Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AGRN	375790	broad.mit.edu	37	1	981607	981607	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:981607G>A	uc001ack.1	+	17	2923	c.2873G>A	c.(2872-2874)GGC>GAC	p.G958D		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	958	Kazal-like 9.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TGCCGCCAGGGCCTGCAAATC	0.612													40	71	---	---	---	---	capture	Missense_Mutation	SNP	981607	981607	AGRN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	397	71
ZNF362	149076	broad.mit.edu	37	1	33745881	33745881	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33745881G>A	uc001bxc.1	+	5	676	c.506G>A	c.(505-507)AGC>AAC	p.S169N		NM_152493	NP_689706	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	169					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GGGATCACCAGCCCCCCTCTC	0.677													53	95	---	---	---	---	capture	Missense_Mutation	SNP	33745881	33745881	ZNF362	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	17748	71
MAP7D1	55700	broad.mit.edu	37	1	36636835	36636835	+	Missense_Mutation	SNP	C	T	T	rs2296266	byFrequency;by1000genomes	TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36636835C>T	uc001bzz.2	+	2	526	c.310C>T	c.(310-312)CGG>TGG	p.R104W	MAP7D1_uc001caa.2_Missense_Mutation_p.R104W|MAP7D1_uc001cab.2_Missense_Mutation_p.R104W|MAP7D1_uc001cac.2_5'Flank	NM_018067	NP_060537	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	104	Pro-rich.					cytoplasm|spindle				ovary(3)|breast(2)	5		Myeloproliferative disorder(586;0.0393)				CATGGGCCCACGGGATGCCAG	0.662													35	35	---	---	---	---	capture	Missense_Mutation	SNP	36636835	36636835	MAP7D1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	9180	71
TM2D1	83941	broad.mit.edu	37	1	62190731	62190731	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62190731C>A	uc001czz.1	-	1	365	c.62G>T	c.(61-63)GGT>GTT	p.G21V		NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN	beta-amyloid binding protein precursor	21					apoptosis					ovary(1)	1						CCACAGGACACCAACGAGTCT	0.657													40	57	---	---	---	---	capture	Missense_Mutation	SNP	62190731	62190731	TM2D1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	15848	71
FLG	2312	broad.mit.edu	37	1	152282713	152282713	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152282713G>C	uc001ezu.1	-	3	4685	c.4649C>G	c.(4648-4650)TCA>TGA	p.S1550*		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1550	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCGTCTCCTGATTGTTCCTC	0.592									Ichthyosis				243	390	---	---	---	---	capture	Nonsense_Mutation	SNP	152282713	152282713	FLG	1	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	5867	71
PTEN	5728	broad.mit.edu	37	10	89717712	89717712	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717712C>T	uc001kfb.2	+	8	1768	c.737C>T	c.(736-738)CCG>CTG	p.P246L		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	246	C2 tensin-type.		P -> L (in CD and BZS).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.P246L(6)|p.R55fs*1(4)|p.P246fs*10(3)|p.L247fs*10(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.L247fs*11(1)|p.L247fs*12(1)|p.G165_*404del(1)|p.?(1)|p.F243fs*9(1)|p.P246fs*11(1)|p.P246_L247insGP(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCCCTCAGCCGTTACCTGTG	0.418		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			55	26	---	---	---	---	capture	Missense_Mutation	SNP	89717712	89717712	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12633	71
PTEN	5728	broad.mit.edu	37	10	89720659	89720659	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720659G>A	uc001kfb.2	+	9	1841	c.810G>A	c.(808-810)ATG>ATA	p.M270I		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	270	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.D268_F279>VGQNVSLLGKYI(2)|p.G165_*404del(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGGACAAAATGTTTCACTTTT	0.239		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			11	8	---	---	---	---	capture	Missense_Mutation	SNP	89720659	89720659	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	12633	71
MRGPRE	116534	broad.mit.edu	37	11	3249621	3249621	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3249621G>A	uc001lxq.3	-	2	716	c.406C>T	c.(406-408)CGC>TGC	p.R136C		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	136	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTCAGGTGGCGTGGGCGGCGG	0.692													5	7	---	---	---	---	capture	Missense_Mutation	SNP	3249621	3249621	MRGPRE	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9674	71
MRGPRX2	117194	broad.mit.edu	37	11	19077538	19077538	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:19077538G>A	uc001mph.2	-	2	500	c.412C>T	c.(412-414)CGC>TGC	p.R138C		NM_054030	NP_473371	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	138	Cytoplasmic (Potential).				sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding			ovary(1)	1						CGGCGGCAGCGATACCAGATG	0.617													23	72	---	---	---	---	capture	Missense_Mutation	SNP	19077538	19077538	MRGPRX2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9677	71
MAPK8IP1	9479	broad.mit.edu	37	11	45925671	45925671	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45925671A>G	uc001nbr.2	+	7	1795	c.1625A>G	c.(1624-1626)TAT>TGT	p.Y542C		NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting	542	SH3.				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity	p.Y542C(1)		ovary(2)|breast(1)|skin(1)	4				GBM - Glioblastoma multiforme(35;0.231)		TTTCCTGCCTATTACGCCATC	0.602													40	72	---	---	---	---	capture	Missense_Mutation	SNP	45925671	45925671	MAPK8IP1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	9197	71
OR5R1	219479	broad.mit.edu	37	11	56185215	56185215	+	Missense_Mutation	SNP	C	T	T	rs138983419	byFrequency	TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56185215C>T	uc010rji.1	-	1	494	c.494G>A	c.(493-495)CGT>CAT	p.R165H		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GTAAGTCAGACGGAAAGTGAT	0.438													49	92	---	---	---	---	capture	Missense_Mutation	SNP	56185215	56185215	OR5R1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11084	71
LRRC55	219527	broad.mit.edu	37	11	56950146	56950146	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56950146G>A	uc001njl.1	+	1	926	c.779G>A	c.(778-780)CGC>CAC	p.R260H		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	230	LRRCT.					integral to membrane					0						CGGATCCAGCGCTGTACAGCA	0.607													73	119	---	---	---	---	capture	Missense_Mutation	SNP	56950146	56950146	LRRC55	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8926	71
RNF169	254225	broad.mit.edu	37	11	74546969	74546969	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74546969C>T	uc001ovl.3	+	6	1334	c.1321C>T	c.(1321-1323)CGG>TGG	p.R441W	XRRA1_uc001ovm.2_Intron	NM_001098638	NP_001092108	Q8NCN4	RN169_HUMAN	ring finger protein 169	441							zinc ion binding			ovary(1)	1						CTTTCAGGAGCGGCAGATCAA	0.478													93	138	---	---	---	---	capture	Missense_Mutation	SNP	74546969	74546969	RNF169	11	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	13352	71
C12orf4	57102	broad.mit.edu	37	12	4643363	4643363	+	Nonsense_Mutation	SNP	A	C	C			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4643363A>C	uc001qms.2	-	3	372	c.284T>G	c.(283-285)TTA>TGA	p.L95*	C12orf4_uc001qmt.2_Nonsense_Mutation_p.L95*	NM_020374	NP_065107	Q9NQ89	CL004_HUMAN	hypothetical protein LOC57102	95											0			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		CAGCTGATGTAAATCTACTTC	0.393													62	81	---	---	---	---	capture	Nonsense_Mutation	SNP	4643363	4643363	C12orf4	12	A	C	C	C	1	0	0	0	0	0	1	0	0	169	13	5	4	1671	71
CLSTN3	9746	broad.mit.edu	37	12	7295764	7295764	+	Silent	SNP	C	T	T	rs143198009	byFrequency	TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7295764C>T	uc001qsr.2	+	12	1982	c.1704C>T	c.(1702-1704)CAC>CAT	p.H568H	CLSTN3_uc001qss.2_Silent_p.H580H	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	568	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						CCCAGGTCCACGTGAACCCCT	0.612													81	161	---	---	---	---	capture	Silent	SNP	7295764	7295764	CLSTN3	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3528	71
PPP1CC	5501	broad.mit.edu	37	12	111168342	111168342	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111168342T>A	uc001tru.2	-	3	655	c.410A>T	c.(409-411)TAT>TTT	p.Y137F		NM_002710	NP_002701	P36873	PP1G_HUMAN	protein phosphatase 1, catalytic subunit, gamma	137					cell division|glycogen metabolic process|mitotic prometaphase|triglyceride catabolic process	cleavage furrow|condensed chromosome kinetochore|cytosol|midbody|MLL5-L complex|nuclear speck|nucleolus|PTW/PP1 phosphatase complex	metal ion binding|protein binding|protein kinase binding|protein serine/threonine phosphatase activity			lung(2)|central_nervous_system(1)	3						ACATTCATCATAAAATCCATA	0.308													26	115	---	---	---	---	capture	Missense_Mutation	SNP	111168342	111168342	PPP1CC	12	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	12252	71
DNAH10	196385	broad.mit.edu	37	12	124416577	124416577	+	Silent	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124416577G>A	uc001uft.3	+	75	12889	c.12864G>A	c.(12862-12864)AGG>AGA	p.R4288R	DNAH10_uc001ufu.3_Silent_p.R201R	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4288					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TCTGGAGAAGGCTTGCTCCTG	0.493													58	77	---	---	---	---	capture	Silent	SNP	124416577	124416577	DNAH10	12	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	4556	71
MDGA2	161357	broad.mit.edu	37	14	47351248	47351248	+	Silent	SNP	A	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:47351248A>G	uc001wwj.3	-	11	2404	c.2208T>C	c.(2206-2208)AGT>AGC	p.S736S	MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Silent_p.S507S|MDGA2_uc010ani.2_Silent_p.S296S	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	736					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						GCTACTTACCACTATATTTGA	0.313													4	11	---	---	---	---	capture	Silent	SNP	47351248	47351248	MDGA2	14	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	9320	71
CDKL1	8814	broad.mit.edu	37	14	50808934	50808934	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50808934G>A	uc010anu.1	-	17	2386	c.2386C>T	c.(2386-2388)CAT>TAT	p.H796Y	CDKL1_uc001wxz.2_Missense_Mutation_p.H125Y	NM_004196	NP_004187	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1	124	Protein kinase.					cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(1)|stomach(1)	2	all_epithelial(31;0.000746)|Breast(41;0.0102)					ACGTCTCTATGTATGCACTAG	0.333													39	39	---	---	---	---	capture	Missense_Mutation	SNP	50808934	50808934	CDKL1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	3123	71
NIN	51199	broad.mit.edu	37	14	51196324	51196324	+	Missense_Mutation	SNP	G	A	A	rs144624455	by1000genomes	TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:51196324G>A	uc001wym.2	-	29	6186	c.5995C>T	c.(5995-5997)CGC>TGC	p.R1999C	NIN_uc001wyi.2_Missense_Mutation_p.R1999C|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.R1286C|NIN_uc010tqp.1_Missense_Mutation_p.R2005C|NIN_uc001wyo.2_Missense_Mutation_p.R1999C|NIN_uc001wyn.2_RNA	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1999	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					AGCAGCTGGCGTTGAAGCTGC	0.567			T	PDGFRB	MPD								23	15	---	---	---	---	capture	Missense_Mutation	SNP	51196324	51196324	NIN	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10324	71
AK7	122481	broad.mit.edu	37	14	96949427	96949427	+	Silent	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96949427C>T	uc001yfn.2	+	16	1889	c.1845C>T	c.(1843-1845)GAC>GAT	p.D615D		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	615	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		GTTTAACAGACGAAGAAAAGG	0.507													11	48	---	---	---	---	capture	Silent	SNP	96949427	96949427	AK7	14	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	444	71
NIPA1	123606	broad.mit.edu	37	15	23048832	23048832	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23048832G>T	uc001yvc.2	-	5	1012	c.987C>A	c.(985-987)GAC>GAA	p.D329E	NIPA1_uc001yvd.2_Missense_Mutation_p.D159E|NIPA1_uc001yve.2_Missense_Mutation_p.D254E	NM_144599	NP_653200	Q7RTP0	NIPA1_HUMAN	non-imprinted in Prader-Willi/Angelman syndrome	329	Cytoplasmic (Potential).				cell death	early endosome|integral to membrane|plasma membrane					0		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		TTGCAATCTAGTCTGTTTTCA	0.453													25	68	---	---	---	---	capture	Missense_Mutation	SNP	23048832	23048832	NIPA1	15	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	10329	71
AKAP13	11214	broad.mit.edu	37	15	86270682	86270682	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:86270682C>G	uc002blv.1	+	29	7245	c.7075C>G	c.(7075-7077)CGA>GGA	p.R2359G	AKAP13_uc002blu.1_Missense_Mutation_p.R2363G|AKAP13_uc010bnf.1_Missense_Mutation_p.R980G|AKAP13_uc002blw.1_Missense_Mutation_p.R824G|AKAP13_uc002blx.1_Missense_Mutation_p.R604G	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	2359	Interaction with ESR1.|Potential.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						CACCAGAGCCCGAGAATTAAA	0.448													16	32	---	---	---	---	capture	Missense_Mutation	SNP	86270682	86270682	AKAP13	15	C	G	G	G	1	0	0	0	0	1	0	0	0	295	23	4	4	449	71
ACAN	176	broad.mit.edu	37	15	89417650	89417650	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89417650C>T	uc010upo.1	+	18	7905	c.7531C>T	c.(7531-7533)CGC>TGC	p.R2511C	ACAN_uc010upp.1_Missense_Mutation_p.R2412C|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	2511					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CACCTACAAACGCAGACTACA	0.612													3	6	---	---	---	---	capture	Missense_Mutation	SNP	89417650	89417650	ACAN	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	117	71
CLCN7	1186	broad.mit.edu	37	16	1507256	1507256	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1507256T>C	uc002clv.2	-	9	931	c.821A>G	c.(820-822)AAG>AGG	p.K274R	CLCN7_uc002clw.2_Missense_Mutation_p.K250R	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	274						integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				TCAACTCACCTTGAAATCTCG	0.592													21	64	---	---	---	---	capture	Missense_Mutation	SNP	1507256	1507256	CLCN7	16	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	3433	71
COG4	25839	broad.mit.edu	37	16	70551628	70551628	+	Silent	SNP	C	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70551628C>G	uc002ezc.2	-	3	281	c.270G>C	c.(268-270)CTG>CTC	p.L90L	COG4_uc010cfu.2_RNA|COG4_uc002ezd.2_Silent_p.L90L|COG4_uc002eze.2_5'UTR	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	86	Interacts with STX5.				Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)				CTCCCTCAATCAGCTGCAGAT	0.453													21	85	---	---	---	---	capture	Silent	SNP	70551628	70551628	COG4	16	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	3625	71
TAT	6898	broad.mit.edu	37	16	71603782	71603782	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71603782C>T	uc002fap.2	-	10	1199	c.1100G>A	c.(1099-1101)CGC>CAC	p.R367H		NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase	367					2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	CCCAGAAGGGCGGACTGGCCG	0.512													19	30	---	---	---	---	capture	Missense_Mutation	SNP	71603782	71603782	TAT	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15478	71
KARS	3735	broad.mit.edu	37	16	75665416	75665416	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75665416C>T	uc002feq.2	-	9	1198	c.1150G>A	c.(1150-1152)GAT>AAT	p.D384N	KARS_uc002fer.2_Missense_Mutation_p.D412N|KARS_uc002fes.2_Missense_Mutation_p.D228N	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2	384					interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)	AAGTCAACATCGTAGGCTTGG	0.517													31	118	---	---	---	---	capture	Missense_Mutation	SNP	75665416	75665416	KARS	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7903	71
USP10	9100	broad.mit.edu	37	16	84812553	84812553	+	Silent	SNP	C	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84812553C>A	uc002fii.2	+	14	2404	c.2262C>A	c.(2260-2262)GTC>GTA	p.V754V	USP10_uc010voe.1_Silent_p.V758V|USP10_uc010vof.1_Silent_p.V316V|USP10_uc002fij.2_Silent_p.V280V	NM_005153	NP_005144	Q14694	UBP10_HUMAN	ubiquitin specific protease 10	754					DNA damage response, signal transduction by p53 class mediator|DNA repair|protein deubiquitination|ubiquitin-dependent protein catabolic process	early endosome|intermediate filament cytoskeleton|nucleus	cystic fibrosis transmembrane conductance regulator binding|p53 binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						CTACAGACGTCTTCCAGATCG	0.567													20	33	---	---	---	---	capture	Silent	SNP	84812553	84812553	USP10	16	C	A	A	A	1	0	0	0	0	0	0	0	1	405	32	4	4	16923	71
WSCD1	23302	broad.mit.edu	37	17	5991317	5991317	+	Silent	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5991317C>T	uc010cli.2	+	3	814	c.435C>T	c.(433-435)TAC>TAT	p.Y145Y	WSCD1_uc002gcn.2_Silent_p.Y145Y|WSCD1_uc002gco.2_Silent_p.Y145Y|WSCD1_uc010clj.2_Intron	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN	WSC domain containing 1	145	WSC 1.					integral to membrane	sulfotransferase activity				0						CAGGCACCTACATTGGATGCT	0.537													13	47	---	---	---	---	capture	Silent	SNP	5991317	5991317	WSCD1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	17287	71
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	A	A	rs28934574		TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577094G>A	uc002gim.2	-	8	1038	c.844C>T	c.(844-846)CGG>TGG	p.R282W	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R282W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R150W|TP53_uc010cng.1_Missense_Mutation_p.R150W|TP53_uc002gii.1_Missense_Mutation_p.R150W|TP53_uc010cnh.1_Missense_Mutation_p.R282W|TP53_uc010cni.1_Missense_Mutation_p.R282W|TP53_uc002gij.2_Missense_Mutation_p.R282W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGTGCGCCGGTCTCTCCCA	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			35	24	---	---	---	---	capture	Missense_Mutation	SNP	7577094	7577094	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16264	71
SLC13A2	9058	broad.mit.edu	37	17	26816246	26816246	+	Silent	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26816246G>A	uc002hbh.2	+	2	184	c.117G>A	c.(115-117)GCG>GCA	p.A39A	SLC13A2_uc010wal.1_Intron|SLC13A2_uc010wam.1_5'UTR|SLC13A2_uc010wan.1_Silent_p.A39A|SLC13A2_uc010wao.1_Intron|SLC13A2_uc002hbi.2_5'UTR	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	39						integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CCTACTGCGCGTATGCCATCA	0.612													58	86	---	---	---	---	capture	Silent	SNP	26816246	26816246	SLC13A2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	14285	71
SLC16A6	9120	broad.mit.edu	37	17	66267054	66267054	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66267054T>G	uc002jgz.1	-	5	1435	c.1247A>C	c.(1246-1248)GAG>GCG	p.E416A	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Missense_Mutation_p.E416A	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	416	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	AGACATCTTCTCAATGCCCAC	0.458													45	84	---	---	---	---	capture	Missense_Mutation	SNP	66267054	66267054	SLC16A6	17	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	14305	71
GPS1	2873	broad.mit.edu	37	17	80014960	80014960	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80014960T>C	uc002kdl.1	+	13	1478	c.1433T>C	c.(1432-1434)CTG>CCG	p.L478P	GPS1_uc002kdk.1_Missense_Mutation_p.L514P|GPS1_uc010dij.1_Missense_Mutation_p.L513P|GPS1_uc002kdm.1_Missense_Mutation_p.L458P|GPS1_uc002kdn.1_Missense_Mutation_p.L474P|GPS1_uc002kdo.1_Missense_Mutation_p.L477P|GPS1_uc010wvh.1_Missense_Mutation_p.L470P	NM_004127	NP_004118	Q13098	CSN1_HUMAN	G protein pathway suppressor 1 isoform 2	478					cell cycle|cullin deneddylation|inactivation of MAPK activity|JNK cascade	cytoplasm|signalosome	GTPase inhibitor activity|protein binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CAGGGGGAGCTGACTCCAGCC	0.677													22	55	---	---	---	---	capture	Missense_Mutation	SNP	80014960	80014960	GPS1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	6665	71
CIDEA	1149	broad.mit.edu	37	18	12262928	12262928	+	Missense_Mutation	SNP	G	A	A	rs149949331	byFrequency	TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12262928G>A	uc002kqt.3	+	2	208	c.143G>A	c.(142-144)CGT>CAT	p.R48H	CIDEA_uc002kqu.3_Missense_Mutation_p.R82H|CIDEA_uc010dlc.2_RNA	NM_001279	NP_001270	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a isoform	48	CIDE-N.				DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|lipid metabolic process|lipid storage|negative regulation of apoptosis|negative regulation of cytokine secretion|negative regulation of lipid catabolic process|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of sequestering of triglyceride|temperature homeostasis	mitochondrial envelope|nucleus	protein homodimerization activity			ovary(1)|central_nervous_system(1)	2						AGCAGCCGGCGTGGGGTGATG	0.622													32	40	---	---	---	---	capture	Missense_Mutation	SNP	12262928	12262928	CIDEA	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3390	71
MUC16	94025	broad.mit.edu	37	19	9046404	9046404	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9046404C>T	uc002mkp.2	-	5	35431	c.35227G>A	c.(35227-35229)GTG>ATG	p.V11743M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11745	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTGAAGTCACCATCTCTGGT	0.502													53	50	---	---	---	---	capture	Missense_Mutation	SNP	9046404	9046404	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	9883	71
HPN	3249	broad.mit.edu	37	19	35556818	35556818	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35556818C>T	uc002nxq.1	+	13	1342	c.1097C>T	c.(1096-1098)ACG>ATG	p.T366M	HPN_uc002nxr.1_Missense_Mutation_p.T366M|HPN_uc002nxs.1_Missense_Mutation_p.T208M|HPN_uc010xsh.1_Missense_Mutation_p.T335M|HPN_uc002nxt.1_Missense_Mutation_p.T250M|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin	366	Extracellular (Potential).|Peptidase S1.				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	ATCTCTCGGACGCCACGTTGG	0.632													95	117	---	---	---	---	capture	Missense_Mutation	SNP	35556818	35556818	HPN	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7261	71
NUCB1	4924	broad.mit.edu	37	19	49414468	49414468	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49414468C>G	uc002plb.3	+	5	511	c.439C>G	c.(439-441)CAT>GAT	p.H147D	NUCB1_uc002pla.2_Missense_Mutation_p.H147D|NUCB1_uc002plc.2_Missense_Mutation_p.H147D	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor	147						ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		TCAGAACCAGCATACATTCGA	0.552													7	43	---	---	---	---	capture	Missense_Mutation	SNP	49414468	49414468	NUCB1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	10625	71
ZNF264	9422	broad.mit.edu	37	19	57722987	57722987	+	Silent	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57722987G>A	uc002qob.2	+	4	935	c.522G>A	c.(520-522)GAG>GAA	p.E174E		NM_003417	NP_003408	O43296	ZN264_HUMAN	zinc finger protein 264	174					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TTGGACAGGAGCAAGTCTCTC	0.463													10	52	---	---	---	---	capture	Silent	SNP	57722987	57722987	ZNF264	19	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	17684	71
TMEM198	130612	broad.mit.edu	37	2	220414057	220414057	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220414057A>G	uc002vme.2	+	5	1511	c.926A>G	c.(925-927)AAT>AGT	p.N309S	TMEM198_uc002vmf.2_Missense_Mutation_p.N309S|hsa-mir-3132|MI0014152_5'Flank	NM_001005209	NP_001005209	Q66K66	TM198_HUMAN	transmembrane protein 198	309						integral to membrane				ovary(1)	1		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AAACGCTTCAATGGAGACGTC	0.627													38	59	---	---	---	---	capture	Missense_Mutation	SNP	220414057	220414057	TMEM198	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	16002	71
CHGB	1114	broad.mit.edu	37	20	5904212	5904212	+	Silent	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5904212C>T	uc002wmg.2	+	4	1728	c.1422C>T	c.(1420-1422)TAC>TAT	p.Y474Y	CHGB_uc010zqz.1_Silent_p.Y157Y	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	474						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						ATCTCAACTACGGTGAGGAAG	0.507													77	101	---	---	---	---	capture	Silent	SNP	5904212	5904212	CHGB	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3305	71
TRPM2	7226	broad.mit.edu	37	21	45825917	45825917	+	Silent	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45825917G>A	uc002zet.1	+	19	3000	c.2787G>A	c.(2785-2787)CGG>CGA	p.R929R	TRPM2_uc002zeu.1_Silent_p.R929R|TRPM2_uc002zew.1_Silent_p.R929R|TRPM2_uc010gpt.1_Silent_p.R929R|TRPM2_uc002zex.1_Silent_p.R715R|TRPM2_uc002zey.1_Silent_p.R442R	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	929	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TTGTGAAGCGGATGGTAAGGG	0.627													108	125	---	---	---	---	capture	Silent	SNP	45825917	45825917	TRPM2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	16469	71
TGFBR2	7048	broad.mit.edu	37	3	30732972	30732972	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:30732972C>T	uc003ceo.2	+	7	1967	c.1585C>T	c.(1585-1587)CTC>TTC	p.L529F	TGFBR2_uc003cen.2_Missense_Mutation_p.L554F	NM_003242	NP_003233	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II	529	Protein kinase.|Cytoplasmic (Potential).				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						AGAGGCCCGTCTCACAGCCCA	0.592													41	155	---	---	---	---	capture	Missense_Mutation	SNP	30732972	30732972	TGFBR2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	15707	71
CELSR3	1951	broad.mit.edu	37	3	48696782	48696782	+	Missense_Mutation	SNP	C	T	T	rs144228630		TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48696782C>T	uc003cul.2	-	1	3567	c.3286G>A	c.(3286-3288)GAA>AAA	p.E1096K	CELSR3_uc003cuf.1_Missense_Mutation_p.E1166K	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	1096	Extracellular (Potential).|Cadherin 8.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TTGGGGCCTTCGTCAGGGTCC	0.532													94	133	---	---	---	---	capture	Missense_Mutation	SNP	48696782	48696782	CELSR3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3191	71
BSN	8927	broad.mit.edu	37	3	49699300	49699300	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49699300C>T	uc003cxe.3	+	6	10136	c.10022C>T	c.(10021-10023)CCC>CTC	p.P3341L		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	3341					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCCATGGGGCCCAAGCATCCC	0.572													21	97	---	---	---	---	capture	Missense_Mutation	SNP	49699300	49699300	BSN	3	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	1518	71
CLDN18	51208	broad.mit.edu	37	3	137717874	137717874	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137717874G>A	uc003ero.1	+	1	217	c.164G>A	c.(163-165)CGA>CAA	p.R55Q		NM_001002026	NP_001002026	P56856	CLD18_HUMAN	claudin 18 isoform 2	55	Extracellular (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity			upper_aerodigestive_tract(1)|ovary(1)	2						TCCTGTGTCCGAGAGAGCTCT	0.602													94	153	---	---	---	---	capture	Missense_Mutation	SNP	137717874	137717874	CLDN18	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3444	71
ATP10D	57205	broad.mit.edu	37	4	47575010	47575010	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47575010A>T	uc003gxk.1	+	18	3526	c.3362A>T	c.(3361-3363)AAT>ATT	p.N1121I	ATP10D_uc003gxl.1_Missense_Mutation_p.N369I	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1121	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TTCTATAAGAATGTGGTATGT	0.433													23	371	---	---	---	---	capture	Missense_Mutation	SNP	47575010	47575010	ATP10D	4	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	1109	71
TLR2	7097	broad.mit.edu	37	4	154626088	154626088	+	Missense_Mutation	SNP	C	T	T	rs121917864		TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:154626088C>T	uc003inq.2	+	3	2248	c.2029C>T	c.(2029-2031)CGG>TGG	p.R677W	TLR2_uc003inr.2_Missense_Mutation_p.R677W|TLR2_uc003ins.2_Missense_Mutation_p.R677W	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor	677	TIR.|Cytoplasmic (Potential).		R -> W.		cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				TCTTCATAAGCGGGACTTCAT	0.443													86	123	---	---	---	---	capture	Missense_Mutation	SNP	154626088	154626088	TLR2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15836	71
DNAH5	1767	broad.mit.edu	37	5	13735337	13735337	+	Silent	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13735337G>A	uc003jfd.2	-	68	11706	c.11664C>T	c.(11662-11664)TAC>TAT	p.Y3888Y	DNAH5_uc003jfc.2_Silent_p.Y56Y	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3888					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TGTGCTCCTCGTACAGCCCTC	0.458									Kartagener_syndrome				53	72	---	---	---	---	capture	Silent	SNP	13735337	13735337	DNAH5	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4561	71
PCDHA12	56137	broad.mit.edu	37	5	140256980	140256980	+	Silent	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140256980C>T	uc003lic.2	+	1	2050	c.1923C>T	c.(1921-1923)GAC>GAT	p.D641D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.D641D	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	641	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAGGCGGACGCTCCGCGCC	0.692													32	58	---	---	---	---	capture	Silent	SNP	140256980	140256980	PCDHA12	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11425	71
IL12B	3593	broad.mit.edu	37	5	158743755	158743755	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:158743755G>A	uc003lxr.1	-	7	967	c.925C>T	c.(925-927)CGG>TGG	p.R309W		NM_002187	NP_002178	P29460	IL12B_HUMAN	interleukin 12B precursor	309	Fibronectin type-III.				cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCTGGGCCCGCACGCTAATG	0.562											OREG0016989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	67	---	---	---	---	capture	Missense_Mutation	SNP	158743755	158743755	IL12B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	7548	71
KDM1B	221656	broad.mit.edu	37	6	18207666	18207666	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:18207666C>T	uc003nco.1	+	9	1163	c.1088C>T	c.(1087-1089)GCC>GTC	p.A363V	KDM1B_uc003ncn.1_Missense_Mutation_p.A334V	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1	566					multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding			skin(1)	1						GAATTCTTTGCCCAGTTTGCT	0.502													57	84	---	---	---	---	capture	Missense_Mutation	SNP	18207666	18207666	KDM1B	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8045	71
PRSS35	167681	broad.mit.edu	37	6	84233953	84233953	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84233953C>T	uc003pjz.2	+	2	956	c.793C>T	c.(793-795)CGA>TGA	p.R265*	PRSS35_uc010kbm.2_Nonsense_Mutation_p.R265*	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	265	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		GGGCTGGGCACGAGGAGGCAT	0.527													66	75	---	---	---	---	capture	Nonsense_Mutation	SNP	84233953	84233953	PRSS35	6	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12519	71
WISP3	8838	broad.mit.edu	37	6	112385979	112385979	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:112385979A>G	uc003pvm.2	+	4	478	c.368A>G	c.(367-369)GAG>GGG	p.E123G	WISP3_uc003pvn.2_RNA|WISP3_uc003pvo.2_Missense_Mutation_p.E141G	NM_003880	NP_003871	O95389	WISP3_HUMAN	WNT1 inducible signaling pathway protein 3	123					cell-cell signaling|regulation of cell growth|signal transduction	extracellular region|soluble fraction	growth factor activity|insulin-like growth factor binding				0		all_cancers(87;0.000196)|Acute lymphoblastic leukemia(125;1.18e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0283)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0827)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)		GTTGGGTGCGAGTTCAACCAG	0.458													86	188	---	---	---	---	capture	Missense_Mutation	SNP	112385979	112385979	WISP3	6	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	17255	71
GPR141	353345	broad.mit.edu	37	7	37780069	37780069	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37780069T>A	uc003tfm.1	+	1	74	c.74T>A	c.(73-75)TTC>TAC	p.F25Y	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	25	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						AGCCTCTACTTCATAGTGCTT	0.493													54	404	---	---	---	---	capture	Missense_Mutation	SNP	37780069	37780069	GPR141	7	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	6583	71
TXNDC3	51314	broad.mit.edu	37	7	37923971	37923971	+	Missense_Mutation	SNP	C	T	T	rs144650767		TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37923971C>T	uc003tfn.2	+	13	1433	c.1061C>T	c.(1060-1062)TCG>TTG	p.S354L		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	354	NDK 2.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						GTAGTATTATCGGAAAAAGAA	0.294									Kartagener_syndrome				48	204	---	---	---	---	capture	Missense_Mutation	SNP	37923971	37923971	TXNDC3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16680	71
AMPH	273	broad.mit.edu	37	7	38530706	38530706	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38530706C>T	uc003tgu.2	-	5	409	c.340G>A	c.(340-342)GTG>ATG	p.V114M	AMPH_uc003tgv.2_Missense_Mutation_p.V114M	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	114	BAR.				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						GACCCATCCACGAGTTTTTGA	0.403													114	383	---	---	---	---	capture	Missense_Mutation	SNP	38530706	38530706	AMPH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	588	71
ABCB4	5244	broad.mit.edu	37	7	87035603	87035603	+	Splice_Site	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87035603C>T	uc003uiv.1	-	26	3583	c.3507_splice	c.e26+1	p.H1169_splice	ABCB4_uc003uiw.1_Splice_Site_p.H1162_splice|ABCB4_uc003uix.1_Splice_Site_p.H1115_splice	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4						cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					CTTTAACTTACGTGGGGTAAC	0.393													51	324	---	---	---	---	capture	Splice_Site	SNP	87035603	87035603	ABCB4	7	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	43	71
SAMD9L	219285	broad.mit.edu	37	7	92763951	92763951	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92763951T>C	uc003umh.1	-	5	2550	c.1334A>G	c.(1333-1335)GAG>GGG	p.E445G	SAMD9L_uc003umj.1_Missense_Mutation_p.E445G|SAMD9L_uc003umi.1_Missense_Mutation_p.E445G|SAMD9L_uc010lfb.1_Missense_Mutation_p.E445G|SAMD9L_uc003umk.1_Missense_Mutation_p.E445G|SAMD9L_uc010lfc.1_Missense_Mutation_p.E445G|SAMD9L_uc010lfd.1_Missense_Mutation_p.E445G|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	445										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			AGGATCAAACTCCAACACAGC	0.343													37	306	---	---	---	---	capture	Missense_Mutation	SNP	92763951	92763951	SAMD9L	7	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	13719	71
TFPI2	7980	broad.mit.edu	37	7	93518519	93518519	+	Silent	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93518519G>A	uc003umy.1	-	3	363	c.288C>T	c.(286-288)TGC>TGT	p.C96C	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_Silent_p.C96C|TFPI2_uc003una.1_Silent_p.C85C|TFPI2_uc003unb.1_Silent_p.C96C|TFPI2_uc010lfg.1_Intron	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	96	BPTI/Kunitz inhibitor 2.				blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CTTGCAGCCGGCAAACTTTGG	0.398													33	270	---	---	---	---	capture	Silent	SNP	93518519	93518519	TFPI2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	15694	71
CYP3A43	64816	broad.mit.edu	37	7	99447306	99447306	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99447306T>C	uc003urx.1	+	7	762	c.659T>C	c.(658-660)TTA>TCA	p.L220S	CYP3A43_uc003ury.1_Missense_Mutation_p.L220S|CYP3A43_uc003urz.1_Missense_Mutation_p.L220S|CYP3A43_uc003usa.1_RNA|CYP3A43_uc010lgi.1_Intron|CYP3A43_uc003usb.1_Silent_p.F82F	NM_057095	NP_476436	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A,	220			Missing (in allele CYP3A43*2).		xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Cetirizine(DB00341)|Doxycycline(DB00254)	GATCCCTTTTTACTCTTAATA	0.204													32	108	---	---	---	---	capture	Missense_Mutation	SNP	99447306	99447306	CYP3A43	7	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	4139	71
C7orf52	375607	broad.mit.edu	37	7	100816793	100816793	+	Silent	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100816793C>T	uc003uxy.1	-	3	560	c.321G>A	c.(319-321)CTG>CTA	p.L107L	C7orf52_uc003uxz.1_Silent_p.L107L	NM_198571	NP_940973	Q8N8M0	CG052_HUMAN	hypothetical protein LOC375607	107	N-acetyltransferase.						N-acetyltransferase activity			ovary(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					TCACCGACTCCAGCGCGATCT	0.736													10	43	---	---	---	---	capture	Silent	SNP	100816793	100816793	C7orf52	7	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	2378	71
ADAM32	203102	broad.mit.edu	37	8	39080734	39080734	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39080734G>A	uc003xmt.3	+	14	1747	c.1502G>A	c.(1501-1503)CGT>CAT	p.R501H	ADAM32_uc011lch.1_Missense_Mutation_p.R402H|ADAM32_uc003xmu.3_Missense_Mutation_p.R395H|ADAM32_uc003xmv.2_Missense_Mutation_p.V23I	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32	501	Extracellular (Potential).|Cys-rich.				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CTCGATGCACGTTGTGAGAGT	0.338													11	15	---	---	---	---	capture	Missense_Mutation	SNP	39080734	39080734	ADAM32	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	249	71
IDO1	3620	broad.mit.edu	37	8	39785510	39785510	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39785510G>C	uc003xnm.2	+	10	1132	c.1018G>C	c.(1018-1020)GTC>CTC	p.V340L	IDO1_uc003xnn.2_RNA	NM_002164	NP_002155	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	340					female pregnancy|tryptophan catabolic process	cytosol	electron carrier activity|heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			central_nervous_system(2)	2					L-Tryptophan(DB00150)	GAAAGCTCTGGTCTCCCTGAG	0.498													4	20	---	---	---	---	capture	Missense_Mutation	SNP	39785510	39785510	IDO1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	7426	71
NIPAL2	79815	broad.mit.edu	37	8	99215392	99215392	+	Missense_Mutation	SNP	G	A	A	rs145862248	byFrequency	TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:99215392G>A	uc003yil.1	-	8	1080	c.824C>T	c.(823-825)ACG>ATG	p.T275M	NIPAL2_uc011lgw.1_Missense_Mutation_p.T71M|NIPAL2_uc003yim.1_Missense_Mutation_p.T275M	NM_024759	NP_079035	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	275						integral to membrane					0						CACTGTTGTCGTATTGTAGAG	0.393													47	72	---	---	---	---	capture	Missense_Mutation	SNP	99215392	99215392	NIPAL2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10332	71
KANK1	23189	broad.mit.edu	37	9	730069	730069	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:730069C>G	uc003zgl.1	+	8	3366	c.2717C>G	c.(2716-2718)ACC>AGC	p.T906S	KANK1_uc003zgm.2_Missense_Mutation_p.T906S|KANK1_uc003zgn.1_Missense_Mutation_p.T906S|KANK1_uc003zgs.1_Missense_Mutation_p.T748S|KANK1_uc010mgx.1_5'Flank|KANK1_uc010mgy.1_5'Flank	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a	906					negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TTGGGATATACCTGTAAGTGT	0.473													10	24	---	---	---	---	capture	Missense_Mutation	SNP	730069	730069	KANK1	9	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	7899	71
RUSC2	9853	broad.mit.edu	37	9	35560384	35560384	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35560384G>T	uc003zww.2	+	10	4002	c.3747G>T	c.(3745-3747)GAG>GAT	p.E1249D	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.E1249D	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1249	Poly-Glu.					cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			agacagaagaggtggcagagg	0.512													27	34	---	---	---	---	capture	Missense_Mutation	SNP	35560384	35560384	RUSC2	9	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	13643	71
TMEM2	23670	broad.mit.edu	37	9	74305126	74305126	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:74305126C>T	uc011lsa.1	-	22	4273	c.3733G>A	c.(3733-3735)GTC>ATC	p.V1245I	TMEM2_uc011lrz.1_Missense_Mutation_p.V238I|TMEM2_uc010mos.2_Missense_Mutation_p.V1182I|TMEM2_uc011lsb.1_RNA|TMEM2_uc004aik.2_Missense_Mutation_p.V79I	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	1245						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AGGAGGAGGACGCCTGCACTT	0.453													33	62	---	---	---	---	capture	Missense_Mutation	SNP	74305126	74305126	TMEM2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16004	71
TMC1	117531	broad.mit.edu	37	9	75387401	75387401	+	Missense_Mutation	SNP	A	T	T	rs111839361		TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:75387401A>T	uc004aiz.1	+	13	1354	c.814A>T	c.(814-816)AGG>TGG	p.R272W	TMC1_uc010moz.1_Missense_Mutation_p.R230W|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.R126W|TMC1_uc010mpa.1_Missense_Mutation_p.R126W	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	272	Extracellular (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						GATGAATTTCAGGTTGCCGCT	0.398													163	62	---	---	---	---	capture	Missense_Mutation	SNP	75387401	75387401	TMC1	9	A	T	T	T	1	0	0	0	0	1	0	0	0	88	7	4	4	15869	71
AGPAT2	10555	broad.mit.edu	37	9	139568283	139568283	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139568283C>A	uc004cii.1	-	6	860	c.758G>T	c.(757-759)AGG>ATG	p.R253M	AGPAT2_uc004cij.1_Missense_Mutation_p.R221M	NM_006412	NP_006403	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	253					phosphatidic acid biosynthetic process|positive regulation of cytokine production|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GAAGGTGGTCCTCATGGCCCG	0.682													5	21	---	---	---	---	capture	Missense_Mutation	SNP	139568283	139568283	AGPAT2	9	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	387	71
ASB11	140456	broad.mit.edu	37	X	15307657	15307657	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15307657C>A	uc004cwp.1	-	5	624	c.624G>T	c.(622-624)AGG>AGT	p.R208S	ASB11_uc004cwo.1_Missense_Mutation_p.R187S|ASB11_uc010nes.1_RNA|ASB11_uc010net.1_Missense_Mutation_p.R191S	NM_080873	NP_543149	Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box-containing protein	208	ANK 5.				intracellular signal transduction					breast(2)|skin(1)	3	Hepatocellular(33;0.183)					CACAGTCTACCCTCTGGTAGG	0.408													80	301	---	---	---	---	capture	Missense_Mutation	SNP	15307657	15307657	ASB11	23	C	A	A	A	1	0	0	0	0	1	0	0	0	285	22	4	4	1006	71
GRPR	2925	broad.mit.edu	37	X	16170433	16170433	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:16170433G>A	uc004cxj.2	+	3	1473	c.820G>A	c.(820-822)GCC>ACC	p.A274T		NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	274	Helical; Name=6; (Potential).				cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					GGGCCTGTTCGCCTTCTGCTG	0.537													66	211	---	---	---	---	capture	Missense_Mutation	SNP	16170433	16170433	GRPR	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6741	71
FTHL17	53940	broad.mit.edu	37	X	31089888	31089888	+	Silent	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:31089888G>A	uc004dcl.1	-	1	286	c.183C>T	c.(181-183)GAC>GAT	p.D61D		NM_031894	NP_114100	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	61	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity				0						CCATTTTGTCGTCCGACAGGC	0.577													107	85	---	---	---	---	capture	Silent	SNP	31089888	31089888	FTHL17	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6025	71
PAGE2B	389860	broad.mit.edu	37	X	55103027	55103027	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55103027G>A	uc004due.2	+	3	162	c.110G>A	c.(109-111)CGT>CAT	p.R37H		NM_001015038	NP_001015038	Q5JRK9	GGEE3_HUMAN	P antigen family, member 2B	37											0						GAGGAAAAACGTCAAGAAGAG	0.443													12	16	---	---	---	---	capture	Missense_Mutation	SNP	55103027	55103027	PAGE2B	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11295	71
RPS6KA6	27330	broad.mit.edu	37	X	83320106	83320106	+	Missense_Mutation	SNP	T	C	C	rs149201069	byFrequency	TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:83320106T>C	uc004eej.1	-	21	2062	c.1985A>G	c.(1984-1986)CAT>CGT	p.H662R	RPS6KA6_uc011mqt.1_Missense_Mutation_p.H662R|RPS6KA6_uc011mqu.1_Missense_Mutation_p.H559R	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	662	Protein kinase 2.				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						ATGAAGCATATGGGAAAGCAA	0.299													42	97	---	---	---	---	capture	Missense_Mutation	SNP	83320106	83320106	RPS6KA6	23	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	13547	71
KIAA1211	57482	broad.mit.edu	37	4	57189704	57189704	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57189704delA	uc003hbk.2	+	9	3740	c.3349delA	c.(3349-3351)AAAfs	p.K1117fs	KIAA1211_uc010iha.2_Frame_Shift_Del_p.K1110fs	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1117										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					CAGAGAGGCCAAACAGGCAGA	0.507													28	27	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	57189704	57189704	KIAA1211	4	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	8137	71
HIST1H3J	8356	broad.mit.edu	37	6	27858448	27858451	+	Frame_Shift_Del	DEL	GCGG	-	-			TCGA-06-0875-01	TCGA-06-0875-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27858448_27858451delGCGG	uc003nka.2	-	1	120_123	c.120_123delCCGC	c.(118-123)CACCGCfs	p.H40fs	HIST1H2BO_uc003nkc.1_5'Flank	NM_003535	NP_003526	P68431	H31_HUMAN	histone cluster 1, H3j	40_41					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						CTGGCCTGTAGCGGTGGGGCTTCT	0.632													18	99	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	27858448	27858451	HIST1H3J	6	GCGG	-	-	-	1	0	1	0	1	0	0	0	0	431	34	5	5	7089	71
