Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ARID1A	8289	broad.mit.edu	37	1	27106176	27106176	+	Missense_Mutation	SNP	T	G	G			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27106176T>G	uc001bmv.1	+	20	6160	c.5787T>G	c.(5785-5787)AGT>AGG	p.S1929R	ARID1A_uc001bmu.1_Missense_Mutation_p.S1712R|ARID1A_uc001bmx.1_Missense_Mutation_p.S775R|ARID1A_uc009vsm.1_Missense_Mutation_p.S257R|ARID1A_uc009vsn.1_Missense_Mutation_p.S171R	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1929					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GAGCTAAGAGTTCAGAGGCCA	0.532			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								6	143	---	---	---	---	capture	Missense_Mutation	SNP	27106176	27106176	ARID1A	1	T	G	G	G	1	0	0	0	0	1	0	0	0	777	60	4	4	906	80
NBPF10	100132406	broad.mit.edu	37	1	145299838	145299838	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145299838G>A	uc001end.3	+	6	922	c.887G>A	c.(886-888)CGC>CAC	p.R296H	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.R296H|NBPF10_uc010oyi.1_5'Flank|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	296											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAGAAATTGCGCCCCCAGCTG	0.488													9	497	---	---	---	---	capture	Missense_Mutation	SNP	145299838	145299838	NBPF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10100	80
OR2L3	391192	broad.mit.edu	37	1	248224277	248224277	+	Silent	SNP	T	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248224277T>A	uc001idx.1	+	1	294	c.294T>A	c.(292-294)ATT>ATA	p.I98I	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GGTGTGGGATTCAGAGTTTCT	0.428													24	145	---	---	---	---	capture	Silent	SNP	248224277	248224277	OR2L3	1	T	A	A	A	1	0	0	0	0	0	0	0	1	796	62	4	4	10912	80
SYT13	57586	broad.mit.edu	37	11	45273992	45273992	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45273992C>T	uc001myq.2	-	4	952	c.826G>A	c.(826-828)GAG>AAG	p.E276K	SYT13_uc009yku.1_Missense_Mutation_p.E132K	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	276	Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						GTCTTCAGCTCGCCCCACTGG	0.632											OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	87	---	---	---	---	capture	Missense_Mutation	SNP	45273992	45273992	SYT13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15357	80
MAPK8IP1	9479	broad.mit.edu	37	11	45927211	45927211	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45927211A>G	uc001nbr.2	+	12	2245	c.2075A>G	c.(2074-2076)CAG>CGG	p.Q692R		NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting	692	PID.				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity			ovary(2)|breast(1)|skin(1)	4				GBM - Glioblastoma multiforme(35;0.231)		AGAGCATTCCAGCAGTTCTAC	0.597													26	210	---	---	---	---	capture	Missense_Mutation	SNP	45927211	45927211	MAPK8IP1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9197	80
PTPRJ	5795	broad.mit.edu	37	11	48185118	48185118	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48185118C>T	uc001ngp.3	+	23	4022	c.3667C>T	c.(3667-3669)CGT>TGT	p.R1223C		NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1223	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						GTACCTCGTTCGTGACTACAT	0.517													16	52	---	---	---	---	capture	Missense_Mutation	SNP	48185118	48185118	PTPRJ	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12699	80
ZNF202	7753	broad.mit.edu	37	11	123597645	123597645	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123597645T>C	uc001pzd.1	-	9	1407	c.1007A>G	c.(1006-1008)GAG>GGG	p.E336G	ZNF202_uc001pzc.1_Missense_Mutation_p.E112G|ZNF202_uc001pze.1_Missense_Mutation_p.E336G|ZNF202_uc001pzf.1_Missense_Mutation_p.E336G	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202	336					lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		GTGTATATCCTCCAAACTCAG	0.453													4	270	---	---	---	---	capture	Missense_Mutation	SNP	123597645	123597645	ZNF202	11	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17643	80
B3GAT1	27087	broad.mit.edu	37	11	134253884	134253884	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:134253884C>T	uc001qhq.2	-	4	572	c.311G>A	c.(310-312)CGC>CAC	p.R104H	B3GAT1_uc001qhr.2_Missense_Mutation_p.R104H|B3GAT1_uc010scv.1_Missense_Mutation_p.R117H	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	104	Lumenal (Potential).				carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GTTGGCCATGCGCGTCAGCTC	0.716													4	15	---	---	---	---	capture	Missense_Mutation	SNP	134253884	134253884	B3GAT1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1242	80
PDZRN4	29951	broad.mit.edu	37	12	41967365	41967365	+	Silent	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:41967365C>T	uc010skn.1	+	10	2255	c.2187C>T	c.(2185-2187)GAC>GAT	p.D729D	PDZRN4_uc001rmq.3_Silent_p.D670D|PDZRN4_uc009zjz.2_Silent_p.D668D|PDZRN4_uc001rmr.2_Silent_p.D555D	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	928							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TGACCACAGACGATGACACCA	0.562													24	53	---	---	---	---	capture	Silent	SNP	41967365	41967365	PDZRN4	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11613	80
LRRIQ1	84125	broad.mit.edu	37	12	85459127	85459127	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85459127C>T	uc001tac.2	+	9	2590	c.2479C>T	c.(2479-2481)CGC>TGC	p.R827C	LRRIQ1_uc001tab.1_Missense_Mutation_p.R827C	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	827	LRR 1.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		ATCCCTTCGACGCTGTGGATT	0.393													10	18	---	---	---	---	capture	Missense_Mutation	SNP	85459127	85459127	LRRIQ1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8944	80
LUM	4060	broad.mit.edu	37	12	91502172	91502172	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91502172C>G	uc001tbm.2	-	2	974	c.585G>C	c.(583-585)CAG>CAC	p.Q195H	LUM_uc001tbn.2_Intron	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	195	LRR 6.				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						GTCTGGCTATCTGATTGAAGC	0.428													13	101	---	---	---	---	capture	Missense_Mutation	SNP	91502172	91502172	LUM	12	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	9000	80
AKAP13	11214	broad.mit.edu	37	15	86286791	86286791	+	Silent	SNP	G	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:86286791G>A	uc002blv.1	+	36	8297	c.8127G>A	c.(8125-8127)TCG>TCA	p.S2709S	AKAP13_uc002blu.1_Silent_p.S2713S|AKAP13_uc002blw.1_Silent_p.S1174S|AKAP13_uc002blx.1_Silent_p.S954S	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	2709	Interaction with ESR1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						AGCCCCCCTCGCCATCTGCAC	0.502													24	132	---	---	---	---	capture	Silent	SNP	86286791	86286791	AKAP13	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	449	80
ATP9B	374868	broad.mit.edu	37	18	77133909	77133909	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77133909A>T	uc002lmx.2	+	28	3096	c.3082A>T	c.(3082-3084)ATG>TTG	p.M1028L	ATP9B_uc002lmw.1_Missense_Mutation_p.M1028L|ATP9B_uc002lna.2_Missense_Mutation_p.M54L|ATP9B_uc002lnb.1_Missense_Mutation_p.H126L|ATP9B_uc010drb.2_RNA	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	1028	Helical; (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CGGCATCCTCATGTATGGGGC	0.567													9	69	---	---	---	---	capture	Missense_Mutation	SNP	77133909	77133909	ATP9B	18	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	1190	80
DOT1L	84444	broad.mit.edu	37	19	2216705	2216705	+	Silent	SNP	G	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2216705G>A	uc002lvb.3	+	20	2385	c.2349G>A	c.(2347-2349)CGG>CGA	p.R783R	DOT1L_uc002lvc.1_Silent_p.R77R|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_Silent_p.R77R	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	783						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCTGAGGCGGCACCTGAGCC	0.687													25	58	---	---	---	---	capture	Silent	SNP	2216705	2216705	DOT1L	19	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	4665	80
FUT5	2527	broad.mit.edu	37	19	5867010	5867010	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5867010G>C	uc002mdo.3	-	2	815	c.727C>G	c.(727-729)CCC>GCC	p.P243A	FUT5_uc010duo.2_Missense_Mutation_p.P243A	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	243	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						GTCCCCTTGGGCAGGGGCTTG	0.602													27	101	---	---	---	---	capture	Missense_Mutation	SNP	5867010	5867010	FUT5	19	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	6049	80
NOSIP	51070	broad.mit.edu	37	19	50059597	50059597	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50059597G>A	uc002pok.2	-	9	963	c.811C>T	c.(811-813)CGC>TGC	p.R271C	NOSIP_uc002pol.2_Missense_Mutation_p.R271C	NM_015953	NP_057037	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	271					negative regulation of nitric-oxide synthase activity|nitric oxide metabolic process	cytosol|nucleus	protein binding			skin(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		ATGATGTCGCGGTCTGTGAGT	0.383													10	26	---	---	---	---	capture	Missense_Mutation	SNP	50059597	50059597	NOSIP	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10452	80
ANTXR1	84168	broad.mit.edu	37	2	69240637	69240637	+	Silent	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:69240637C>T	uc002sfg.2	+	1	362	c.6C>T	c.(4-6)GCC>GCT	p.A2A	ANTXR1_uc002sfe.2_Silent_p.A2A|ANTXR1_uc002sff.2_Silent_p.A2A|ANTXR1_uc002sfd.2_Silent_p.A2A	NM_032208	NP_115584	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1 isoform 1 precursor	2					actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4						GGGCCATGGCCACGGCGGAGC	0.721									Familial_Infantile_Hemangioma				4	15	---	---	---	---	capture	Silent	SNP	69240637	69240637	ANTXR1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	705	80
ADAM33	80332	broad.mit.edu	37	20	3652076	3652076	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3652076T>C	uc002wit.2	-	17	2060	c.1973A>G	c.(1972-1974)CAC>CGC	p.H658R	ADAM33_uc002wiq.1_5'Flank|ADAM33_uc002wir.1_Missense_Mutation_p.H658R|ADAM33_uc002wis.2_Intron|ADAM33_uc002wiu.2_Intron|uc002wiv.1_5'Flank|ADAM33_uc002wiw.1_RNA|ADAM33_uc010gba.1_Intron	NM_025220	NP_079496	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33 isoform alpha	658	Extracellular (Potential).|EGF-like.				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|ovary(1)|skin(1)	4						CCCGTGGCTGTGGCAGGCAGT	0.612													4	112	---	---	---	---	capture	Missense_Mutation	SNP	3652076	3652076	ADAM33	20	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	250	80
CSRP2BP	57325	broad.mit.edu	37	20	18165284	18165284	+	Missense_Mutation	SNP	A	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:18165284A>C	uc002wqj.2	+	10	2645	c.2023A>C	c.(2023-2025)AGT>CGT	p.S675R	CSRP2BP_uc002wqk.2_Missense_Mutation_p.S547R|CSRP2BP_uc010zru.1_Missense_Mutation_p.S546R	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	675	N-acetyltransferase.				histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						CCCAGACTTCAGTGTTGTTGT	0.408													30	131	---	---	---	---	capture	Missense_Mutation	SNP	18165284	18165284	CSRP2BP	20	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	3933	80
SEMG2	6407	broad.mit.edu	37	20	43851863	43851863	+	Silent	SNP	T	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43851863T>A	uc010ggz.2	+	2	1647	c.1590T>A	c.(1588-1590)TCT>TCA	p.S530S	SEMG2_uc002xnk.2_Silent_p.S530S|SEMG2_uc002xnl.2_Silent_p.S410S	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	530	Repeat-rich region.|3-2.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				CTGGTCAATCTGCAGATAGCA	0.388													4	49	---	---	---	---	capture	Silent	SNP	43851863	43851863	SEMG2	20	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	13938	80
ARFGAP1	55738	broad.mit.edu	37	20	61910293	61910293	+	Silent	SNP	G	A	A	rs143521520	byFrequency	TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61910293G>A	uc002yem.2	+	7	685	c.573G>A	c.(571-573)CCG>CCA	p.P191P	ARFGAP1_uc011aas.1_Silent_p.P138P|ARFGAP1_uc011aat.1_Silent_p.P78P|ARFGAP1_uc002yel.2_Silent_p.P191P|ARFGAP1_uc002yen.2_Silent_p.P191P	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating	191					COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)					ACACGCCACCGCCTCAGAAGA	0.597													21	64	---	---	---	---	capture	Silent	SNP	61910293	61910293	ARFGAP1	20	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	842	80
IFNGR2	3460	broad.mit.edu	37	21	34809223	34809223	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:34809223T>C	uc002yrp.3	+	7	1616	c.968T>C	c.(967-969)ATC>ACC	p.I323T	IFNGR2_uc002yrq.3_Missense_Mutation_p.I342T|IFNGR2_uc010gma.2_Missense_Mutation_p.I244T|IFNGR2_uc002yrr.3_Missense_Mutation_p.I244T|TMEM50B_uc002yrs.1_Intron	NM_005534	NP_005525	P38484	INGR2_HUMAN	interferon gamma receptor 2 precursor	323	Cytoplasmic (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)	GTGTCCATTATCTCGTTTCCG	0.502													3	53	---	---	---	---	capture	Missense_Mutation	SNP	34809223	34809223	IFNGR2	21	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	7475	80
SRRD	402055	broad.mit.edu	37	22	26887547	26887547	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26887547T>C	uc010gve.2	+	7	936	c.929T>C	c.(928-930)ATT>ACT	p.I310T	SRRD_uc003acp.3_Missense_Mutation_p.I303T|uc003acu.1_5'Flank	NM_001013694	NP_001013716	Q9UH36	SRR1L_HUMAN	SRR1 domain containing	310					rhythmic process						0						TCCATAGATATTTGGGAGTTT	0.433													27	57	---	---	---	---	capture	Missense_Mutation	SNP	26887547	26887547	SRRD	22	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	15059	80
IDUA	3425	broad.mit.edu	37	4	995272	995272	+	Silent	SNP	G	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:995272G>A	uc003gby.2	+	5	598	c.510G>A	c.(508-510)GCG>GCA	p.A170A	IDUA_uc003gbz.2_RNA|IDUA_uc003gca.2_Silent_p.A123A	NM_000203	NP_000194	P35475	IDUA_HUMAN	alpha-L-iduronidase precursor	170					disaccharide metabolic process	lysosome	cation binding|L-iduronidase activity				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)		Laronidase(DB00090)	ACGGACTGGCGCATGTTTCCA	0.582													4	123	---	---	---	---	capture	Silent	SNP	995272	995272	IDUA	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7429	80
TMEM184C	55751	broad.mit.edu	37	4	148545074	148545074	+	Silent	SNP	A	G	G			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:148545074A>G	uc003ila.3	+	2	782	c.213A>G	c.(211-213)TTA>TTG	p.L71L		NM_018241	NP_060711	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	71						integral to membrane					0						TGCAACACTTAGTGCATTATA	0.338													17	43	---	---	---	---	capture	Silent	SNP	148545074	148545074	TMEM184C	4	A	G	G	G	1	0	0	0	0	0	0	0	1	193	15	3	3	15989	80
MCC	4163	broad.mit.edu	37	5	112824054	112824054	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:112824054C>T	uc003kql.3	-	1	474	c.58G>A	c.(58-60)GGC>AGC	p.G20S		NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ccgctgccgccgccgccgccg	0.408													3	6	---	---	---	---	capture	Missense_Mutation	SNP	112824054	112824054	MCC	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9286	80
PCDHB7	56129	broad.mit.edu	37	5	140554787	140554787	+	Missense_Mutation	SNP	T	G	G			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140554787T>G	uc003lit.2	+	1	2545	c.2371T>G	c.(2371-2373)TTG>GTG	p.L791V	PCDHB8_uc011dai.1_5'Flank	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	791	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAGAATAATTTGGGTTTCTG	0.423													18	35	---	---	---	---	capture	Missense_Mutation	SNP	140554787	140554787	PCDHB7	5	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	11450	80
F13A1	2162	broad.mit.edu	37	6	6145963	6145963	+	Silent	SNP	G	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:6145963G>A	uc003mwv.2	-	15	2211	c.2088C>T	c.(2086-2088)TGC>TGT	p.C696C	F13A1_uc011dib.1_Missense_Mutation_p.A590V	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	696					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CCCAGGGCCGGCACACTTCTT	0.547													4	106	---	---	---	---	capture	Silent	SNP	6145963	6145963	F13A1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5294	80
IQCE	23288	broad.mit.edu	37	7	2644610	2644610	+	Silent	SNP	A	G	G			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2644610A>G	uc003smo.3	+	19	1912	c.1728A>G	c.(1726-1728)CCA>CCG	p.P576P	IQCE_uc003sml.1_Silent_p.P576P|IQCE_uc011jvy.1_Silent_p.P560P|IQCE_uc011jvz.1_Silent_p.P511P|IQCE_uc003smk.3_Silent_p.P560P|IQCE_uc003smn.3_Silent_p.P511P	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1	576											0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CCAGCGTGCCAGGCCTCCCAG	0.612													3	54	---	---	---	---	capture	Silent	SNP	2644610	2644610	IQCE	7	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	7729	80
ZNF727	442319	broad.mit.edu	37	7	63538420	63538420	+	Silent	SNP	C	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63538420C>T	uc011kdm.1	+	4	1172	c.993C>T	c.(991-993)AAC>AAT	p.N331N		NM_001159522	NP_001152994	A8MUV8	ZN727_HUMAN	zinc finger protein 727	331	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCAACATAACAGAATTCATA	0.378													7	14	---	---	---	---	capture	Silent	SNP	63538420	63538420	ZNF727	7	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	17999	80
CACNA2D1	781	broad.mit.edu	37	7	81591237	81591238	+	Missense_Mutation	DNP	CC	AT	AT			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81591237_81591238CC>AT	uc003uhr.1	-	36	3194_3195	c.2938_2939GG>AT	c.(2938-2940)GGT>ATT	p.G980I	CACNA2D1_uc011kgy.1_Missense_Mutation_p.G192I	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	992	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	GTCTAATACACCACTGAATGAT	0.361													4	45	---	---	---	---	capture	Missense_Mutation	DNP	81591237	81591238	CACNA2D1	7	CC	AT	AT	AT	1	0	0	0	0	1	0	0	0	234	18	4	4	2524	80
NAMPT	10135	broad.mit.edu	37	7	105909693	105909693	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:105909693T>C	uc003vdq.2	-	5	821	c.513A>G	c.(511-513)ATA>ATG	p.I171M	NAMPT_uc003vdr.1_Missense_Mutation_p.I171M|NAMPT_uc011klu.1_Missense_Mutation_p.I84M	NM_005746	NP_005737	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	171					cell-cell signaling|NAD biosynthetic process|nicotinamide metabolic process|positive regulation of cell proliferation|positive regulation of nitric-oxide synthase biosynthetic process|signal transduction|water-soluble vitamin metabolic process	cytosol	cytokine activity|nicotinamide phosphoribosyltransferase activity|nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity			large_intestine(1)	1						ATTTGGCCAATATTTTCTTCT	0.363													3	28	---	---	---	---	capture	Missense_Mutation	SNP	105909693	105909693	NAMPT	7	T	C	C	C	1	0	0	0	0	1	0	0	0	628	49	3	3	10058	80
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140453136A>T	uc003vwc.3	-	15	1860	c.1799T>A	c.(1798-1800)GTG>GAG	p.V600E		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	600	Protein kinase.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.V600E(16892)|p.V600?(325)|p.V600K(176)|p.V600R(36)|p.V600M(25)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_V600insTT(3)|p.T599_R603>I(2)|p.T599_V600>IAL(2)|p.V600L(2)|p.T599_V600insT(2)|p.V600_W604del(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insDFGLAT(1)	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TCGAGATTTCACTGTAGCTAG	0.368	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				22	35	---	---	---	---	capture	Missense_Mutation	SNP	140453136	140453136	BRAF	7	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	1484	80
SLCO5A1	81796	broad.mit.edu	37	8	70585394	70585394	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70585394T>C	uc003xyl.2	-	10	2964	c.2257A>G	c.(2257-2259)ATT>GTT	p.I753V	SLCO5A1_uc010lzb.2_Missense_Mutation_p.I698V|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_3'UTR	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	753	Helical; Name=12; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GCCAGAAAAATAAAAATAAAC	0.488													37	103	---	---	---	---	capture	Missense_Mutation	SNP	70585394	70585394	SLCO5A1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	14623	80
QSOX2	169714	broad.mit.edu	37	9	139108556	139108556	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139108556G>A	uc010nbi.2	-	9	1137	c.1099C>T	c.(1099-1101)CGG>TGG	p.R367W		NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2 precursor	367					cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		ACTGGCGGCCGTCCAGGGAAC	0.642													21	47	---	---	---	---	capture	Missense_Mutation	SNP	139108556	139108556	QSOX2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	12779	80
NHS	4810	broad.mit.edu	37	X	17745854	17745854	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:17745854A>G	uc004cxx.2	+	6	3903	c.3565A>G	c.(3565-3567)ATG>GTG	p.M1189V	NHS_uc011mix.1_Missense_Mutation_p.M1210V|NHS_uc004cxy.2_Missense_Mutation_p.M1033V|NHS_uc004cxz.2_Missense_Mutation_p.M1012V|NHS_uc004cya.2_Missense_Mutation_p.M912V	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1189						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					TGCAGTTGAGATGGGACCAGA	0.398													31	87	---	---	---	---	capture	Missense_Mutation	SNP	17745854	17745854	NHS	23	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	10318	80
PGAM4	441531	broad.mit.edu	37	X	77224407	77224407	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77224407T>C	uc004ecy.1	-	1	729	c.729A>G	c.(727-729)ATA>ATG	p.I243M	ATP7A_uc004ecw.2_Intron|ATP7A_uc004ecx.3_Intron	NM_001029891	NP_001025062	Q8N0Y7	PGAM4_HUMAN	bisphosphoglycerate mutase 4	243					glycolysis		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0						CCACAGCTTCTATGGCTTTGC	0.567													3	114	---	---	---	---	capture	Missense_Mutation	SNP	77224407	77224407	PGAM4	23	T	C	C	C	1	0	0	0	0	1	0	0	0	680	53	3	3	11678	80
MLST8	64223	broad.mit.edu	37	16	2256651	2256651	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-1806-01	TCGA-06-1806-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2256651delG	uc002coz.2	+	4	454	c.335delG	c.(334-336)TGGfs	p.W112fs	MLST8_uc002coy.2_Frame_Shift_Del_p.W112fs|MLST8_uc002cpa.2_5'UTR|MLST8_uc002cpb.2_Frame_Shift_Del_p.W111fs|MLST8_uc010uvx.1_Frame_Shift_Del_p.W46fs|MLST8_uc002cpc.2_Frame_Shift_Del_p.W112fs|MLST8_uc002cpd.2_Frame_Shift_Del_p.W46fs|MLST8_uc002cpe.2_Frame_Shift_Del_p.W112fs|MLST8_uc010uvy.1_Frame_Shift_Del_p.W112fs|MLST8_uc002cpg.2_Frame_Shift_Del_p.W131fs|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Frame_Shift_Del_p.W112fs	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like	112	WD 3.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						GCCAGGATCTGGGACCTCAGG	0.557													43	139	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	2256651	2256651	MLST8	16	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	9546	80
