Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EXTL1	2134	broad.mit.edu	37	1	26360290	26360290	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26360290C>T	uc001blf.2	+	9	2489	c.1622C>T	c.(1621-1623)ACT>ATT	p.T541I		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	541	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		TGGGGCTACACTGCTGAGAGG	0.577													9	134	---	---	---	---	capture	Missense_Mutation	SNP	26360290	26360290	EXTL1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	5280	76
COL24A1	255631	broad.mit.edu	37	1	86590905	86590905	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86590905T>G	uc001dlj.2	-	3	1156	c.1114A>C	c.(1114-1116)AAC>CAC	p.N372H	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.N372H	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	372					cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TCAGACATGTTTAGGAGAGAG	0.378													4	174	---	---	---	---	capture	Missense_Mutation	SNP	86590905	86590905	COL24A1	1	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	3648	76
OR2G2	81470	broad.mit.edu	37	1	247751819	247751819	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247751819G>A	uc010pyy.1	+	1	158	c.158G>A	c.(157-159)CGT>CAT	p.R53H		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	53	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CTGGTTTCTCGTCTGGAACCC	0.418													20	362	---	---	---	---	capture	Missense_Mutation	SNP	247751819	247751819	OR2G2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10902	76
PTEN	5728	broad.mit.edu	37	10	89692830	89692830	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692830G>A	uc001kfb.2	+	6	1345	c.314G>A	c.(313-315)TGT>TAT	p.C105Y		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	105	Phosphatase tensin-type.		C -> F (in BZS; loss of phosphatase activity towards Ins(1,3,4,5)P4).|C -> Y (in BZS).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.C105F(6)|p.C105W(4)|p.R55fs*1(4)|p.C105S(3)|p.?(2)|p.Y27fs*1(2)|p.C105Y(2)|p.Y27_N212>Y(2)|p.C105fs*2(1)|p.C105fs*1(1)|p.C105G(1)|p.C105R(1)|p.F56fs*2(1)|p.P103fs*3(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAACCCTTTTGTGAAGATCTT	0.373		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			12	146	---	---	---	---	capture	Missense_Mutation	SNP	89692830	89692830	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	12633	76
SYNJ2BP	55333	broad.mit.edu	37	14	70839825	70839825	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:70839825T>C	uc001xmc.3	-	4	448	c.321A>G	c.(319-321)ATA>ATG	p.I107M	SYNJ2BP_uc010arc.2_RNA	NM_018373	NP_060843	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein	107	Cytoplasmic (Potential).					integral to membrane|mitochondrial outer membrane					0				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		CTCGATGTCCTATAGGTCCAT	0.473													3	136	---	---	---	---	capture	Missense_Mutation	SNP	70839825	70839825	SYNJ2BP	14	T	C	C	C	1	0	0	0	0	1	0	0	0	680	53	3	3	15342	76
DNAH3	55567	broad.mit.edu	37	16	20994175	20994175	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20994175C>T	uc010vbe.1	-	49	7727	c.7727G>A	c.(7726-7728)CGC>CAC	p.R2576H	DNAH3_uc010vbd.1_Missense_Mutation_p.R11H	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2576	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CATCCGCAGGCGGTTCCTGAA	0.507													6	142	---	---	---	---	capture	Missense_Mutation	SNP	20994175	20994175	DNAH3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4560	76
CDH8	1006	broad.mit.edu	37	16	61687974	61687974	+	Silent	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:61687974C>T	uc002eog.1	-	12	2190	c.1938G>A	c.(1936-1938)CGG>CGA	p.R646R		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	646	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.R646Q(1)		ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CATTTTTATGCCGCCGTAGAG	0.388													5	144	---	---	---	---	capture	Silent	SNP	61687974	61687974	CDH8	16	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	3087	76
MYH3	4621	broad.mit.edu	37	17	10537429	10537429	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10537429C>T	uc002gmq.1	-	31	4504	c.4427G>A	c.(4426-4428)CGC>CAC	p.R1476H		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1476	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						GCTCAAGGAGCGGGACTCCTT	0.493													10	217	---	---	---	---	capture	Missense_Mutation	SNP	10537429	10537429	MYH3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9946	76
CCDC47	57003	broad.mit.edu	37	17	61830101	61830101	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61830101C>T	uc002jbs.3	-	10	1429	c.1093G>A	c.(1093-1095)GTG>ATG	p.V365M	CCDC47_uc010ddx.2_Missense_Mutation_p.V365M|CCDC47_uc002jbt.2_Missense_Mutation_p.V365M	NM_020198	NP_064583	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47 precursor	365						integral to membrane	protein binding				0						GAATACTTACCATTAAATGTA	0.373											OREG0031500	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	8	158	---	---	---	---	capture	Missense_Mutation	SNP	61830101	61830101	CCDC47	17	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	2792	76
FCGBP	8857	broad.mit.edu	37	19	40376323	40376323	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40376323A>G	uc002omp.3	-	25	11989	c.11981T>C	c.(11980-11982)GTC>GCC	p.V3994A		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3994	Cys-rich.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTCATAGTAGACACCATTGTG	0.557													3	73	---	---	---	---	capture	Missense_Mutation	SNP	40376323	40376323	FCGBP	19	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	5724	76
SIGLEC8	27181	broad.mit.edu	37	19	51960862	51960862	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51960862C>T	uc002pwt.2	-	2	653	c.586G>A	c.(586-588)GTG>ATG	p.V196M	SIGLEC8_uc010yda.1_Intron|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Intron	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	196	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GGGGAGGACACGGAGGCCCCA	0.657													5	129	---	---	---	---	capture	Missense_Mutation	SNP	51960862	51960862	SIGLEC8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14207	76
NLRP8	126205	broad.mit.edu	37	19	56459235	56459235	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56459235G>A	uc002qmh.2	+	1	38	c.-33G>A	c.(-35--31)TCGTG>TCATG		NLRP8_uc010etg.2_Translation_Start_Site	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8							cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TGTCTTTATCGTGGACACTGA	0.448													12	189	---	---	---	---	capture	Translation_Start_Site	SNP	56459235	56459235	NLRP8	19	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	10390	76
TANC1	85461	broad.mit.edu	37	2	160042398	160042398	+	Silent	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160042398G>A	uc002uag.2	+	15	2881	c.2607G>A	c.(2605-2607)GCG>GCA	p.A869A	TANC1_uc010zcm.1_Silent_p.A861A|TANC1_uc010fom.1_Silent_p.A675A	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	869						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						TCCTGAAGGCGCACATTTTCA	0.488													3	52	---	---	---	---	capture	Silent	SNP	160042398	160042398	TANC1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	15432	76
SCN9A	6335	broad.mit.edu	37	2	167141062	167141062	+	Silent	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167141062G>A	uc010fpl.2	-	12	2216	c.1875C>T	c.(1873-1875)AAC>AAT	p.N625N	uc002udp.2_Intron|SCN9A_uc002udr.1_Silent_p.N496N|SCN9A_uc002uds.1_Silent_p.N496N|SCN9A_uc002udt.1_Silent_p.N496N	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	625						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	AGACCACACCGTTGCAGTCCA	0.562													5	128	---	---	---	---	capture	Silent	SNP	167141062	167141062	SCN9A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13818	76
TTN	7273	broad.mit.edu	37	2	179438641	179438641	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179438641G>C	uc010zfg.1	-	275	64738	c.64514C>G	c.(64513-64515)ACA>AGA	p.T21505R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T15200R|TTN_uc010zfi.1_Missense_Mutation_p.T15133R|TTN_uc010zfj.1_Missense_Mutation_p.T15008R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22432							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAACTTTGCTGTGCCTTCCAG	0.413													5	85	---	---	---	---	capture	Missense_Mutation	SNP	179438641	179438641	TTN	2	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	16617	76
TTN	7273	broad.mit.edu	37	2	179615121	179615121	+	Silent	SNP	A	G	G			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179615121A>G	uc002unb.2	-	46	12230	c.12006T>C	c.(12004-12006)ACT>ACC	p.T4002T	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	9818							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGATGAAAGAGTTAATATTG	0.333													5	184	---	---	---	---	capture	Silent	SNP	179615121	179615121	TTN	2	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	16617	76
TTN	7273	broad.mit.edu	37	2	179647637	179647637	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179647637C>T	uc010zfg.1	-	18	3220	c.2996G>A	c.(2995-2997)CGT>CAT	p.R999H	TTN_uc010zfh.1_Missense_Mutation_p.R953H|TTN_uc010zfi.1_Missense_Mutation_p.R953H|TTN_uc010zfj.1_Missense_Mutation_p.R953H|TTN_uc002unb.2_Missense_Mutation_p.R999H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	999							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCATAAGACGAGCAATTCC	0.493													9	139	---	---	---	---	capture	Missense_Mutation	SNP	179647637	179647637	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	76
COL6A3	1293	broad.mit.edu	37	2	238245018	238245018	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238245018C>T	uc002vwl.2	-	40	9010	c.8725G>A	c.(8725-8727)GCT>ACT	p.A2909T	COL6A3_uc002vwo.2_Missense_Mutation_p.A2703T|COL6A3_uc010znj.1_Missense_Mutation_p.A2302T|COL6A3_uc002vwj.2_Missense_Mutation_p.A290T	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2909	Nonhelical region.|Ala-rich.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGCTTTGCAGCGGCTGGCTTC	0.582													17	155	---	---	---	---	capture	Missense_Mutation	SNP	238245018	238245018	COL6A3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3666	76
KRTAP10-1	386677	broad.mit.edu	37	21	45959752	45959752	+	Silent	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45959752G>A	uc002zfh.1	-	1	327	c.282C>T	c.(280-282)CCC>CCT	p.P94P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198691	NP_941964	P60331	KR101_HUMAN	keratin associated protein 10-1	94	24 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						cctgctggcagggggaggagg	0.323													5	130	---	---	---	---	capture	Silent	SNP	45959752	45959752	KRTAP10-1	21	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	8425	76
DAG1	1605	broad.mit.edu	37	3	49570453	49570453	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49570453C>T	uc003cxc.3	+	3	2927	c.2509C>T	c.(2509-2511)CCC>TCC	p.P837S		NM_004393	NP_004384	Q14118	DAG1_HUMAN	dystroglycan 1 preproprotein	837	Pro-rich.|Required for interaction with CAV3.|Cytoplasmic (Potential).				cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCAGAGTGTGCCCGAGACCAC	0.637													4	144	---	---	---	---	capture	Missense_Mutation	SNP	49570453	49570453	DAG1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4184	76
ANKRD17	26057	broad.mit.edu	37	4	73962983	73962983	+	Silent	SNP	T	G	G			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:73962983T>G	uc003hgp.2	-	27	5145	c.5028A>C	c.(5026-5028)TCA>TCC	p.S1676S	ANKRD17_uc003hgo.2_Silent_p.S1563S|ANKRD17_uc003hgq.2_Silent_p.S1425S|ANKRD17_uc003hgr.2_Silent_p.S1675S	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1676	Ser-rich.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGATAGTTTCTGACAATCTTT	0.333													8	168	---	---	---	---	capture	Silent	SNP	73962983	73962983	ANKRD17	4	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	643	76
FGA	2243	broad.mit.edu	37	4	155506815	155506815	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155506815T>C	uc003iod.1	-	5	1824	c.1766A>G	c.(1765-1767)TAC>TGC	p.Y589C	FGA_uc003ioe.1_Missense_Mutation_p.Y589C|FGA_uc003iof.1_3'UTR	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	589	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCCTCTGTTGTAACTCGTGCT	0.443													8	185	---	---	---	---	capture	Missense_Mutation	SNP	155506815	155506815	FGA	4	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	5776	76
CDH18	1016	broad.mit.edu	37	5	19520824	19520825	+	Missense_Mutation	DNP	GG	AC	AC			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19520824_19520825GG>AC	uc003jgc.2	-	9	1830_1831	c.1453_1454CC>GT	c.(1453-1455)CCA>GTA	p.P485V	CDH18_uc003jgd.2_Missense_Mutation_p.P485V|CDH18_uc011cnm.1_Missense_Mutation_p.P485V	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	485	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AAGTTCGGGTGGATTGTCATTG	0.381													26	159	---	---	---	---	capture	Missense_Mutation	DNP	19520824	19520825	CDH18	5	GG	AC	AC	AC	1	0	0	0	0	1	0	0	0	611	47	2	2	3074	76
PCDHB16	57717	broad.mit.edu	37	5	140563145	140563145	+	Silent	SNP	G	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140563145G>T	uc003liv.2	+	1	2166	c.1011G>T	c.(1009-1011)GTG>GTT	p.V337V	PCDHB16_uc010jfw.1_Silent_p.V9V	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	337	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCTGCAGGTGGTGGACGTGA	0.502													15	132	---	---	---	---	capture	Silent	SNP	140563145	140563145	PCDHB16	5	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	11444	76
PCDHGA2	56113	broad.mit.edu	37	5	140720392	140720392	+	Silent	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140720392G>A	uc003ljk.1	+	1	2039	c.1854G>A	c.(1852-1854)TCG>TCA	p.S618S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Silent_p.S618S	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	618	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACTCTTCTCGGTGGGTCTGC	0.677													7	182	---	---	---	---	capture	Silent	SNP	140720392	140720392	PCDHGA2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11457	76
TUBB	203068	broad.mit.edu	37	6	30690337	30690337	+	Silent	SNP	A	G	G			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30690337A>G	uc003nrl.2	+	2	208	c.81A>G	c.(79-81)GAA>GAG	p.E27E	TUBB_uc003nrk.1_Silent_p.E27E|TUBB_uc011dmq.1_5'UTR	NM_178014	NP_821133	P07437	TBB5_HUMAN	tubulin, beta	27					cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding			ovary(1)	1					Colchicine(DB01394)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	TCAGTGATGAACATGGCATCG	0.552													4	53	---	---	---	---	capture	Silent	SNP	30690337	30690337	TUBB	6	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	16634	76
BAT1	7919	broad.mit.edu	37	6	31504445	31504445	+	Missense_Mutation	SNP	C	A	A	rs75750725		TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31504445C>A	uc003ntt.2	-	5	1079	c.448G>T	c.(448-450)GGT>TGT	p.G150C	BAT1_uc003ntr.2_5'Flank|BAT1_uc003nts.2_Missense_Mutation_p.G150C|BAT1_uc011dnn.1_Missense_Mutation_p.G72C|BAT1_uc003ntu.2_Missense_Mutation_p.G150C|BAT1_uc003ntv.2_Missense_Mutation_p.G150C|BAT1_uc003ntw.2_Missense_Mutation_p.G150C|BAT1_uc003ntx.2_Missense_Mutation_p.G150C|BAT1_uc011dno.1_Missense_Mutation_p.G103C|BAT1_uc011dnp.1_Missense_Mutation_p.G72C|SNORD117_uc003nty.1_5'Flank|BAT1_uc011dnq.1_RNA	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1	150	Helicase ATP-binding.				intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						GACAGACCACCAAAAAAAACA	0.507													4	46	---	---	---	---	capture	Missense_Mutation	SNP	31504445	31504445	BAT1	6	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	1307	76
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			86	409	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	76
RSBN1L	222194	broad.mit.edu	37	7	77378833	77378833	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77378833C>T	uc010ldt.1	+	3	840	c.796C>T	c.(796-798)CGG>TGG	p.R266W	RSBN1L_uc003ugm.2_Missense_Mutation_p.R48W	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	266	Lys-rich.					nucleus				ovary(1)	1						GAATGAAAAACGGAAGCGTCC	0.353													5	96	---	---	---	---	capture	Missense_Mutation	SNP	77378833	77378833	RSBN1L	7	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	13589	76
SEMA3E	9723	broad.mit.edu	37	7	82997239	82997239	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82997239G>A	uc003uhy.1	-	17	2457	c.1991C>T	c.(1990-1992)ACG>ATG	p.T664M		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	664	Ig-like C2-type.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TTTACGGACCGTATGGACAAA	0.458													13	184	---	---	---	---	capture	Missense_Mutation	SNP	82997239	82997239	SEMA3E	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13921	76
MYOM2	9172	broad.mit.edu	37	8	2040299	2040299	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:2040299G>A	uc003wpx.3	+	16	2092	c.1954G>A	c.(1954-1956)GGA>AGA	p.G652R	MYOM2_uc011kwi.1_Missense_Mutation_p.G77R	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	652	Fibronectin type-III 3.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CTGTGTGGCCGGAACCAACCT	0.607													9	147	---	---	---	---	capture	Missense_Mutation	SNP	2040299	2040299	MYOM2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10002	76
CSMD1	64478	broad.mit.edu	37	8	2855644	2855644	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:2855644G>C	uc011kwk.1	-	54	8659	c.8269C>G	c.(8269-8271)CTG>GTG	p.L2757V	CSMD1_uc011kwj.1_Missense_Mutation_p.L2086V|CSMD1_uc010lrg.2_Missense_Mutation_p.L767V	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2757	Extracellular (Potential).|Sushi 19.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACATCATTCAGGTTGAACTCA	0.527													6	134	---	---	---	---	capture	Missense_Mutation	SNP	2855644	2855644	CSMD1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	3909	76
CDH17	1015	broad.mit.edu	37	8	95188833	95188833	+	Silent	SNP	G	A	A	rs148638200	byFrequency	TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95188833G>A	uc003ygh.2	-	5	485	c.360C>T	c.(358-360)AAC>AAT	p.N120N	CDH17_uc011lgo.1_Silent_p.N120N|CDH17_uc011lgp.1_Silent_p.N120N	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	120	Extracellular (Potential).|Cadherin 1.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			GTCGATTGTCGTTGATGTCCT	0.483													9	106	---	---	---	---	capture	Silent	SNP	95188833	95188833	CDH17	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3073	76
FAM75C1	441452	broad.mit.edu	37	9	90536517	90536517	+	Silent	SNP	A	T	T			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90536517A>T	uc010mqi.2	+	4	1724	c.1695A>T	c.(1693-1695)TCA>TCT	p.S565S	FAM75C1_uc004apq.3_Silent_p.S548S	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						GGAGTGACTCAGGAAGTGATT	0.507													11	193	---	---	---	---	capture	Silent	SNP	90536517	90536517	FAM75C1	9	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	5569	76
OR13C4	138804	broad.mit.edu	37	9	107288808	107288808	+	Missense_Mutation	SNP	G	A	A	rs139144967		TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107288808G>A	uc011lvn.1	-	1	683	c.683C>T	c.(682-684)ACG>ATG	p.T228M		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	228	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GGCCGAGTTCGTTCGCAAGAT	0.403													11	155	---	---	---	---	capture	Missense_Mutation	SNP	107288808	107288808	OR13C4	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10840	76
FXR2	9513	broad.mit.edu	37	17	7507356	7507357	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-0881-01	TCGA-06-0881-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7507356_7507357insC	uc002gia.1	-	4	497_498	c.270_271insG	c.(268-273)TGGCTGfs	p.W90fs	FXR2_uc010vud.1_Frame_Shift_Ins_p.W90fs	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related	90_91						cytosolic large ribosomal subunit	protein binding|RNA binding	p.?(1)			0				READ - Rectum adenocarcinoma(115;0.17)		ACCCGGGCCAGCCACCAGCCAC	0.441													6	5	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	7507356	7507357	FXR2	17	-	C	C	C	1	0	1	1	0	0	0	0	0	438	34	5	5	6058	76
