Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NPHP4	261734	broad.mit.edu	37	1	5965822	5965822	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:5965822C>T	uc001alq.1	-	14	1899	c.1633G>A	c.(1633-1635)GGT>AGT	p.G545S	NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_RNA|NPHP4_uc001alt.1_RNA|NPHP4_uc009vlu.1_5'Flank	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	545					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TGGGAGATACCGGCCTCCAAC	0.582													3	25	---	---	---	---	capture	Missense_Mutation	SNP	5965822	5965822	NPHP4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10488	73
PUM1	9698	broad.mit.edu	37	1	31479941	31479941	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31479941C>G	uc001bsi.1	-	4	554	c.441G>C	c.(439-441)TTG>TTC	p.L147F	PUM1_uc001bsg.1_5'Flank|PUM1_uc001bsh.1_Missense_Mutation_p.L147F|PUM1_uc001bsj.1_Missense_Mutation_p.L147F|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Missense_Mutation_p.L183F|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	147					cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TTTTACCTGGCAAGAGCTGCT	0.393													93	176	---	---	---	---	capture	Missense_Mutation	SNP	31479941	31479941	PUM1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	12720	73
IQCC	55721	broad.mit.edu	37	1	32671870	32671870	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32671870G>A	uc001bum.2	+	2	205	c.158G>A	c.(157-159)CGC>CAC	p.R53H	IQCC_uc009vua.2_Missense_Mutation_p.R133H|IQCC_uc010ogz.1_5'UTR|DCDC2B_uc001bun.2_5'Flank	NM_018134	NP_060604	Q4KMZ1	IQCC_HUMAN	IQ motif containing C isoform 2	53										ovary(4)	4		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACCGAGGGCCGCATTCCCAGG	0.612													4	167	---	---	---	---	capture	Missense_Mutation	SNP	32671870	32671870	IQCC	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7727	73
POLR3C	10623	broad.mit.edu	37	1	145608488	145608488	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145608488C>T	uc001eoh.2	-	3	480	c.319G>A	c.(319-321)GTT>ATT	p.V107I	NBPF10_uc001emp.3_Intron|RNF115_uc001eoj.2_5'Flank|RNF115_uc001eok.2_5'Flank|RNF115_uc009wiy.2_5'Flank|POLR3C_uc001eog.2_Missense_Mutation_p.V120I|POLR3C_uc001eoi.2_RNA|POLR3C_uc009wix.2_Missense_Mutation_p.V107I	NM_006468	NP_006459	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	107					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			AGCTCCTCAACAATCAGCTCT	0.493													61	119	---	---	---	---	capture	Missense_Mutation	SNP	145608488	145608488	POLR3C	1	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12132	73
C1orf129	80133	broad.mit.edu	37	1	170961347	170961347	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:170961347C>T	uc001ghg.2	+	12	1201	c.1071C>T	c.(1069-1071)AGC>AGT	p.S357S	C1orf129_uc009wvy.2_Silent_p.S164S|C1orf129_uc010plz.1_Silent_p.S357S	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	357							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTCAGGCGAGCGTGGCCCCTC	0.493													18	38	---	---	---	---	capture	Silent	SNP	170961347	170961347	C1orf129	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	1978	73
RYR2	6262	broad.mit.edu	37	1	237604756	237604756	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237604756C>T	uc001hyl.1	+	13	1263	c.1143C>T	c.(1141-1143)TCC>TCT	p.S381S		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	381	Cytoplasmic (By similarity).|MIR 5.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACGTGAAATCCGTGAGAATGG	0.348													46	104	---	---	---	---	capture	Silent	SNP	237604756	237604756	RYR2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13661	73
PLD5	200150	broad.mit.edu	37	1	242383388	242383388	+	Missense_Mutation	SNP	C	T	T	rs140243407	byFrequency	TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:242383388C>T	uc001hzn.1	-	5	764	c.637G>A	c.(637-639)GCT>ACT	p.A213T	PLD5_uc001hzl.3_Missense_Mutation_p.A151T|PLD5_uc001hzm.3_Missense_Mutation_p.A3T|PLD5_uc001hzo.1_Missense_Mutation_p.A121T			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	213						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TTGTTGTAAGCGGTCATGTTC	0.577													32	89	---	---	---	---	capture	Missense_Mutation	SNP	242383388	242383388	PLD5	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11952	73
OR2B11	127623	broad.mit.edu	37	1	247614785	247614785	+	Missense_Mutation	SNP	G	A	A	rs149375684	byFrequency	TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247614785G>A	uc010pyx.1	-	1	500	c.500C>T	c.(499-501)ACG>ATG	p.T167M		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	167	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CAATTGCACCGTCAGGACCAC	0.592													30	31	---	---	---	---	capture	Missense_Mutation	SNP	247614785	247614785	OR2B11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10892	73
ADAMTS14	140766	broad.mit.edu	37	10	72517795	72517795	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:72517795C>T	uc001jrh.2	+	20	3015	c.3015C>T	c.(3013-3015)TGC>TGT	p.C1005C	ADAMTS14_uc001jrg.2_Silent_p.C1008C	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1005	TSP type-1 4.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						TCGGGCATTGCGAGGGGGATA	0.667													27	12	---	---	---	---	capture	Silent	SNP	72517795	72517795	ADAMTS14	10	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	259	73
EIF3A	8661	broad.mit.edu	37	10	120801816	120801816	+	Silent	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:120801816C>G	uc001ldu.2	-	19	3362	c.3216G>C	c.(3214-3216)GGG>GGC	p.G1072G	EIF3A_uc010qsu.1_Silent_p.G1038G|EIF3A_uc009xzg.1_Silent_p.G111G	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	1072	15.|Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CATCATCCAACCCTCGCCTGG	0.637													6	226	---	---	---	---	capture	Silent	SNP	120801816	120801816	EIF3A	10	C	G	G	G	1	0	0	0	0	0	0	0	1	223	18	4	4	4967	73
DHX32	55760	broad.mit.edu	37	10	127527726	127527726	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:127527726G>C	uc001ljf.1	-	9	2216	c.1725C>G	c.(1723-1725)TTC>TTG	p.F575L	BCCIP_uc001ljd.3_Intron|DHX32_uc001lje.1_Missense_Mutation_p.F199L|DHX32_uc001ljg.1_Missense_Mutation_p.F575L|BCCIP_uc010qui.1_Intron|BCCIP_uc001ljc.3_Intron|BCCIP_uc010quj.1_Intron	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32	575						mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AACAGTTGAGGAAGTAATCAC	0.453													17	112	---	---	---	---	capture	Missense_Mutation	SNP	127527726	127527726	DHX32	10	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	4463	73
ELF5	2001	broad.mit.edu	37	11	34515184	34515184	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:34515184C>T	uc001mvo.1	-	3	457	c.227G>A	c.(226-228)TGC>TAC	p.C76Y	ELF5_uc001mvp.1_Missense_Mutation_p.C66Y|ELF5_uc009ykd.1_Intron|ELF5_uc001mvq.1_Missense_Mutation_p.C66Y	NM_198381	NP_938195	Q9UKW6	ELF5_HUMAN	E74-like factor 5 ESE-2a	76	PNT.				cell proliferation|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.0087)|all_hematologic(20;0.0384)				CTGGTCGCAGCAGAACTGGAG	0.527											OREG0020879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	47	---	---	---	---	capture	Missense_Mutation	SNP	34515184	34515184	ELF5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	5012	73
OR5D13	390142	broad.mit.edu	37	11	55541628	55541628	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55541628A>T	uc010ril.1	+	1	715	c.715A>T	c.(715-717)ACT>TCT	p.T239S		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	239	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				GCGCCAGAAAACTTTCTCCAC	0.418													63	111	---	---	---	---	capture	Missense_Mutation	SNP	55541628	55541628	OR5D13	11	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	11058	73
OR5L2	26338	broad.mit.edu	37	11	55594866	55594866	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55594866C>A	uc001nhy.1	+	1	172	c.172C>A	c.(172-174)CCC>ACC	p.P58T		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				GCTCCACACCCCCGTGTACTT	0.468										HNSCC(27;0.073)			123	278	---	---	---	---	capture	Missense_Mutation	SNP	55594866	55594866	OR5L2	11	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	11075	73
OR5W2	390148	broad.mit.edu	37	11	55681471	55681471	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55681471C>G	uc010rir.1	-	1	588	c.588G>C	c.(586-588)GAG>GAC	p.E196D		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						ATAACACTAACTCATTGACCT	0.383													45	85	---	---	---	---	capture	Missense_Mutation	SNP	55681471	55681471	OR5W2	11	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	11089	73
OR9G9	504191	broad.mit.edu	37	11	56468275	56468275	+	Nonsense_Mutation	SNP	A	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56468275A>T	uc010rjn.1	+	1	412	c.412A>T	c.(412-414)AAG>TAG	p.K138*		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CATGTCCATAAAGCTGTGTGC	0.493													57	291	---	---	---	---	capture	Nonsense_Mutation	SNP	56468275	56468275	OR9G9	11	A	T	T	T	1	0	0	0	0	0	1	0	0	13	1	5	4	11156	73
OR9G9	504191	broad.mit.edu	37	11	56468515	56468515	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56468515C>A	uc010rjn.1	+	1	652	c.652C>A	c.(652-654)CTC>ATC	p.L218I		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	218	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GGCCTCCTACCTCTTTATCAT	0.532													46	241	---	---	---	---	capture	Missense_Mutation	SNP	56468515	56468515	OR9G9	11	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	11156	73
HTR3B	9177	broad.mit.edu	37	11	113815368	113815368	+	Silent	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113815368C>G	uc001pok.2	+	8	1048	c.981C>G	c.(979-981)CTC>CTG	p.L327L	HTR3B_uc001pol.2_Silent_p.L316L	NM_006028	NP_006019	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B	327	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)		TCAAATTCCTCCATGATGAGC	0.557													39	89	---	---	---	---	capture	Silent	SNP	113815368	113815368	HTR3B	11	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	7370	73
MAP3K12	7786	broad.mit.edu	37	12	53875972	53875972	+	Missense_Mutation	SNP	C	T	T	rs149876591		TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53875972C>T	uc001sdm.1	-	14	2332	c.2234G>A	c.(2233-2235)CGC>CAC	p.R745H	MAP3K12_uc001sdn.1_Missense_Mutation_p.R778H	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase	745					histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)|skin(1)	5						TAGTGACTGGCGCATGTTCAG	0.512											OREG0021873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	153	147	---	---	---	---	capture	Missense_Mutation	SNP	53875972	53875972	MAP3K12	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9160	73
CUX2	23316	broad.mit.edu	37	12	111748125	111748125	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111748125C>T	uc001tsa.1	+	15	1692	c.1539C>T	c.(1537-1539)GGC>GGT	p.G513G		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	513	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						CCTTCTATGGCGCCAAGCCCC	0.741													3	2	---	---	---	---	capture	Silent	SNP	111748125	111748125	CUX2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4025	73
TMEM132B	114795	broad.mit.edu	37	12	125834741	125834741	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125834741C>G	uc001uhe.1	+	2	804	c.796C>G	c.(796-798)CCA>GCA	p.P266A		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	266	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GGTGGTCTACCCAACCCAAGA	0.577													170	194	---	---	---	---	capture	Missense_Mutation	SNP	125834741	125834741	TMEM132B	12	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	15930	73
TBC1D4	9882	broad.mit.edu	37	13	75933904	75933904	+	Splice_Site	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:75933904C>T	uc001vjl.1	-	3	1517	c.1170_splice	c.e3+1	p.Q390_splice	TBC1D4_uc010aer.2_Splice_Site_p.Q390_splice|TBC1D4_uc010aes.2_Splice_Site_p.Q390_splice	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		TTGATACATACCTGAGAACAA	0.313													31	70	---	---	---	---	capture	Splice_Site	SNP	75933904	75933904	TBC1D4	13	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	15509	73
SERPINA1	5265	broad.mit.edu	37	14	94849558	94849558	+	Missense_Mutation	SNP	G	A	A	rs140814100		TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94849558G>A	uc001ycx.3	-	2	278	c.17C>T	c.(16-18)TCG>TTG	p.S6L	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Missense_Mutation_p.S6L|SERPINA1_uc010aux.2_Missense_Mutation_p.S6L|SERPINA1_uc001ycy.3_Missense_Mutation_p.S6L|SERPINA1_uc010auy.2_Missense_Mutation_p.S6L|SERPINA1_uc001ycz.3_Missense_Mutation_p.S6L|SERPINA1_uc010auz.2_Missense_Mutation_p.S6L|SERPINA1_uc010ava.2_Missense_Mutation_p.S6L|SERPINA1_uc001ydb.3_Missense_Mutation_p.S6L|SERPINA1_uc010avb.2_Missense_Mutation_p.S6L|SERPINA1_uc001ydc.3_Missense_Mutation_p.S6L|SERPINA1_uc001yda.1_Missense_Mutation_p.S6L	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	6					acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)	GATGCCCCACGAGACAGAAGA	0.612									Alpha-1-Antitrypsin_Deficiency				16	32	---	---	---	---	capture	Missense_Mutation	SNP	94849558	94849558	SERPINA1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13979	73
SLC12A1	6557	broad.mit.edu	37	15	48566793	48566793	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:48566793G>A	uc001zwn.3	+	20	2644	c.2428G>A	c.(2428-2430)GTG>ATG	p.V810M	SLC12A1_uc010uew.1_Missense_Mutation_p.V616M|SLC12A1_uc001zwq.3_Missense_Mutation_p.V581M|SLC12A1_uc001zwr.3_Missense_Mutation_p.V537M	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	810	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TGAGATTGGCGTGGTTATAGT	0.338													19	33	---	---	---	---	capture	Missense_Mutation	SNP	48566793	48566793	SLC12A1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14275	73
ISLR2	57611	broad.mit.edu	37	15	74425374	74425374	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74425374C>T	uc002axd.2	+	4	1048	c.279C>T	c.(277-279)GGC>GGT	p.G93G	ISLR2_uc002axe.2_Silent_p.G93G|ISLR2_uc010bjg.2_Silent_p.G93G|ISLR2_uc010bjf.2_Silent_p.G93G	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	93	Extracellular (Potential).|LRR 2.				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						TGGAGCCAGGCGCACTGGCCG	0.637													30	75	---	---	---	---	capture	Silent	SNP	74425374	74425374	ISLR2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7782	73
PCSK6	5046	broad.mit.edu	37	15	101968175	101968175	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101968175G>T	uc002bwy.2	-	7	1059	c.745C>A	c.(745-747)CGT>AGT	p.R249S	PCSK6_uc010bpd.2_Missense_Mutation_p.R119S|PCSK6_uc010bpe.2_Missense_Mutation_p.R249S|PCSK6_uc002bxa.2_Missense_Mutation_p.R249S|PCSK6_uc002bxb.2_Missense_Mutation_p.R249S|PCSK6_uc002bxc.1_Missense_Mutation_p.R249S|PCSK6_uc002bxd.1_Missense_Mutation_p.R249S|PCSK6_uc002bxe.2_Missense_Mutation_p.R249S|PCSK6_uc002bxg.1_Missense_Mutation_p.R249S	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	249	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCCGCACAACGAGTGCCGTGT	0.512													4	2	---	---	---	---	capture	Missense_Mutation	SNP	101968175	101968175	PCSK6	15	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	11507	73
UBN1	29855	broad.mit.edu	37	16	4909917	4909917	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4909917G>A	uc002cyb.2	+	6	958	c.619G>A	c.(619-621)GAC>AAC	p.D207N	UBN1_uc010uxw.1_Missense_Mutation_p.D207N|UBN1_uc002cyc.2_Missense_Mutation_p.D207N	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	207	Lys-rich.				chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						GAAAAAAGATGACACTTATGA	0.443													33	47	---	---	---	---	capture	Missense_Mutation	SNP	4909917	4909917	UBN1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	16774	73
SLC12A3	6559	broad.mit.edu	37	16	56928513	56928513	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56928513C>T	uc010ccm.2	+	22	2621	c.2592C>T	c.(2590-2592)TTC>TTT	p.F864F	SLC12A3_uc002ekd.3_Silent_p.F873F|SLC12A3_uc010ccn.2_Silent_p.F872F	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	864	Cytoplasmic (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TCCGTGTGTTCGTAGGCGGCC	0.582													21	64	---	---	---	---	capture	Silent	SNP	56928513	56928513	SLC12A3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	14277	73
CPNE7	27132	broad.mit.edu	37	16	89656340	89656340	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89656340G>A	uc002fnp.2	+	13	1452	c.1322G>A	c.(1321-1323)CGG>CAG	p.R441Q	CPNE7_uc002fnq.2_Missense_Mutation_p.R366Q	NM_014427	NP_055242	Q9UBL6	CPNE7_HUMAN	copine 7 isoform b	441	VWFA.				lipid metabolic process		transporter activity				0		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		TTTGGAGCCCGGATCCCTCCC	0.622													22	36	---	---	---	---	capture	Missense_Mutation	SNP	89656340	89656340	CPNE7	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3782	73
TRPV2	51393	broad.mit.edu	37	17	16321183	16321183	+	Splice_Site	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16321183G>A	uc002gpy.2	+	2	567	c.200_splice	c.e2+1	p.S67_splice	TRPV2_uc002gpz.2_Splice_Site	NM_016113	NP_057197	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel,						sensory perception	integral to plasma membrane|melanosome	calcium channel activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CAGGTGCCAGGTGAGACAGCA	0.617													15	24	---	---	---	---	capture	Splice_Site	SNP	16321183	16321183	TRPV2	17	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	16479	73
EFCAB5	374786	broad.mit.edu	37	17	28434861	28434861	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:28434861G>A	uc002het.2	+	23	4523	c.4331G>A	c.(4330-4332)CGA>CAA	p.R1444Q	EFCAB5_uc010cse.2_Missense_Mutation_p.R1199Q|EFCAB5_uc010csf.2_Missense_Mutation_p.R795Q	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a	1444							calcium ion binding			ovary(1)|skin(1)	2						GATCATTCCCGAACTGAAGTA	0.308													3	56	---	---	---	---	capture	Missense_Mutation	SNP	28434861	28434861	EFCAB5	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4893	73
ERBB2	2064	broad.mit.edu	37	17	37884124	37884124	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37884124C>A	uc002hso.2	+	27	3833	c.3595C>A	c.(3595-3597)CCC>ACC	p.P1199T	ERBB2_uc002hsm.2_Missense_Mutation_p.P1169T|ERBB2_uc010cwa.2_Missense_Mutation_p.P1184T|ERBB2_uc002hsp.2_Missense_Mutation_p.P1002T|ERBB2_uc010cwb.2_3'UTR|ERBB2_uc010wek.1_Missense_Mutation_p.P923T	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	1199	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	GTACTTGACACCCCAGGGAGG	0.622		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			50	100	---	---	---	---	capture	Missense_Mutation	SNP	37884124	37884124	ERBB2	17	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	5161	73
AOC3	8639	broad.mit.edu	37	17	41003669	41003669	+	Silent	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41003669G>A	uc002ibv.2	+	1	469	c.309G>A	c.(307-309)CTG>CTA	p.L103L		NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor	103	Extracellular (Potential).				amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	AGTTGCAGCTGCCTCCCAAGG	0.672													45	82	---	---	---	---	capture	Silent	SNP	41003669	41003669	AOC3	17	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	721	73
GALNT1	2589	broad.mit.edu	37	18	33257555	33257555	+	Silent	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:33257555G>A	uc010dmu.2	+	4	368	c.315G>A	c.(313-315)GGG>GGA	p.G105G	GALNT1_uc002kyz.3_Silent_p.G45G|GALNT1_uc002kzb.2_Silent_p.G105G	NM_020474	NP_065207	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	105	Lumenal (Potential).				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						TTGTCTCTAGGTGTAAAACAA	0.383													70	135	---	---	---	---	capture	Silent	SNP	33257555	33257555	GALNT1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	561	44	2	2	6147	73
PARD6G	84552	broad.mit.edu	37	18	77918374	77918374	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77918374C>T	uc002lny.2	-	3	577	c.411G>A	c.(409-411)CCG>CCA	p.P137P	LOC100130522_uc002lnx.2_Intron|LOC100130522_uc010xfn.1_Intron|LOC100130522_uc010xfo.1_Intron	NM_032510	NP_115899	Q9BYG4	PAR6G_HUMAN	PAR-6 gamma protein	137	Pseudo-CRIB.|Interaction with PARD3 and CDC42 (By similarity).				cell cycle|cell division|tight junction assembly	cytosol|tight junction	protein binding				0		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		GGAAGTCGCGCGGGAGGCCGA	0.731													5	11	---	---	---	---	capture	Silent	SNP	77918374	77918374	PARD6G	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11351	73
C3	718	broad.mit.edu	37	19	6680227	6680227	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6680227G>T	uc002mfm.2	-	36	4460	c.4398C>A	c.(4396-4398)TAC>TAA	p.Y1466*	C3_uc002mfl.2_Nonsense_Mutation_p.Y202*	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1466					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		CTACATTAAAGTATTGGTGAA	0.542													49	158	---	---	---	---	capture	Nonsense_Mutation	SNP	6680227	6680227	C3	19	G	T	T	T	1	0	0	0	0	0	1	0	0	464	36	5	4	2184	73
EMR1	2015	broad.mit.edu	37	19	6913826	6913826	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6913826C>T	uc002mfw.2	+	11	1323	c.1285C>T	c.(1285-1287)CGG>TGG	p.R429W	EMR1_uc010dvc.2_Missense_Mutation_p.R429W|EMR1_uc010dvb.2_Missense_Mutation_p.R377W|EMR1_uc010xji.1_Missense_Mutation_p.R288W|EMR1_uc010xjj.1_Missense_Mutation_p.R252W	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	429	Ser/Thr-rich.|Extracellular (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					TCCGGCTGTTCGGACGGAATA	0.498													69	218	---	---	---	---	capture	Missense_Mutation	SNP	6913826	6913826	EMR1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	5059	73
GMIP	51291	broad.mit.edu	37	19	19745707	19745707	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19745707C>T	uc002nnd.2	-	17	1898	c.1781G>A	c.(1780-1782)CGT>CAT	p.R594H	GMIP_uc010xrb.1_Missense_Mutation_p.R568H|GMIP_uc010xrc.1_Missense_Mutation_p.R565H	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	594	Rho-GAP.				negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						CCGCTCCACACGGACCCGGGA	0.592													35	120	---	---	---	---	capture	Missense_Mutation	SNP	19745707	19745707	GMIP	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6427	73
CD22	933	broad.mit.edu	37	19	35837554	35837554	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35837554G>A	uc010edt.2	+	14	2575	c.2498G>A	c.(2497-2499)CGG>CAG	p.R833Q	CD22_uc010xst.1_Missense_Mutation_p.R661Q|CD22_uc010edu.2_Missense_Mutation_p.R745Q|CD22_uc010edv.2_3'UTR|CD22_uc002nzb.3_Missense_Mutation_p.R656Q|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	833	Cytoplasmic (Potential).				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	GTCGGGGAGCGGCCTCAGGCA	0.547													17	31	---	---	---	---	capture	Missense_Mutation	SNP	35837554	35837554	CD22	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2956	73
SIPA1L3	23094	broad.mit.edu	37	19	38633315	38633315	+	Silent	SNP	G	T	T	rs142547881		TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38633315G>T	uc002ohk.2	+	12	4007	c.3498G>T	c.(3496-3498)TCG>TCT	p.S1166S		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	1166					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCCCCGGTTCGGCCACCTACG	0.468											OREG0025445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	140	383	---	---	---	---	capture	Silent	SNP	38633315	38633315	SIPA1L3	19	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	14224	73
LGALS13	29124	broad.mit.edu	37	19	40097889	40097889	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40097889C>T	uc002omb.2	+	4	370	c.330C>T	c.(328-330)TAC>TAT	p.Y110Y		NM_013268	NP_037400	Q9UHV8	PP13_HUMAN	galectin-13	110	Galectin.				lipid catabolic process|phospholipid metabolic process		carboxylesterase activity|lysophospholipase activity|sugar binding			ovary(1)	1	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			TACGCATTTACGGCTTTGTCC	0.463													43	124	---	---	---	---	capture	Silent	SNP	40097889	40097889	LGALS13	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8660	73
RUVBL2	10856	broad.mit.edu	37	19	49507675	49507675	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49507675G>A	uc002plr.1	+	4	278	c.265G>A	c.(265-267)GGC>AGC	p.G89S	RUVBL2_uc002plq.1_Missense_Mutation_p.G44S|RUVBL2_uc010yab.1_Missense_Mutation_p.G89S|RUVBL2_uc002pls.1_RNA|RUVBL2_uc010emn.1_Missense_Mutation_p.G44S|RUVBL2_uc010yac.1_Missense_Mutation_p.G44S	NM_006666	NP_006657	Q9Y230	RUVB2_HUMAN	RuvB-like 2	89					cellular response to UV|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|protein folding|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|membrane|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|ATP-dependent DNA helicase activity|damaged DNA binding|identical protein binding|unfolded protein binding				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		CATCGCCATGGGTAAGAAACC	0.468													41	115	---	---	---	---	capture	Missense_Mutation	SNP	49507675	49507675	RUVBL2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13645	73
ZNF534	147658	broad.mit.edu	37	19	52942496	52942496	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52942496C>T	uc002pzk.2	+	4	1883	c.1822C>T	c.(1822-1824)CGA>TGA	p.R608*	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Nonsense_Mutation_p.R595*	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	608	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACACCTTGCGCGACATAGGAA	0.423													5	12	---	---	---	---	capture	Nonsense_Mutation	SNP	52942496	52942496	ZNF534	19	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	17852	73
ZSCAN5B	342933	broad.mit.edu	37	19	56701664	56701664	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56701664C>T	uc010ygh.1	-	4	1020	c.1020G>A	c.(1018-1020)CCG>CCA	p.P340P		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	340					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						GGTGACTGACCGGGCCCGCAG	0.542													45	199	---	---	---	---	capture	Silent	SNP	56701664	56701664	ZSCAN5B	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	18115	73
RPS5	6193	broad.mit.edu	37	19	58904370	58904370	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58904370G>T	uc002qsn.2	+	3	208	c.136G>T	c.(136-138)GCC>TCC	p.A46S	RPS5_uc002qso.2_Missense_Mutation_p.A46S	NM_001009	NP_001000	P46782	RS5_HUMAN	ribosomal protein S5	46					endocrine pancreas development|regulation of translational fidelity|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|structural constituent of ribosome				0		all_cancers(17;1.71e-22)|all_epithelial(17;1.69e-16)|Lung NSC(17;2.25e-06)|all_lung(17;9.97e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Breast(46;0.0194)|Ovarian(87;0.0443)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.171)|GBM - Glioblastoma multiforme(193;0.0323)|Lung(386;0.0543)|LUSC - Lung squamous cell carcinoma(496;0.176)		GGAGAAGTATGCCAAGTACCT	0.557													16	60	---	---	---	---	capture	Missense_Mutation	SNP	58904370	58904370	RPS5	19	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	13540	73
CLIP4	79745	broad.mit.edu	37	2	29386734	29386734	+	Silent	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:29386734C>G	uc002rmv.2	+	13	1811	c.1572C>G	c.(1570-1572)GGC>GGG	p.G524G	CLIP4_uc002rmu.2_Silent_p.G524G|CLIP4_uc002rmw.2_RNA	NM_024692	NP_078968	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family,	524	CAP-Gly 2.									ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					AACCCCATGGCAAGAATGATG	0.388													103	110	---	---	---	---	capture	Silent	SNP	29386734	29386734	CLIP4	2	C	G	G	G	1	0	0	0	0	0	0	0	1	314	25	4	4	3500	73
ACTG2	72	broad.mit.edu	37	2	74128551	74128551	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74128551G>A	uc002sjw.2	+	2	235	c.113G>A	c.(112-114)CGC>CAC	p.R38H	ACTG2_uc010fex.1_Missense_Mutation_p.R38H|ACTG2_uc010fey.2_Missense_Mutation_p.R38H|ACTG2_uc010yrn.1_Missense_Mutation_p.R38H	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide	38					muscle contraction	cytoskeleton|cytosol	ATP binding				0						ATTGTGGGCCGCCCTCGCCAC	0.637													37	102	---	---	---	---	capture	Missense_Mutation	SNP	74128551	74128551	ACTG2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	197	73
CNTNAP5	129684	broad.mit.edu	37	2	125547685	125547685	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125547685A>T	uc002tno.2	+	18	3320	c.2956A>T	c.(2956-2958)AAT>TAT	p.N986Y	CNTNAP5_uc010flu.2_Missense_Mutation_p.N987Y	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	986	EGF-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGATTGCACCAATTCACCTTA	0.552													53	39	---	---	---	---	capture	Missense_Mutation	SNP	125547685	125547685	CNTNAP5	2	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	3615	73
CDCA7	83879	broad.mit.edu	37	2	174231123	174231123	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:174231123G>A	uc002uid.1	+	7	1042	c.911G>A	c.(910-912)CGT>CAT	p.R304H	CDCA7_uc002uic.1_Missense_Mutation_p.R383H|CDCA7_uc010zej.1_Missense_Mutation_p.R339H|CDCA7_uc010zek.1_Missense_Mutation_p.R262H	NM_145810	NP_665809	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7 isoform 2	304	Mediates transcriptional activity.				regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.116)			CTTCGAAACCGTTATGGTGAA	0.557													72	244	---	---	---	---	capture	Missense_Mutation	SNP	174231123	174231123	CDCA7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3061	73
OSBPL6	114880	broad.mit.edu	37	2	179238622	179238622	+	Silent	SNP	T	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179238622T>G	uc002ulx.2	+	15	1779	c.1401T>G	c.(1399-1401)GGT>GGG	p.G467G	OSBPL6_uc002ulw.2_Silent_p.G400G|OSBPL6_uc002uly.2_Silent_p.G492G|OSBPL6_uc010zfe.1_Silent_p.G436G|OSBPL6_uc002ulz.2_Silent_p.G431G|OSBPL6_uc002uma.2_Silent_p.G471G	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	467					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TGCAGGCTGGTGAGCAAATCC	0.438													8	81	---	---	---	---	capture	Silent	SNP	179238622	179238622	OSBPL6	2	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	11185	73
IRS1	3667	broad.mit.edu	37	2	227661504	227661504	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227661504T>C	uc002voh.3	-	1	2003	c.1951A>G	c.(1951-1953)AGA>GGA	p.R651G		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	651					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGATGGCGTCTGATGGGATTG	0.562											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	69	83	---	---	---	---	capture	Missense_Mutation	SNP	227661504	227661504	IRS1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	7763	73
KIF16B	55614	broad.mit.edu	37	20	16407806	16407806	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:16407806C>A	uc002wpg.1	-	15	1713	c.1555G>T	c.(1555-1557)GGG>TGG	p.G519W	KIF16B_uc010gch.1_Missense_Mutation_p.G519W|KIF16B_uc010gci.1_Missense_Mutation_p.G519W|KIF16B_uc010gcj.1_Missense_Mutation_p.G519W	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	519	FHA.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CACTGGGACCCACTCAGGGGT	0.428													100	252	---	---	---	---	capture	Missense_Mutation	SNP	16407806	16407806	KIF16B	20	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	8200	73
DIDO1	11083	broad.mit.edu	37	20	61542712	61542712	+	Missense_Mutation	SNP	C	T	T	rs138139875		TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61542712C>T	uc002ydr.1	-	3	517	c.253G>A	c.(253-255)GGC>AGC	p.G85S	DIDO1_uc002yds.1_Missense_Mutation_p.G85S|DIDO1_uc002ydt.1_Missense_Mutation_p.G85S|DIDO1_uc002ydu.1_Missense_Mutation_p.G85S|DIDO1_uc002ydv.1_Missense_Mutation_p.G85S|DIDO1_uc002ydw.1_Missense_Mutation_p.G85S|DIDO1_uc002ydx.1_Missense_Mutation_p.G85S|DIDO1_uc011aao.1_Missense_Mutation_p.G85S	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	85					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					CTCCTCCTGCCGCGGCGCCGC	0.701													17	58	---	---	---	---	capture	Missense_Mutation	SNP	61542712	61542712	DIDO1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4480	73
COL6A1	1291	broad.mit.edu	37	21	47412280	47412280	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47412280A>T	uc002zhu.1	+	18	1342	c.1240A>T	c.(1240-1242)AAC>TAC	p.N414Y		NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	414	Triple-helical region.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	ATCCCAGGGGAACCCAGGACC	0.637													9	30	---	---	---	---	capture	Missense_Mutation	SNP	47412280	47412280	COL6A1	21	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	3664	73
HIRA	7290	broad.mit.edu	37	22	19318996	19318996	+	Silent	SNP	A	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19318996A>G	uc002zpf.1	-	25	3241	c.3021T>C	c.(3019-3021)TGT>TGC	p.C1007C	HIRA_uc011agx.1_Missense_Mutation_p.S844P|HIRA_uc010grn.1_Silent_p.C800C|HIRA_uc010gro.1_Silent_p.C963C	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective	1007	Interaction with histone H4.				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					GCTGTTCCTGACACTCGGTGA	0.617													3	109	---	---	---	---	capture	Silent	SNP	19318996	19318996	HIRA	22	A	G	G	G	1	0	0	0	0	0	0	0	1	128	10	3	3	7045	73
VPREB1	7441	broad.mit.edu	37	22	22599423	22599423	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22599423C>T	uc002zvx.1	+	2	138	c.112C>T	c.(112-114)CGC>TGC	p.R38C	LOC96610_uc011aim.1_Intron	NM_007128	NP_009059	P12018	VPREB_HUMAN	immunoglobulin iota chain precursor	38	Framework-1.|Ig-like V-type.				immune response	extracellular region	antigen binding|protein binding				0	all_hematologic(9;0.0312)|Acute lymphoblastic leukemia(84;0.155)	all_cancers(3;3.14e-14)|Acute lymphoblastic leukemia(3;2.97e-57)|all_hematologic(3;5.9e-52)		READ - Rectum adenocarcinoma(21;0.145)		AACCACAATCCGCCTCACCTG	0.632													43	78	---	---	---	---	capture	Missense_Mutation	SNP	22599423	22599423	VPREB1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17068	73
EOMES	8320	broad.mit.edu	37	3	27761789	27761789	+	Silent	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:27761789G>A	uc003cdx.2	-	2	909	c.909C>T	c.(907-909)AAC>AAT	p.N303N	EOMES_uc003cdy.3_Silent_p.N303N|EOMES_uc010hfn.2_Silent_p.N303N|EOMES_uc011axc.1_Silent_p.N8N	NM_005442	NP_005433	O95936	EOMES_HUMAN	eomesodermin	303	T-box.				CD8-positive, alpha-beta T cell differentiation involved in immune response|cell differentiation involved in embryonic placenta development|endoderm formation|mesoderm formation|mesodermal to mesenchymal transition involved in gastrulation|positive regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|breast(1)	4						GTCCGTTTATGTTGAAGCTCA	0.532													114	133	---	---	---	---	capture	Silent	SNP	27761789	27761789	EOMES	3	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	5102	73
ZNF197	10168	broad.mit.edu	37	3	44685661	44685661	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:44685661C>G	uc003cnm.2	+	6	3245	c.3039C>G	c.(3037-3039)TTC>TTG	p.F1013L	ZNF197_uc003cnn.2_Intron|ZNF197_uc003cno.2_Intron|ZNF197_uc003cnp.2_Intron	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1	1013					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		TTGAGGAATTCTCTTGGCTAC	0.363													38	53	---	---	---	---	capture	Missense_Mutation	SNP	44685661	44685661	ZNF197	3	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	17639	73
ITIH3	3699	broad.mit.edu	37	3	52840313	52840313	+	Silent	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52840313C>T	uc003dfv.2	+	18	1983	c.1947C>T	c.(1945-1947)GAC>GAT	p.D649D	ITIH3_uc011bek.1_Intron	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	649					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CACCAGTGGACGGGGATCCCC	0.582													20	31	---	---	---	---	capture	Silent	SNP	52840313	52840313	ITIH3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7828	73
EPHA3	2042	broad.mit.edu	37	3	89468496	89468496	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:89468496T>A	uc003dqy.2	+	11	2255	c.2030T>A	c.(2029-2031)TTT>TAT	p.F677Y	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	677	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		ATGGGACAGTTTGACCACCCC	0.413										TSP Lung(6;0.00050)			50	81	---	---	---	---	capture	Missense_Mutation	SNP	89468496	89468496	EPHA3	3	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	5123	73
ADCY5	111	broad.mit.edu	37	3	123166426	123166426	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123166426G>A	uc003egh.1	-	1	967	c.967C>T	c.(967-969)CGC>TGC	p.R323C		NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	323					activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		GAGGCGCTGCGTGGCTGCGGC	0.687													6	8	---	---	---	---	capture	Missense_Mutation	SNP	123166426	123166426	ADCY5	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	297	73
TRH	7200	broad.mit.edu	37	3	129694827	129694827	+	Silent	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129694827G>A	uc003enc.2	+	2	729	c.168G>A	c.(166-168)CGG>CGA	p.R56R		NM_007117	NP_009048	P20396	TRH_HUMAN	thyrotropin-releasing hormone	56					cell-cell signaling|hormone-mediated signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|thyrotropin-releasing hormone activity			ovary(1)	1						TCTTCCTCCGGGAAAACATCC	0.672													12	27	---	---	---	---	capture	Silent	SNP	129694827	129694827	TRH	3	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	16361	73
DGKG	1608	broad.mit.edu	37	3	186015248	186015248	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186015248T>G	uc003fqa.2	-	5	872	c.335A>C	c.(334-336)AAT>ACT	p.N112T	DGKG_uc003fqb.2_Missense_Mutation_p.N112T|DGKG_uc003fqc.2_Missense_Mutation_p.N112T|DGKG_uc011brx.1_Missense_Mutation_p.N112T	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1	112					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TTTGGTGGCATTATCTGCATT	0.458													45	139	---	---	---	---	capture	Missense_Mutation	SNP	186015248	186015248	DGKG	3	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	4427	73
TLR6	10333	broad.mit.edu	37	4	38829222	38829222	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38829222G>A	uc003gtm.2	-	1	1939	c.1873C>T	c.(1873-1875)CGG>TGG	p.R625W	TLR6_uc010ifg.1_Missense_Mutation_p.R625W	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	625	Cytoplasmic (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						GCCCTGCGCCGAGTCTGGGTC	0.512													77	157	---	---	---	---	capture	Missense_Mutation	SNP	38829222	38829222	TLR6	4	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	15840	73
UGT2B10	7365	broad.mit.edu	37	4	69696459	69696459	+	Silent	SNP	C	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69696459C>G	uc003hee.2	+	6	1474	c.1449C>G	c.(1447-1449)ACC>ACG	p.T483T	UGT2B10_uc011cam.1_Silent_p.T399T	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	483					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						ACAACCTCACCTGGTTCCAGT	0.483													88	189	---	---	---	---	capture	Silent	SNP	69696459	69696459	UGT2B10	4	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	16838	73
PROL1	58503	broad.mit.edu	37	4	71275346	71275346	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71275346G>T	uc003hfi.2	+	3	475	c.301G>T	c.(301-303)GGT>TGT	p.G101C		NM_021225	NP_067048	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	101	Pro-rich.				regulation of sensory perception of pain	extracellular region	endopeptidase inhibitor activity			large_intestine(1)	1		all_hematologic(202;0.196)				ACTCTTTCCGGGTTATCCAAA	0.398													158	305	---	---	---	---	capture	Missense_Mutation	SNP	71275346	71275346	PROL1	4	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	12450	73
AFM	173	broad.mit.edu	37	4	74365895	74365895	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74365895G>A	uc003hhb.2	+	12	1628	c.1597G>A	c.(1597-1599)GCA>ACA	p.A533T		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	533	Albumin 3.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TACCTTTCACGCAGACATGTG	0.393													26	45	---	---	---	---	capture	Missense_Mutation	SNP	74365895	74365895	AFM	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	361	73
ADAMTS16	170690	broad.mit.edu	37	5	5146486	5146486	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5146486C>T	uc003jdl.2	+	3	557	c.419C>T	c.(418-420)CCG>CTG	p.P140L	ADAMTS16_uc003jdk.1_Missense_Mutation_p.P140L|ADAMTS16_uc003jdj.1_Missense_Mutation_p.P140L	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	140					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CAGACTTTACCGCCAGAGGAC	0.522													77	163	---	---	---	---	capture	Missense_Mutation	SNP	5146486	5146486	ADAMTS16	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	261	73
RICTOR	253260	broad.mit.edu	37	5	38972038	38972038	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:38972038C>T	uc003jlp.2	-	11	937	c.913G>A	c.(913-915)GGA>AGA	p.G305R	RICTOR_uc003jlo.2_Missense_Mutation_p.G305R|RICTOR_uc010ivf.2_Missense_Mutation_p.G20R|RICTOR_uc003jlq.1_Missense_Mutation_p.G289R	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	305					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CCAGAATTTCCAGGTTTACAT	0.299													17	44	---	---	---	---	capture	Missense_Mutation	SNP	38972038	38972038	RICTOR	5	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	13250	73
PIK3R1	5295	broad.mit.edu	37	5	67589138	67589138	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589138G>A	uc003jva.2	+	10	1686	c.1126G>A	c.(1126-1128)GGA>AGA	p.G376R	PIK3R1_uc003jvb.2_Missense_Mutation_p.G376R|PIK3R1_uc003jvc.2_Missense_Mutation_p.G76R|PIK3R1_uc003jvd.2_Missense_Mutation_p.G106R|PIK3R1_uc003jve.2_Missense_Mutation_p.G55R|PIK3R1_uc011crb.1_Missense_Mutation_p.G46R	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	376	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.G376R(3)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CAGGAAAGGGGGAAATAACAA	0.308			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			35	74	---	---	---	---	capture	Missense_Mutation	SNP	67589138	67589138	PIK3R1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11821	73
ATP10B	23120	broad.mit.edu	37	5	160047524	160047524	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160047524C>T	uc003lym.1	-	15	3093	c.2246G>A	c.(2245-2247)CGC>CAC	p.R749H	ATP10B_uc010jit.1_Missense_Mutation_p.R66H|ATP10B_uc003lyn.2_Missense_Mutation_p.R307H	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	749	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGGGGCAGGCGCACAGTCAC	0.612													26	32	---	---	---	---	capture	Missense_Mutation	SNP	160047524	160047524	ATP10B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1108	73
ALDH5A1	7915	broad.mit.edu	37	6	24502755	24502755	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:24502755G>A	uc003neg.2	+	2	387	c.359G>A	c.(358-360)AGG>AAG	p.R120K	ALDH5A1_uc003nef.2_Missense_Mutation_p.R120K	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor	120					acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)	TTGCAGGAGAGGAGTTCATTA	0.343													30	52	---	---	---	---	capture	Missense_Mutation	SNP	24502755	24502755	ALDH5A1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	502	73
C6orf138	442213	broad.mit.edu	37	6	47976593	47976593	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47976593C>A	uc011dwm.1	-	2	718	c.633G>T	c.(631-633)AAG>AAT	p.K211N	C6orf138_uc011dwn.1_5'UTR|C6orf138_uc003ozf.2_Missense_Mutation_p.K228N	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	228						integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						GGATGCTGGTCTTATGAAAGT	0.522													25	54	---	---	---	---	capture	Missense_Mutation	SNP	47976593	47976593	C6orf138	6	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	2309	73
RHAG	6005	broad.mit.edu	37	6	49574864	49574864	+	Silent	SNP	T	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49574864T>G	uc003ozk.3	-	8	1199	c.1137A>C	c.(1135-1137)ACA>ACC	p.T379T	RHAG_uc010jzl.2_Silent_p.T379T|RHAG_uc010jzm.2_Silent_p.R339R	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	379	Helical; (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					TATGCTGACCTGTCATCAGAC	0.398													9	40	---	---	---	---	capture	Silent	SNP	49574864	49574864	RHAG	6	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	13207	73
GSTA4	2941	broad.mit.edu	37	6	52850344	52850344	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52850344T>G	uc003pbc.2	-	3	241	c.177A>C	c.(175-177)GAA>GAC	p.E59D	GSTA4_uc003pbd.2_5'UTR|GSTA4_uc003pbe.2_Intron|GSTA4_uc003pbf.2_Missense_Mutation_p.E59D	NM_001512	NP_001503	O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	59	GST N-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity				0	Lung NSC(77;0.103)				Glutathione(DB00143)	TCCCGTCAATTTCAACCATGG	0.468													60	121	---	---	---	---	capture	Missense_Mutation	SNP	52850344	52850344	GSTA4	6	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	6765	73
AMD1	262	broad.mit.edu	37	6	111210086	111210086	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:111210086G>A	uc003puk.1	+	3	546	c.224G>A	c.(223-225)AGA>AAA	p.R75K	AMD1_uc011eay.1_Missense_Mutation_p.R6K|AMD1_uc011eaz.1_Missense_Mutation_p.R46K|AMD1_uc011eba.1_Intron|AMD1_uc003pul.1_Intron	NM_001634	NP_001625	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1 isoform 1	75					spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity			upper_aerodigestive_tract(1)	1		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	GTCTCCAAGAGACGTTTCATT	0.393													60	108	---	---	---	---	capture	Missense_Mutation	SNP	111210086	111210086	AMD1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	566	73
CCDC129	223075	broad.mit.edu	37	7	31614192	31614192	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31614192T>C	uc003tcj.1	+	7	1427	c.434T>C	c.(433-435)GTG>GCG	p.V145A	CCDC129_uc011kad.1_Missense_Mutation_p.V155A|CCDC129_uc003tci.1_Missense_Mutation_p.V144A|CCDC129_uc011kae.1_Missense_Mutation_p.V171A|CCDC129_uc003tck.1_Missense_Mutation_p.V53A	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	145											0						ATAGATCCAGTGGAGATTCTC	0.443													87	214	---	---	---	---	capture	Missense_Mutation	SNP	31614192	31614192	CCDC129	7	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	2738	73
NPTX2	4885	broad.mit.edu	37	7	98254242	98254242	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98254242G>A	uc003upl.2	+	3	829	c.652G>A	c.(652-654)GCC>ACC	p.A218T		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	218					synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			AGGCAATAGCGCCTTTAAGTC	0.582													176	556	---	---	---	---	capture	Missense_Mutation	SNP	98254242	98254242	NPTX2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10510	73
SLC26A4	5172	broad.mit.edu	37	7	107350617	107350617	+	Silent	SNP	A	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107350617A>G	uc003vep.2	+	19	2432	c.2208A>G	c.(2206-2208)CAA>CAG	p.Q736Q	SLC26A4_uc011kmb.1_Silent_p.Q323Q|SLC26A4_uc011kmc.1_Silent_p.Q297Q|SLC26A4_uc011kmd.1_Silent_p.Q305Q	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	736	Cytoplasmic (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						TGAAATCTCAAGAGGGTCAAG	0.363									Pendred_syndrome				48	103	---	---	---	---	capture	Silent	SNP	107350617	107350617	SLC26A4	7	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	14411	73
SHH	6469	broad.mit.edu	37	7	155599026	155599026	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:155599026C>T	uc003wmk.1	-	2	677	c.526G>A	c.(526-528)GAG>AAG	p.E176K	SHH_uc003wmh.1_RNA|SHH_uc003wmi.1_Missense_Mutation_p.E89K|SHH_uc003wmj.1_Missense_Mutation_p.E89K	NM_000193	NP_000184	Q15465	SHH_HUMAN	sonic hedgehog preproprotein	176			Missing (in HPE3).		androgen metabolic process|axon guidance|branching involved in ureteric bud morphogenesis|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment|embryonic digit morphogenesis|hindbrain development|intein-mediated protein splicing|lymphoid progenitor cell differentiation|metanephric mesenchymal cell proliferation involved in metanephros development|midbrain development|negative regulation of cell migration|negative regulation of kidney smooth muscle cell differentiation|negative regulation of ureter smooth muscle cell differentiation|negative thymic T cell selection|neural crest cell migration|neuroblast proliferation|patterning of blood vessels|positive regulation of alpha-beta T cell differentiation|positive regulation of immature T cell proliferation in thymus|positive regulation of kidney smooth muscle cell differentiation|positive regulation of mesenchymal cell proliferation involved in ureter development|positive regulation of T cell differentiation in thymus|positive regulation of ureter smooth muscle cell differentiation|positive thymic T cell selection|proteolysis|sclerotome development|stem cell development|thymus development|vasculogenesis|ventral midline development	cell surface|extracellular space|membrane raft|plasma membrane	calcium ion binding|laminin-1 binding|peptidase activity|signal transducer activity|zinc ion binding			central_nervous_system(3)|lung(1)	4	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCTTGGACTCGTAGTACACC	0.652													52	134	---	---	---	---	capture	Missense_Mutation	SNP	155599026	155599026	SHH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14172	73
SHH	6469	broad.mit.edu	37	7	155599041	155599041	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:155599041C>T	uc003wmk.1	-	2	662	c.511G>A	c.(511-513)GAC>AAC	p.D171N	SHH_uc003wmh.1_RNA|SHH_uc003wmi.1_Missense_Mutation_p.D84N|SHH_uc003wmj.1_Missense_Mutation_p.D84N	NM_000193	NP_000184	Q15465	SHH_HUMAN	sonic hedgehog preproprotein	171			D -> H (in HPE3).		androgen metabolic process|axon guidance|branching involved in ureteric bud morphogenesis|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment|embryonic digit morphogenesis|hindbrain development|intein-mediated protein splicing|lymphoid progenitor cell differentiation|metanephric mesenchymal cell proliferation involved in metanephros development|midbrain development|negative regulation of cell migration|negative regulation of kidney smooth muscle cell differentiation|negative regulation of ureter smooth muscle cell differentiation|negative thymic T cell selection|neural crest cell migration|neuroblast proliferation|patterning of blood vessels|positive regulation of alpha-beta T cell differentiation|positive regulation of immature T cell proliferation in thymus|positive regulation of kidney smooth muscle cell differentiation|positive regulation of mesenchymal cell proliferation involved in ureter development|positive regulation of T cell differentiation in thymus|positive regulation of ureter smooth muscle cell differentiation|positive thymic T cell selection|proteolysis|sclerotome development|stem cell development|thymus development|vasculogenesis|ventral midline development	cell surface|extracellular space|membrane raft|plasma membrane	calcium ion binding|laminin-1 binding|peptidase activity|signal transducer activity|zinc ion binding			central_nervous_system(3)|lung(1)	4	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TACACCCAGTCGAAGCCGGCC	0.652													39	110	---	---	---	---	capture	Missense_Mutation	SNP	155599041	155599041	SHH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14172	73
DLC1	10395	broad.mit.edu	37	8	12952442	12952442	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:12952442C>T	uc003wwm.2	-	12	3796	c.3352G>A	c.(3352-3354)GTC>ATC	p.V1118I	DLC1_uc003wwk.1_Missense_Mutation_p.V681I|DLC1_uc003wwl.1_Missense_Mutation_p.V715I|DLC1_uc011kxx.1_Missense_Mutation_p.V607I	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1118	Rho-GAP.				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						CGGGACTTGACCCCCGATTTT	0.507													4	57	---	---	---	---	capture	Missense_Mutation	SNP	12952442	12952442	DLC1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	4508	73
ELP3	55140	broad.mit.edu	37	8	28017799	28017799	+	Silent	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:28017799G>A	uc003xgo.3	+	13	1459	c.1311G>A	c.(1309-1311)TTG>TTA	p.L437L	ELP3_uc003xgn.3_Silent_p.L422L|ELP3_uc011laq.1_Silent_p.L365L|ELP3_uc011lar.1_Silent_p.L345L|ELP3_uc011las.1_Silent_p.L318L|ELP3_uc011lat.1_Silent_p.L318L	NM_018091	NP_060561	Q9H9T3	ELP3_HUMAN	elongation protein 3 homolog	437	N-acetyltransferase.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	histone acetyltransferase activity|iron-sulfur cluster binding|metal ion binding|phosphorylase kinase regulator activity|protein binding				0		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		AAACATTCTTGTCATACGAAG	0.383													32	56	---	---	---	---	capture	Silent	SNP	28017799	28017799	ELP3	8	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	5036	73
CHD7	55636	broad.mit.edu	37	8	61764695	61764695	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:61764695A>T	uc003xue.2	+	29	6260	c.5783A>T	c.(5782-5784)CAG>CTG	p.Q1928L		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1928					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AAAAGGCAACAGATGAGGCAA	0.527													31	66	---	---	---	---	capture	Missense_Mutation	SNP	61764695	61764695	CHD7	8	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	3296	73
SLCO5A1	81796	broad.mit.edu	37	8	70744582	70744582	+	Silent	SNP	G	A	A	rs145247874		TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70744582G>A	uc003xyl.2	-	2	1034	c.327C>T	c.(325-327)TCC>TCT	p.S109S	SLCO5A1_uc010lzb.2_Silent_p.S109S|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Silent_p.S109S|SLCO5A1_uc010lzc.2_Silent_p.S109S	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	109	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TGGCCAAGGCGGAGGACACCG	0.622											OREG0018815	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	33	78	---	---	---	---	capture	Silent	SNP	70744582	70744582	SLCO5A1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14623	73
RIMS2	9699	broad.mit.edu	37	8	105160868	105160868	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105160868G>C	uc003yls.2	+	23	3421	c.3180G>C	c.(3178-3180)ATG>ATC	p.M1060I	RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Missense_Mutation_p.M1049I|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GCAGACAAATGGGCATATCAG	0.433										HNSCC(12;0.0054)			19	39	---	---	---	---	capture	Missense_Mutation	SNP	105160868	105160868	RIMS2	8	G	C	C	C	1	0	0	0	0	1	0	0	0	599	47	4	4	13260	73
SLC24A2	25769	broad.mit.edu	37	9	19786746	19786746	+	Nonsense_Mutation	SNP	A	C	C			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19786746A>C	uc003zoa.1	-	1	181	c.119T>G	c.(118-120)TTA>TGA	p.L40*	SLC24A2_uc003zob.1_Nonsense_Mutation_p.L40*	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24	40					visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GAAAAGGCCTAAGACTCGAAT	0.438													69	70	---	---	---	---	capture	Nonsense_Mutation	SNP	19786746	19786746	SLC24A2	9	A	C	C	C	1	0	0	0	0	0	1	0	0	169	13	5	4	14358	73
TESK1	7016	broad.mit.edu	37	9	35609460	35609460	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35609460G>A	uc003zxa.2	+	10	1938	c.1602G>A	c.(1600-1602)TGG>TGA	p.W534*	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Nonsense_Mutation_p.W374*	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	534					cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGGAGCCCTGGAACCGGGCCC	0.692													27	40	---	---	---	---	capture	Nonsense_Mutation	SNP	35609460	35609460	TESK1	9	G	A	A	A	1	0	0	0	0	0	1	0	0	533	41	5	2	15652	73
P2RY4	5030	broad.mit.edu	37	X	69479145	69479145	+	Silent	SNP	G	A	A	rs146718292	byFrequency	TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69479145G>A	uc004dxz.1	-	1	510	c.330C>T	c.(328-330)TTC>TTT	p.F110F		NM_002565	NP_002556	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y4	110	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1						GAAAGCGGACGAACTTGCAGA	0.542													24	9	---	---	---	---	capture	Silent	SNP	69479145	69479145	P2RY4	23	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	11257	73
KIF2B	84643	broad.mit.edu	37	17	51901522	51901522	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51901522delC	uc002iua.2	+	1	1284	c.1128delC	c.(1126-1128)GTCfs	p.V376fs	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	376	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						AGCTGCAAGTCCTTGAGGATG	0.468													46	120	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	51901522	51901522	KIF2B	17	C	-	-	-	1	0	1	0	1	0	0	0	0	379	30	5	5	8220	73
MBNL1	4154	broad.mit.edu	37	3	152018103	152018103	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:152018103delA	uc003ezm.2	+	1	910	c.121delA	c.(121-123)AAAfs	p.K41fs	MBNL1_uc003ezh.2_Frame_Shift_Del_p.K41fs|MBNL1_uc003ezi.2_Frame_Shift_Del_p.K41fs|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Frame_Shift_Del_p.K41fs|MBNL1_uc003ezp.2_Frame_Shift_Del_p.K41fs|MBNL1_uc003ezn.2_Frame_Shift_Del_p.K41fs|MBNL1_uc003ezo.2_Frame_Shift_Del_p.K41fs|MBNL1_uc003ezg.1_RNA|MBNL1_uc003ezk.1_RNA	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	41	C3H1-type 1.				embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ACATCCTTCGAAAAGCTGCCA	0.403													62	141	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	152018103	152018103	MBNL1	3	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	9266	73
SRRT	51593	broad.mit.edu	37	7	100481735	100481736	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0877-01	TCGA-06-0877-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100481735_100481736insG	uc003uwy.2	+	7	900_901	c.632_633insG	c.(631-633)CAGfs	p.Q211fs	SRRT_uc010lhl.1_Frame_Shift_Ins_p.Q211fs|SRRT_uc003uxa.2_Frame_Shift_Ins_p.Q211fs|SRRT_uc003uwz.2_Frame_Shift_Ins_p.Q211fs	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	211					cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						AAGCGTCGGCAGGAGGCCCGGG	0.569													8	194	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	100481735	100481736	SRRT	7	-	G	G	G	1	0	1	1	0	0	0	0	0	91	7	5	5	15064	73
