	15	101718018	101718018	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101718018G>A	uc002bwt.1	-	4	2467	c.1984C>T	c.(1984-1986)CAG>TAG	p.Q662*	CHSY1_uc010usd.1_Nonsense_Mutation_p.Q390*	NM_014918	NP_055733	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	662	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity				0	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGGTCATACTGGCTGAAGATG	0.428													25	167	---	---	---	---	capture	Nonsense_Mutation	SNP	101718018	101718018	CHSY1	15	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	3377	70
DPEP1	1800	broad.mit.edu	37	16	89704306	89704306	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89704306G>A	uc010cin.2	+	10	1195	c.992G>A	c.(991-993)AGG>AAG	p.R331K	DPEP1_uc002fnr.3_Missense_Mutation_p.R331K|DPEP1_uc002fns.3_Missense_Mutation_p.R331K	NM_001128141	NP_001121613	P16444	DPEP1_HUMAN	dipeptidase 1 precursor	331					proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	CTGCTCAGGAGGAACTGGACG	0.627													23	53	---	---	---	---	capture	Missense_Mutation	SNP	89704306	89704306	DPEP1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	4668	70
FXR2	9513	broad.mit.edu	37	17	7495610	7495610	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7495610G>A	uc002gia.1	-	16	2115	c.1888C>T	c.(1888-1890)CGC>TGC	p.R630C	MPDU1_uc010vuc.1_Intron|SOX15_uc002ghy.1_5'Flank|SOX15_uc002ghz.1_5'Flank	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related	630						cytosolic large ribosomal subunit	protein binding|RNA binding				0				READ - Rectum adenocarcinoma(115;0.17)		GGTTTAGTGCGTTCCAGGGGT	0.522													62	132	---	---	---	---	capture	Missense_Mutation	SNP	7495610	7495610	FXR2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6058	70
FKBP10	60681	broad.mit.edu	37	17	39975472	39975472	+	Silent	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39975472C>T	uc002hxv.2	+	5	1063	c.738C>T	c.(736-738)ATC>ATT	p.I246I	FKBP10_uc002hxw.1_5'UTR	NM_021939	NP_068758	Q96AY3	FKB10_HUMAN	FK506 binding protein 10 precursor	246	PPIase FKBP-type 2.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		GGACAGTGATCCCCCCACAGG	0.607													67	141	---	---	---	---	capture	Silent	SNP	39975472	39975472	FKBP10	17	C	T	T	T	1	0	0	0	0	0	0	0	1	382	30	2	2	5847	70
NPEPPS	9520	broad.mit.edu	37	17	45681356	45681356	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45681356C>T	uc002ilr.3	+	16	2039	c.1816C>T	c.(1816-1818)CGT>TGT	p.R606C	NPEPPS_uc010wkt.1_Missense_Mutation_p.R602C|NPEPPS_uc010wku.1_Missense_Mutation_p.R570C|NPEPPS_uc010wkv.1_Missense_Mutation_p.R160C|NPEPPS_uc002ils.1_Missense_Mutation_p.R39C	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	606					proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						ACCAGGCATTCGTGACCTTTC	0.433													6	46	---	---	---	---	capture	Missense_Mutation	SNP	45681356	45681356	NPEPPS	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10482	70
DSG1	1828	broad.mit.edu	37	18	28934664	28934664	+	Silent	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28934664C>T	uc002kwp.2	+	15	2717	c.2505C>T	c.(2503-2505)GTC>GTT	p.V835V	DSG1_uc010xbp.1_Silent_p.V194V	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	835	Desmoglein repeat 1.|Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			ATGGTAATGTCACTGTGACCG	0.512													52	297	---	---	---	---	capture	Silent	SNP	28934664	28934664	DSG1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	4731	70
SLC14A2	8170	broad.mit.edu	37	18	43212315	43212315	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43212315G>T	uc010dnj.2	+	6	843	c.522G>T	c.(520-522)AGG>AGT	p.R174S	SLC14A2_uc002lbb.2_Missense_Mutation_p.R174S|SLC14A2_uc002lbe.2_Missense_Mutation_p.R174S	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	174						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						TCACCGCCAGGTCTGCCATTG	0.408													66	105	---	---	---	---	capture	Missense_Mutation	SNP	43212315	43212315	SLC14A2	18	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	14290	70
MC4R	4160	broad.mit.edu	37	18	58038973	58038973	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:58038973T>A	uc002lie.1	-	1	1029	c.610A>T	c.(610-612)ATG>TTG	p.M204L		NM_005912	NP_005903	P32245	MC4R_HUMAN	melanocortin 4 receptor	204	Helical; Name=5; (Potential).				feeding behavior|G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of bone resorption|positive regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|ubiquitin protein ligase binding			lung(1)	1		Colorectal(73;0.0946)				AGAGCCAGCATGGTGAAGAAC	0.498													21	128	---	---	---	---	capture	Missense_Mutation	SNP	58038973	58038973	MC4R	18	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	9279	70
C18orf22	79863	broad.mit.edu	37	18	77796687	77796687	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77796687A>C	uc002lns.2	+	2	316	c.178A>C	c.(178-180)AGT>CGT	p.S60R	TXNL4A_uc010drg.2_5'Flank|C18orf22_uc010drh.2_Missense_Mutation_p.S60R|C18orf22_uc010dri.1_Intron	NM_024805	NP_079081	Q8N0V3	RBFA_HUMAN	hypothetical protein LOC79863 precursor	60					rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)		TTGGTATGAAAGTCCTTCCTT	0.378													24	64	---	---	---	---	capture	Missense_Mutation	SNP	77796687	77796687	C18orf22	18	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	1882	70
MAP1S	55201	broad.mit.edu	37	19	17844106	17844106	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17844106G>T	uc002nhe.1	+	6	2902	c.2893G>T	c.(2893-2895)GAG>TAG	p.E965*	MAP1S_uc010eba.1_Intron|MAP1S_uc002nhf.1_Nonsense_Mutation_p.E213*|MAP1S_uc010xpv.1_Nonsense_Mutation_p.E939*	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	965	Necessary for association with actin (By similarity).|Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for association with microtubules.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						CCTGGTGGATGAGGAGTTCTT	0.697													5	8	---	---	---	---	capture	Nonsense_Mutation	SNP	17844106	17844106	MAP1S	19	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	9148	70
ZNF98	148198	broad.mit.edu	37	19	22574462	22574462	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22574462T>A	uc002nqt.2	-	4	1697	c.1575A>T	c.(1573-1575)AAA>AAT	p.K525N		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	525	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TGTTAAAGGCTTTGCCGCATT	0.388													16	43	---	---	---	---	capture	Missense_Mutation	SNP	22574462	22574462	ZNF98	19	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	18079	70
CD37	951	broad.mit.edu	37	19	49840274	49840274	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49840274G>A	uc002pnd.2	+	3	372	c.251G>A	c.(250-252)CGC>CAC	p.R84H	uc002pnb.1_Intron|CD37_uc002pnc.2_RNA|CD37_uc010yam.1_Missense_Mutation_p.R84H|CD37_uc010yan.1_Missense_Mutation_p.R16H|CD37_uc002pnf.3_Missense_Mutation_p.R56H|CD37_uc002pne.2_Missense_Mutation_p.R16H	NM_001774	NP_001765	P11049	CD37_HUMAN	CD37 antigen isoform A	84	Cytoplasmic (Potential).					integral to membrane					0		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		AAGGAGCTCCGCTGCCTCCTG	0.622													7	105	---	---	---	---	capture	Missense_Mutation	SNP	49840274	49840274	CD37	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2979	70
GPR17	2840	broad.mit.edu	37	2	128408380	128408380	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128408380G>T	uc010yzn.1	+	4	766	c.155G>T	c.(154-156)GGC>GTC	p.G52V	LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.G52V|GPR17_uc010yzo.1_Missense_Mutation_p.G24V|GPR17_uc002tpd.2_Missense_Mutation_p.G24V	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	52	Extracellular (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		gagcaatgtggccaggagacg	0.080											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	68	115	---	---	---	---	capture	Missense_Mutation	SNP	128408380	128408380	GPR17	2	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	6601	70
FAM123C	205147	broad.mit.edu	37	2	131521709	131521709	+	Silent	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131521709C>T	uc002trw.2	+	2	2254	c.2064C>T	c.(2062-2064)AAC>AAT	p.N688N	FAM123C_uc010fmv.2_Silent_p.N688N|FAM123C_uc010fms.1_Silent_p.N688N|FAM123C_uc010fmt.1_Silent_p.N688N|FAM123C_uc010fmu.1_Silent_p.N688N	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	688										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		TCAGCTCAAACGAACAGCCCC	0.652													16	25	---	---	---	---	capture	Silent	SNP	131521709	131521709	FAM123C	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5378	70
CST7	8530	broad.mit.edu	37	20	24930092	24930092	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:24930092C>A	uc002wtx.1	+	1	227	c.17C>A	c.(16-18)GCA>GAA	p.A6E		NM_003650	NP_003641	O76096	CYTF_HUMAN	cystatin F	Error:Variant_position_missing_in_O76096_after_alignment					immune response	cytoplasm|extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1						CCTGAGAAGGCACTGCACGGC	0.672													34	86	---	---	---	---	capture	Missense_Mutation	SNP	24930092	24930092	CST7	20	C	A	A	A	1	0	0	0	0	1	0	0	0	313	25	4	4	3942	70
C20orf185	359710	broad.mit.edu	37	20	31656654	31656654	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31656654C>T	uc002wym.1	+	10	1024	c.1024C>T	c.(1024-1026)CGG>TGG	p.R342W		NM_182658	NP_872599	P59826	LPLC3_HUMAN	antimicrobial peptide RYA3 precursor	342					innate immune response	cytoplasm|extracellular region	lipid binding|protein binding			ovary(4)	4						ACTGTTCCTGCGGGTGAGGGA	0.562													32	73	---	---	---	---	capture	Missense_Mutation	SNP	31656654	31656654	C20orf185	20	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	2079	70
PHF20	51230	broad.mit.edu	37	20	34487354	34487354	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34487354G>T	uc002xek.1	+	10	1456	c.1345G>T	c.(1345-1347)GAC>TAC	p.D449Y	PHF20_uc002xei.1_Missense_Mutation_p.D449Y|PHF20_uc010gfo.1_Missense_Mutation_p.D449Y|PHF20_uc002xej.1_Missense_Mutation_p.D333Y	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	449					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					TGTCGACCTAGACCATAAGTT	0.348													21	63	---	---	---	---	capture	Missense_Mutation	SNP	34487354	34487354	PHF20	20	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	11734	70
TMPRSS3	64699	broad.mit.edu	37	21	43803180	43803180	+	Silent	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43803180C>T	uc002zbb.2	-	8	945	c.744G>A	c.(742-744)ACG>ACA	p.T248T	TMPRSS3_uc002zay.2_5'UTR|TMPRSS3_uc002zaz.2_Silent_p.T121T|TMPRSS3_uc002zba.2_Silent_p.T121T|TMPRSS3_uc002zbc.2_Silent_p.T248T|TMPRSS3_uc002zbd.2_Silent_p.T248T	NM_024022	NP_076927	P57727	TMPS3_HUMAN	transmembrane protease, serine 3 isoform 1	248	Peptidase S1.|Extracellular (Potential).				cellular sodium ion homeostasis|proteolysis	endoplasmic reticulum membrane|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity|sodium channel regulator activity			ovary(2)|breast(1)	3						TCCACAGGGGCGTGATGACAG	0.602													24	53	---	---	---	---	capture	Silent	SNP	43803180	43803180	TMPRSS3	21	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16131	70
GGT5	2687	broad.mit.edu	37	22	24622188	24622188	+	Missense_Mutation	SNP	C	T	T	rs149456868		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24622188C>T	uc002zzo.3	-	8	1502	c.1085G>A	c.(1084-1086)CGC>CAC	p.R362H	GGT5_uc002zzp.3_Missense_Mutation_p.R362H|GGT5_uc002zzr.3_Missense_Mutation_p.R330H|GGT5_uc002zzq.3_Missense_Mutation_p.R330H|GGT5_uc011ajm.1_Missense_Mutation_p.R285H|GGT5_uc011ajn.1_RNA	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b	362	Extracellular (Potential).				glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						GATCTGTTGGCGGATGAGCTG	0.692													25	46	---	---	---	---	capture	Missense_Mutation	SNP	24622188	24622188	GGT5	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6301	70
TMEM144	55314	broad.mit.edu	37	4	159136389	159136389	+	Silent	SNP	C	G	G	rs149733307		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159136389C>G	uc003ipx.2	+	4	676	c.156C>G	c.(154-156)GCC>GCG	p.A52A	TMEM144_uc010iqi.2_RNA	NM_018342	NP_060812	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	52	Helical; (Potential).					integral to membrane					0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		GGTTGGTTGCCTTGGTTGTCA	0.383													51	101	---	---	---	---	capture	Silent	SNP	159136389	159136389	TMEM144	4	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	15942	70
PIK3R1	5295	broad.mit.edu	37	5	67591246	67591246	+	Splice_Site	SNP	A	G	G			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591246A>G	uc003jva.2	+	14	2306	c.1746_splice	c.e14-2	p.M582_splice	PIK3R1_uc003jvb.2_Splice_Site_p.M582_splice|PIK3R1_uc003jvc.2_Splice_Site_p.M282_splice|PIK3R1_uc003jvd.2_Splice_Site_p.M312_splice|PIK3R1_uc003jve.2_Splice_Site_p.M261_splice|PIK3R1_uc011crb.1_Splice_Site_p.M252_splice	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(2)|p.Y580fs*1(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	ACTGTTTTTCAGGTGGTTGAC	0.363			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			27	51	---	---	---	---	capture	Splice_Site	SNP	67591246	67591246	PIK3R1	5	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	11821	70
FSTL4	23105	broad.mit.edu	37	5	132535036	132535036	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:132535036G>T	uc003kyn.1	-	16	2498	c.2280C>A	c.(2278-2280)GAC>GAA	p.D760E	FSTL4_uc003kym.1_Missense_Mutation_p.D409E	NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor	760						extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGAACAGCAGGTCCGGCTCCG	0.582													36	62	---	---	---	---	capture	Missense_Mutation	SNP	132535036	132535036	FSTL4	5	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	6021	70
ARHGAP26	23092	broad.mit.edu	37	5	142281566	142281566	+	Missense_Mutation	SNP	G	A	A	rs148543665		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:142281566G>A	uc011dbj.1	+	7	699	c.664G>A	c.(664-666)GGG>AGG	p.G222R	ARHGAP26_uc003lmt.2_Missense_Mutation_p.G222R|ARHGAP26_uc003lmw.2_Missense_Mutation_p.G222R	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal	222					actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAAGGATTTCGGGGACTTCAA	0.448													27	138	---	---	---	---	capture	Missense_Mutation	SNP	142281566	142281566	ARHGAP26	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	868	70
SNX14	57231	broad.mit.edu	37	6	86253476	86253476	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:86253476C>A	uc003pkr.2	-	13	1304	c.1111G>T	c.(1111-1113)GAA>TAA	p.E371*	SNX14_uc003pkp.2_Nonsense_Mutation_p.E234*|SNX14_uc003pkq.2_5'UTR|SNX14_uc011dzg.1_Nonsense_Mutation_p.E319*|SNX14_uc003pks.2_Nonsense_Mutation_p.E327*|SNX14_uc003pkt.2_Nonsense_Mutation_p.E371*	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a	371	RGS.				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TCATTAAATTCCTCTAACAAA	0.279													12	23	---	---	---	---	capture	Nonsense_Mutation	SNP	86253476	86253476	SNX14	6	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	14777	70
EGFR	1956	broad.mit.edu	37	7	55221821	55221822	+	Missense_Mutation	DNP	GC	AA	AA	rs149840192		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221821_55221822GC>AA	uc003tqk.2	+	7	1111_1112	c.865_866GC>AA	c.(865-867)GCC>AAC	p.A289N	EGFR_uc003tqh.2_Missense_Mutation_p.A289N|EGFR_uc003tqi.2_Missense_Mutation_p.A289N|EGFR_uc003tqj.2_Missense_Mutation_p.A289N|EGFR_uc010kzg.1_Missense_Mutation_p.A244N|EGFR_uc011kco.1_Missense_Mutation_p.A236N|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289T(3)|p.A289D(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGCTTTGGTGCCACCTGCGTG	0.589		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			126	811	---	---	---	---	capture	Missense_Mutation	DNP	55221821	55221822	EGFR	7	GC	AA	AA	AA	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	70
EGFR	1956	broad.mit.edu	37	7	55233037	55233037	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233037C>G	uc003tqk.2	+	15	2033	c.1787C>G	c.(1786-1788)CCG>CGG	p.P596R	EGFR_uc003tqi.2_Missense_Mutation_p.P596R|EGFR_uc003tqj.2_Missense_Mutation_p.P596R|EGFR_uc010kzg.1_Missense_Mutation_p.P551R|EGFR_uc011kco.1_Missense_Mutation_p.P543R|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	596	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.P596L(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AAGACCTGCCCGGCAGGAGTC	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			220	698	---	---	---	---	capture	Missense_Mutation	SNP	55233037	55233037	EGFR	7	C	G	G	G	1	0	0	0	0	1	0	0	0	299	23	4	4	4922	70
PCLO	27445	broad.mit.edu	37	7	82784471	82784471	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82784471A>G	uc003uhx.2	-	2	1775	c.1486T>C	c.(1486-1488)TCA>CCA	p.S496P	PCLO_uc003uhv.2_Missense_Mutation_p.S496P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGCTTTGCTGAGCCAGGCTGT	0.607													13	272	---	---	---	---	capture	Missense_Mutation	SNP	82784471	82784471	PCLO	7	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	11486	70
BPGM	669	broad.mit.edu	37	7	134346723	134346723	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134346723C>T	uc003vrv.2	+	3	1005	c.464C>T	c.(463-465)TCG>TTG	p.S155L	BPGM_uc003vrw.2_Missense_Mutation_p.S155L|BPGM_uc003vrx.2_Missense_Mutation_p.S155L	NM_199186	NP_954655	P07738	PMGE_HUMAN	bisphosphoglycerate mutase	155					glycolysis|respiratory gaseous exchange		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0						CTGCCACGGTCGGAAAGCTTA	0.473													25	120	---	---	---	---	capture	Missense_Mutation	SNP	134346723	134346723	BPGM	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1476	70
SLC34A3	142680	broad.mit.edu	37	9	140128961	140128961	+	Missense_Mutation	SNP	C	T	T	rs138798032		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140128961C>T	uc004cmf.1	+	11	1373	c.1187C>T	c.(1186-1188)ACG>ATG	p.T396M	SLC34A3_uc011met.1_Missense_Mutation_p.T396M	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	396	Extracellular (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		AGCGTCTTCACGGCGGCCGTC	0.721													8	9	---	---	---	---	capture	Missense_Mutation	SNP	140128961	140128961	SLC34A3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14461	70
DMD	1756	broad.mit.edu	37	X	32663088	32663088	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32663088G>C	uc004dda.1	-	10	1386	c.1142C>G	c.(1141-1143)ACT>AGT	p.T381S	DMD_uc004dcz.2_Missense_Mutation_p.T258S|DMD_uc004dcy.1_Missense_Mutation_p.T377S|DMD_uc004ddb.1_Missense_Mutation_p.T373S|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.T373S|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron|DMD_uc010ngr.1_Missense_Mutation_p.T92S	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	381	Spectrin 1.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TACCTCATGAGTATGAAACTG	0.353													9	63	---	---	---	---	capture	Missense_Mutation	SNP	32663088	32663088	DMD	23	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	4538	70
PCDH11X	27328	broad.mit.edu	37	X	91132696	91132696	+	Missense_Mutation	SNP	C	T	T	rs62621113		TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91132696C>T	uc004efk.1	+	2	2302	c.1457C>T	c.(1456-1458)ACG>ATG	p.T486M	PCDH11X_uc004efl.1_Missense_Mutation_p.T486M|PCDH11X_uc004efo.1_Missense_Mutation_p.T486M|PCDH11X_uc010nmv.1_Missense_Mutation_p.T486M|PCDH11X_uc004efm.1_Missense_Mutation_p.T486M|PCDH11X_uc004efn.1_Missense_Mutation_p.T486M|PCDH11X_uc004efh.1_Missense_Mutation_p.T486M|PCDH11X_uc004efj.1_Missense_Mutation_p.T486M	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	486	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						ATCCAGTTGACGAAAGTAAGT	0.438													6	83	---	---	---	---	capture	Missense_Mutation	SNP	91132696	91132696	PCDH11X	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11411	70
GPRASP2	114928	broad.mit.edu	37	X	101971308	101971308	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101971308A>G	uc004ejk.2	+	4	2845	c.1511A>G	c.(1510-1512)CAT>CGT	p.H504R	GPRASP2_uc004ejl.2_Missense_Mutation_p.H504R|GPRASP2_uc004ejm.2_Missense_Mutation_p.H504R|GPRASP2_uc011mrp.1_5'Flank	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	504						cytoplasm	protein binding			ovary(1)	1						GGTCTTTTTCATGGGGTTGGC	0.512													4	112	---	---	---	---	capture	Missense_Mutation	SNP	101971308	101971308	GPRASP2	23	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	6656	70
PCDH11Y	83259	broad.mit.edu	37	Y	4968500	4968500	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:4968500A>G	uc004fqo.2	+	2	3615	c.2881A>G	c.(2881-2883)AAG>GAG	p.K961E	PCDH11Y_uc010nwg.1_Missense_Mutation_p.K950E|PCDH11Y_uc004fql.1_Missense_Mutation_p.K950E|PCDH11Y_uc004fqm.1_Missense_Mutation_p.K950E|PCDH11Y_uc004fqn.1_Missense_Mutation_p.K961E|PCDH11Y_uc004fqp.1_Missense_Mutation_p.K732E	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	961	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						TACTACTTTCAAGCCTGACAG	0.458													20	102	---	---	---	---	capture	Missense_Mutation	SNP	4968500	4968500	PCDH11Y	24	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	11412	70
RLTPR	146206	broad.mit.edu	37	16	67683416	67683417	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0750-01	TCGA-06-0750-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67683416_67683417insT	uc002etn.2	+	20	1933_1934	c.1813_1814insT	c.(1813-1815)CTAfs	p.L605fs	RLTPR_uc010cel.1_Frame_Shift_Ins_p.L598fs|RLTPR_uc010vjr.1_Frame_Shift_Ins_p.L569fs	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	605	Tropomodulin-like.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		ACTCCGGGCCCTAGCCACCAAT	0.629													8	102	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	67683416	67683417	RLTPR	16	-	T	T	T	1	0	1	1	0	0	0	0	0	311	24	5	5	13286	70
