Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ATP13A2	23400	broad.mit.edu	37	1	17314833	17314833	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17314833C>T	uc001baa.2	-	24	2936	c.2746G>A	c.(2746-2748)GTG>ATG	p.V916M	ATP13A2_uc001azz.1_Missense_Mutation_p.V63M|ATP13A2_uc001bab.2_Missense_Mutation_p.V911M|ATP13A2_uc001bac.2_Missense_Mutation_p.V872M	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	916	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		ACCATGGGCACGCACTCAATA	0.642													116	108	---	---	---	---	capture	Missense_Mutation	SNP	17314833	17314833	ATP13A2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1115	81
CNKSR1	10256	broad.mit.edu	37	1	26507077	26507077	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26507077C>T	uc001bln.3	+	2	244	c.186C>T	c.(184-186)GGC>GGT	p.G62G	CNKSR1_uc010oex.1_RNA|CNKSR1_uc001blm.3_Silent_p.G62G|CNKSR1_uc009vsd.2_5'UTR|CNKSR1_uc009vse.2_5'UTR|CNKSR1_uc001blo.2_5'UTR	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	62	SAM.				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		TCATCCTGGGCGGGGTGGAAC	0.657													89	69	---	---	---	---	capture	Silent	SNP	26507077	26507077	CNKSR1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3571	81
GJB4	127534	broad.mit.edu	37	1	35227182	35227182	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35227182C>T	uc001bxv.1	+	2	697	c.327C>T	c.(325-327)CAC>CAT	p.H109H	GJB4_uc001bxw.3_Silent_p.H109H	NM_153212	NP_694944	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4	109	Cytoplasmic (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity			ovary(2)|central_nervous_system(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				ACCTGAAACACGGGCCCAATG	0.632													5	74	---	---	---	---	capture	Silent	SNP	35227182	35227182	GJB4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6347	81
MYSM1	114803	broad.mit.edu	37	1	59132729	59132729	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:59132729T>C	uc009wab.1	-	16	2035	c.2012A>G	c.(2011-2013)GAC>GGC	p.D671G	MYSM1_uc009waa.1_Missense_Mutation_p.D77G|MYSM1_uc001czc.2_RNA	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	671	MPN.				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					AGCTTGTGTGTCAATATCTCG	0.373													56	40	---	---	---	---	capture	Missense_Mutation	SNP	59132729	59132729	MYSM1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	10011	81
LRRC7	57554	broad.mit.edu	37	1	70505050	70505050	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70505050C>T	uc001dep.2	+	19	3459	c.3429C>T	c.(3427-3429)TAC>TAT	p.Y1143Y	LRRC7_uc009wbg.2_Silent_p.Y427Y|LRRC7_uc001deq.2_Silent_p.Y384Y	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1143						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						CTGATAGGTACGGCAGACCCC	0.557													18	185	---	---	---	---	capture	Silent	SNP	70505050	70505050	LRRC7	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8935	81
TTF2	8458	broad.mit.edu	37	1	117603105	117603105	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117603105C>T	uc001egy.2	+	2	77	c.57C>T	c.(55-57)GTC>GTT	p.V19V	TTF2_uc001egx.1_Silent_p.V19V	NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	19					mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		AGACCGGCGTCCGCGATGGCC	0.582													46	70	---	---	---	---	capture	Silent	SNP	117603105	117603105	TTF2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	16601	81
AQP10	89872	broad.mit.edu	37	1	154294516	154294516	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154294516C>T	uc001feu.2	+	2	253	c.213C>T	c.(211-213)TAC>TAT	p.Y71Y	AQP10_uc001fev.2_Silent_p.Y71Y	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	71	Helical; (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TAGCCATCTACGTGGGTGGTA	0.557													11	34	---	---	---	---	capture	Silent	SNP	154294516	154294516	AQP10	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	815	81
PIK3C2B	5287	broad.mit.edu	37	1	204410639	204410639	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204410639T>G	uc001haw.2	-	22	3688	c.3209A>C	c.(3208-3210)AAT>ACT	p.N1070T	PIK3C2B_uc010pqv.1_Missense_Mutation_p.N1042T	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	1070					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GGGATCCACATTTTGGAAGGA	0.527													44	34	---	---	---	---	capture	Missense_Mutation	SNP	204410639	204410639	PIK3C2B	1	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	11813	81
CHRM3	1131	broad.mit.edu	37	1	240071079	240071079	+	Silent	SNP	C	T	T	rs111407169	byFrequency	TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:240071079C>T	uc001hyp.2	+	5	1107	c.328C>T	c.(328-330)CTG>TTG	p.L110L		NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	110	Helical; Name=2; (By similarity).				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	CCTCTTAAGCCTGGCCTGTGC	0.478													3	91	---	---	---	---	capture	Silent	SNP	240071079	240071079	CHRM3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	3343	81
AKR1C1	1645	broad.mit.edu	37	10	5014817	5014817	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5014817T>A	uc001iho.2	+	12	1563	c.722T>A	c.(721-723)CTT>CAT	p.L241H	AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc001ihq.2_Missense_Mutation_p.L241H	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	241	NADP (By similarity).				bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	GACCCAGTCCTTTGTGCCTTG	0.592													13	56	---	---	---	---	capture	Missense_Mutation	SNP	5014817	5014817	AKR1C1	10	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	469	81
SORCS3	22986	broad.mit.edu	37	10	107015536	107015536	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:107015536T>G	uc001kyi.1	+	24	3541	c.3314T>G	c.(3313-3315)GTG>GGG	p.V1105G		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	1105	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CAAGTCATTGTGTATGTCACA	0.438													33	30	---	---	---	---	capture	Missense_Mutation	SNP	107015536	107015536	SORCS3	10	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	14824	81
MADD	8567	broad.mit.edu	37	11	47307122	47307122	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47307122G>A	uc001ner.1	+	14	2723	c.2532G>A	c.(2530-2532)GGG>GGA	p.G844G	MADD_uc001neq.2_Silent_p.G844G|MADD_uc001nev.1_Silent_p.G801G|MADD_uc001nes.1_Silent_p.G801G|MADD_uc001net.1_Silent_p.G844G|MADD_uc009yln.1_Silent_p.G801G|MADD_uc001neu.1_Silent_p.G801G|MADD_uc001nex.2_Silent_p.G844G|MADD_uc001nez.2_Silent_p.G801G|MADD_uc001new.2_Silent_p.G844G	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	844					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		AGGGCTTCGGGGGCATCATGT	0.532													61	174	---	---	---	---	capture	Silent	SNP	47307122	47307122	MADD	11	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	9067	81
OR5T3	390154	broad.mit.edu	37	11	56019879	56019879	+	Silent	SNP	C	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56019879C>A	uc010rjd.1	+	1	204	c.204C>A	c.(202-204)ACC>ACA	p.T68T		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	68	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					ATCTCTTTACCTTGATAGGCA	0.373													63	101	---	---	---	---	capture	Silent	SNP	56019879	56019879	OR5T3	11	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	11087	81
MS4A3	932	broad.mit.edu	37	11	59834575	59834575	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59834575C>T	uc001nom.2	+	5	631	c.503C>T	c.(502-504)TCC>TTC	p.S168F	MS4A3_uc001non.2_Missense_Mutation_p.S122F|MS4A3_uc001noo.2_Missense_Mutation_p.S45F	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	168	Extracellular (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				TACATGGGCTCCATATCAAAT	0.343													15	39	---	---	---	---	capture	Missense_Mutation	SNP	59834575	59834575	MS4A3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9771	81
AHNAK	79026	broad.mit.edu	37	11	62300927	62300927	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62300927T>G	uc001ntl.2	-	5	1262	c.962A>C	c.(961-963)GAG>GCG	p.E321A	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	321					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TGTCTGGCCCTCACGCCCTGT	0.552													4	149	---	---	---	---	capture	Missense_Mutation	SNP	62300927	62300927	AHNAK	11	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	414	81
FLRT1	23769	broad.mit.edu	37	11	63884137	63884137	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63884137A>G	uc001nyi.1	+	2	739	c.398A>G	c.(397-399)CAC>CGC	p.H133R	MACROD1_uc001nyh.2_Intron	NM_013280	NP_037412	Q9NZU1	FLRT1_HUMAN	fibronectin leucine rich transmembrane protein	105	LRR 3.|Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity				0						CGGGAGCTGCACCTGCAGGAC	0.602													22	57	---	---	---	---	capture	Missense_Mutation	SNP	63884137	63884137	FLRT1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	5882	81
KAT5	10524	broad.mit.edu	37	11	65482151	65482151	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65482151C>T	uc001ofi.2	+	8	1027	c.777C>T	c.(775-777)GTC>GTT	p.V259V	KAT5_uc001ofj.2_Silent_p.V207V|KAT5_uc001ofk.2_Silent_p.V292V|KAT5_uc010roo.1_Silent_p.V240V|KAT5_uc001ofl.2_Silent_p.V48V	NM_006388	NP_006379	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5 isoform 2	259					androgen receptor signaling pathway|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|double-strand break repair|interspecies interaction between organisms|negative regulation of interleukin-2 production|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nucleolus|perinuclear region of cytoplasm|Piccolo NuA4 histone acetyltransferase complex	androgen receptor binding|histone acetyltransferase activity|metal ion binding|repressing transcription factor binding|transcription coactivator activity				0						CATTGCCTGTCCTCTACCTGT	0.582													103	143	---	---	---	---	capture	Silent	SNP	65482151	65482151	KAT5	11	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	7906	81
APOBEC1	339	broad.mit.edu	37	12	7805333	7805333	+	Missense_Mutation	SNP	C	T	T	rs149648198		TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7805333C>T	uc001qtb.2	-	3	177	c.143G>A	c.(142-144)CGG>CAG	p.R48Q	APOBEC1_uc001qtc.2_Missense_Mutation_p.R3Q|APOBEC1_uc010sgf.1_Missense_Mutation_p.R48Q	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	48					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						CCAGATCTTCCGGCTCATGCC	0.453													17	82	---	---	---	---	capture	Missense_Mutation	SNP	7805333	7805333	APOBEC1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	780	81
ATF7IP	55729	broad.mit.edu	37	12	14589059	14589059	+	Missense_Mutation	SNP	A	T	T	rs141409610		TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14589059A>T	uc001rbw.2	+	4	1823	c.1665A>T	c.(1663-1665)AAA>AAT	p.K555N	ATF7IP_uc010shs.1_Missense_Mutation_p.K554N|ATF7IP_uc001rbu.2_Missense_Mutation_p.K555N|ATF7IP_uc001rbv.1_Missense_Mutation_p.K554N|ATF7IP_uc001rbx.2_Missense_Mutation_p.K554N|ATF7IP_uc010sht.1_Missense_Mutation_p.K555N|ATF7IP_uc001rby.3_Missense_Mutation_p.K555N|ATF7IP_uc001rca.2_Missense_Mutation_p.K555N	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	555	Glu-rich.|Nuclear localization signal (By similarity).				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						CTAGACGAAAACGTTCTAAAT	0.348													20	74	---	---	---	---	capture	Missense_Mutation	SNP	14589059	14589059	ATF7IP	12	A	T	T	T	1	0	0	0	0	1	0	0	0	24	2	4	4	1078	81
FAM113B	91523	broad.mit.edu	37	12	47629951	47629951	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:47629951G>A	uc001rpn.2	+	4	1836	c.1105G>A	c.(1105-1107)GTC>ATC	p.V369I	FAM113B_uc001rpq.2_Missense_Mutation_p.V369I	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	369	Pro-rich.						hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					AGGTTTCTTCGTCGAAGACAA	0.527													5	180	---	---	---	---	capture	Missense_Mutation	SNP	47629951	47629951	FAM113B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5356	81
KRT84	3890	broad.mit.edu	37	12	52779219	52779219	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52779219C>A	uc001sah.1	-	1	199	c.151G>T	c.(151-153)GGT>TGT	p.G51C		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	51	Head.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCCGACTACCAAAGCTGCCA	0.582													33	71	---	---	---	---	capture	Missense_Mutation	SNP	52779219	52779219	KRT84	12	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	8418	81
KRT76	51350	broad.mit.edu	37	12	53164870	53164870	+	Missense_Mutation	SNP	C	T	T	rs143394911	byFrequency	TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53164870C>T	uc001sax.2	-	7	1451	c.1397G>A	c.(1396-1398)CGT>CAT	p.R466H		NM_015848	NP_056932	Q01546	K22O_HUMAN	keratin 76	466	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			breast(1)|skin(1)	2						CTGGTAGTCACGCAGGAGCCG	0.602													26	37	---	---	---	---	capture	Missense_Mutation	SNP	53164870	53164870	KRT76	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8409	81
MMAB	326625	broad.mit.edu	37	12	109994906	109994906	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109994906G>A	uc001tou.2	-	9	753	c.680C>T	c.(679-681)GCA>GTA	p.A227V	MMAB_uc001tov.2_RNA|MMAB_uc001tow.2_RNA|MMAB_uc010sxq.1_Missense_Mutation_p.A136V|MMAB_uc001tox.2_Missense_Mutation_p.A175V	NM_052845	NP_443077	Q96EY8	MMAB_HUMAN	cob(I)alamin adenosyltransferase precursor	227					cobalamin biosynthetic process	mitochondrion	ATP binding|cob(I)yrinic acid a,c-diamide adenosyltransferase activity				0					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTCATGGCTGCATATCTGGC	0.473													4	102	---	---	---	---	capture	Missense_Mutation	SNP	109994906	109994906	MMAB	12	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9552	81
ZNF410	57862	broad.mit.edu	37	14	74360573	74360573	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74360573T>C	uc001xoz.1	+	3	289	c.107T>C	c.(106-108)ATT>ACT	p.I36T	ZNF410_uc001xoy.1_RNA|ZNF410_uc010ary.1_RNA|ZNF410_uc010tuf.1_RNA|ZNF410_uc010tug.1_5'UTR|ZNF410_uc010tuh.1_Missense_Mutation_p.I36T|ZNF410_uc010tui.1_RNA|ZNF410_uc010arz.1_Missense_Mutation_p.I36T|ZNF410_uc001xpa.1_5'UTR|ZNF410_uc001xpb.1_Missense_Mutation_p.I36T|ZNF410_uc001xpc.1_5'UTR	NM_021188	NP_067011	Q86VK4	ZN410_HUMAN	zinc finger protein 410	36					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00369)		GCTAAAGATATTACTTGCTTG	0.443													6	214	---	---	---	---	capture	Missense_Mutation	SNP	74360573	74360573	ZNF410	14	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	17770	81
GPR65	8477	broad.mit.edu	37	14	88478073	88478073	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88478073C>T	uc001xvv.2	+	2	1412	c.882C>T	c.(880-882)ACC>ACT	p.T294T		NM_003608	NP_003599	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	294	Helical; Name=7; (Potential).				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity				0						GTTTTGTAACCGAAACAGGAA	0.353													16	99	---	---	---	---	capture	Silent	SNP	88478073	88478073	GPR65	14	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6639	81
DICER1	23405	broad.mit.edu	37	14	95557393	95557393	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95557393C>T	uc001ydw.2	-	27	5763	c.5581G>A	c.(5581-5583)GAA>AAA	p.E1861K	DICER1_uc010avh.1_Missense_Mutation_p.E759K|DICER1_uc001ydv.2_Missense_Mutation_p.E1851K|DICER1_uc001ydx.2_Missense_Mutation_p.E1861K	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1861	DRBM.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GTTTCTGGTTCCATTTCAAGC	0.323			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				25	66	---	---	---	---	capture	Missense_Mutation	SNP	95557393	95557393	DICER1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	4479	81
ZSCAN2	54993	broad.mit.edu	37	15	85164337	85164337	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85164337A>G	uc002bkr.2	+	3	1137	c.911A>G	c.(910-912)AAG>AGG	p.K304R	ZSCAN2_uc010bmz.1_Missense_Mutation_p.K302R|ZSCAN2_uc010bna.2_Missense_Mutation_p.K154R|ZSCAN2_uc010uox.1_Intron|ZSCAN2_uc010uoy.1_Intron|ZSCAN2_uc010uoz.1_Intron	NM_181877	NP_870992	Q7Z7L9	ZSCA2_HUMAN	zinc finger protein 29 isoform 1	304					cell differentiation|multicellular organismal development|spermatogenesis|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		ACGGGGGAAAAGCCCTTCCAG	0.577													3	85	---	---	---	---	capture	Missense_Mutation	SNP	85164337	85164337	ZSCAN2	15	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	18107	81
PDZD9	255762	broad.mit.edu	37	16	21995750	21995750	+	Silent	SNP	G	A	A	rs146108684	byFrequency	TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21995750G>A	uc002dka.1	-	5	764	c.447C>T	c.(445-447)GAC>GAT	p.D149D		NM_173806	NP_776167	Q8IXQ8	PDZD9_HUMAN	hypothetical protein LOC255762	211										pancreas(1)	1						CTTTCTTGTCGTCTCTGTGAA	0.423													6	333	---	---	---	---	capture	Silent	SNP	21995750	21995750	PDZD9	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11609	81
IL27	246778	broad.mit.edu	37	16	28515112	28515112	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28515112C>T	uc002dqc.2	-	3	230	c.207G>A	c.(205-207)GCG>GCA	p.A69A	uc010vct.1_Intron	NM_145659	NP_663634	Q8NEV9	IL27A_HUMAN	interleukin 27 precursor	69					inflammatory response|innate immune response|positive regulation of interferon-gamma biosynthetic process|regulation of defense response to virus|regulation of T cell proliferation|regulation of T-helper 1 cell differentiation	extracellular space	cytokine activity|interleukin-27 receptor binding				0						GGTGAGATTCCGCCTGGGGGG	0.632													14	42	---	---	---	---	capture	Silent	SNP	28515112	28515112	IL27	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7603	81
HEATR3	55027	broad.mit.edu	37	16	50106625	50106625	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50106625G>A	uc002efw.2	+	5	784	c.622G>A	c.(622-624)GCA>ACA	p.A208T	HEATR3_uc002efx.2_Missense_Mutation_p.A122T	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	208							binding			ovary(1)|skin(1)	2						TATTTCAGTAGGTAAGTGAAG	0.348													50	29	---	---	---	---	capture	Missense_Mutation	SNP	50106625	50106625	HEATR3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6956	81
RABEP1	9135	broad.mit.edu	37	17	5286437	5286437	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5286437G>A	uc002gbm.3	+	18	2732	c.2508G>A	c.(2506-2508)CGG>CGA	p.R836R	RABEP1_uc010vsw.1_Silent_p.R793R|RABEP1_uc002gbl.3_Silent_p.R803R|NUP88_uc002gbn.2_Intron	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	836					apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						AGCGGATCCGGCAAGCTGACT	0.473													4	148	---	---	---	---	capture	Silent	SNP	5286437	5286437	RABEP1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	12856	81
MYH13	8735	broad.mit.edu	37	17	10215363	10215363	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10215363C>T	uc002gmk.1	-	32	4486	c.4396G>A	c.(4396-4398)GAA>AAA	p.E1466K		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1466	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						GCCTGGCTTTCGTCCAGCTTT	0.517													20	43	---	---	---	---	capture	Missense_Mutation	SNP	10215363	10215363	MYH13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9942	81
ATG4D	84971	broad.mit.edu	37	19	10655709	10655709	+	Silent	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10655709T>G	uc002mov.2	+	3	516	c.396T>G	c.(394-396)CCT>CCG	p.P132P	ATG4D_uc010xlg.1_Silent_p.P155P|ATG4D_uc010xlh.1_Silent_p.P69P|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_RNA|ATG4D_uc010dxj.2_5'UTR	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	132					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			CGCCCCTTCCTGGGGGCTGCC	0.632													60	148	---	---	---	---	capture	Silent	SNP	10655709	10655709	ATG4D	19	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	1090	81
ZNF208	7757	broad.mit.edu	37	19	22156647	22156647	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22156647A>G	uc002nqp.2	-	4	1338	c.1189T>C	c.(1189-1191)TAC>CAC	p.Y397H	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCACATTTGTAGGGTTTCTCT	0.388													32	75	---	---	---	---	capture	Missense_Mutation	SNP	22156647	22156647	ZNF208	19	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	17646	81
FAM136A	84908	broad.mit.edu	37	2	70524463	70524463	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70524463C>T	uc002sgq.3	-	3	452	c.375G>A	c.(373-375)ATG>ATA	p.M125I	FAM136A_uc010fdp.2_RNA	NM_032822	NP_116211	Q96C01	F136A_HUMAN	hypothetical protein LOC84908	125						mitochondrion	protein binding				0						TCTTCTTGGTCATAGTTGGGA	0.433													57	101	---	---	---	---	capture	Missense_Mutation	SNP	70524463	70524463	FAM136A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	5404	81
NAT8B	51471	broad.mit.edu	37	2	73928290	73928290	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73928290C>T	uc002sjk.1	-	2	178	c.143G>A	c.(142-144)GGG>GAG	p.G48E		NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN	N-acetyltransferase 8B	48	Helical; (Potential).				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity				0						AAGGGCCCCCCCAAGTAAGAG	0.612													31	91	---	---	---	---	capture	Missense_Mutation	SNP	73928290	73928290	NAT8B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10087	81
CCDC138	165055	broad.mit.edu	37	2	109410997	109410997	+	Silent	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109410997T>C	uc002ten.1	+	5	456	c.396T>C	c.(394-396)GTT>GTC	p.V132V	CCDC138_uc002teo.1_Silent_p.V132V|CCDC138_uc002tep.1_5'UTR|CCDC138_uc010fjm.1_5'UTR	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	132											0						TCTTTGCAGTTGCCTTGCCAA	0.363													27	94	---	---	---	---	capture	Silent	SNP	109410997	109410997	CCDC138	2	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	2746	81
POTEF	728378	broad.mit.edu	37	2	130877735	130877735	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:130877735G>A	uc010fmh.2	-	3	754	c.354C>T	c.(352-354)GGC>GGT	p.G118G		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	118						cell cortex	ATP binding			skin(3)|ovary(2)	5						CTCCCCAAGCGCCCACCTTGC	0.587													37	66	---	---	---	---	capture	Silent	SNP	130877735	130877735	POTEF	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12166	81
LRP1B	53353	broad.mit.edu	37	2	141986959	141986959	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141986959C>A	uc002tvj.1	-	6	1615	c.643G>T	c.(643-645)GAG>TAG	p.E215*	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	215	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAGAAAACCTCAATTGTTTCA	0.284										TSP Lung(27;0.18)			35	79	---	---	---	---	capture	Nonsense_Mutation	SNP	141986959	141986959	LRP1B	2	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	8871	81
PLCL1	5334	broad.mit.edu	37	2	198949321	198949321	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198949321C>T	uc010fsp.2	+	2	1371	c.1080C>T	c.(1078-1080)TAC>TAT	p.Y360Y	PLCL1_uc002uuv.3_Silent_p.Y281Y	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	360					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	TAAGGAGATACGAACTTTCTG	0.388													8	255	---	---	---	---	capture	Silent	SNP	198949321	198949321	PLCL1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11942	81
NAPB	63908	broad.mit.edu	37	20	23383673	23383673	+	Nonsense_Mutation	SNP	A	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23383673A>T	uc002wta.2	-	2	252	c.135T>A	c.(133-135)TAT>TAA	p.Y45*	NAPB_uc002wtc.2_5'UTR|NAPB_uc002wtb.2_Nonsense_Mutation_p.Y45*|NAPB_uc002wtd.3_RNA|NAPB_uc010zst.1_Nonsense_Mutation_p.Y45*	NM_022080	NP_071363	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment	45					intracellular protein transport|vesicle-mediated transport	membrane				ovary(1)	1	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					CAGCTCTGGTATACATTTCAC	0.338													31	74	---	---	---	---	capture	Nonsense_Mutation	SNP	23383673	23383673	NAPB	20	A	T	T	T	1	0	0	0	0	0	1	0	0	206	16	5	4	10070	81
MOCS3	27304	broad.mit.edu	37	20	49576077	49576077	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49576077C>T	uc002xvy.1	+	1	715	c.698C>T	c.(697-699)GCG>GTG	p.A233V	DPM1_uc002xvw.1_5'Flank|DPM1_uc002xvx.1_5'Flank	NM_014484	NP_055299	O95396	MOCS3_HUMAN	molybdenum cofactor synthesis 3	233					enzyme active site formation via L-cysteine persulfide|Mo-molybdopterin cofactor biosynthetic process|tRNA thio-modification|tRNA wobble uridine modification|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|nucleotidyltransferase activity|protein binding|thiosulfate sulfurtransferase activity|URM1 activating enzyme activity			skin(2)|ovary(1)	3						CCACCCCCAGCGGAGACAGTG	0.622													13	154	---	---	---	---	capture	Missense_Mutation	SNP	49576077	49576077	MOCS3	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9604	81
PRDM15	63977	broad.mit.edu	37	21	43279747	43279747	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43279747C>T	uc002yzq.1	-	9	1096	c.985G>A	c.(985-987)GGC>AGC	p.G329S	PRDM15_uc002yzo.2_Missense_Mutation_p.G66S|PRDM15_uc002yzp.2_Missense_Mutation_p.G66S|PRDM15_uc002yzr.1_Missense_Mutation_p.G66S	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	329					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACCACTGGGCCCAGCTCGGGA	0.597													16	16	---	---	---	---	capture	Missense_Mutation	SNP	43279747	43279747	PRDM15	21	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	12352	81
SEC14L3	266629	broad.mit.edu	37	22	30857619	30857619	+	Silent	SNP	G	A	A	rs139964800	byFrequency	TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30857619G>A	uc003ahy.2	-	10	923	c.834C>T	c.(832-834)TAC>TAT	p.Y278Y	SEC14L3_uc003ahz.2_Silent_p.Y201Y|SEC14L3_uc003aia.2_Silent_p.Y219Y|SEC14L3_uc003aib.2_Silent_p.Y219Y	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	278	GOLD.					integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	CCGAGTGCTCGTACTGAGTCT	0.517													8	26	---	---	---	---	capture	Silent	SNP	30857619	30857619	SEC14L3	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13876	81
SCN5A	6331	broad.mit.edu	37	3	38622444	38622444	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38622444G>A	uc003cio.2	-	17	3400	c.3206C>T	c.(3205-3207)ACG>ATG	p.T1069M	SCN5A_uc003cin.2_Missense_Mutation_p.T1069M|SCN5A_uc003cil.3_Missense_Mutation_p.T1069M|SCN5A_uc010hhi.2_Missense_Mutation_p.T1069M|SCN5A_uc010hhk.2_Missense_Mutation_p.T1069M|SCN5A_uc011ayr.1_Missense_Mutation_p.T1069M|SCN5A_uc010hhj.1_Missense_Mutation_p.T680M	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1069					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	CTCCTCCTCCGTGCCCAGGCT	0.627													9	47	---	---	---	---	capture	Missense_Mutation	SNP	38622444	38622444	SCN5A	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13815	81
ABI3BP	25890	broad.mit.edu	37	3	100645260	100645260	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:100645260G>A	uc003dun.2	-	2	251	c.166C>T	c.(166-168)CGT>TGT	p.R56C	ABI3BP_uc003duo.2_Missense_Mutation_p.R49C|ABI3BP_uc003dup.3_Missense_Mutation_p.R49C	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	56						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						GGACTTGGACGCAAGAACTTC	0.448													36	60	---	---	---	---	capture	Missense_Mutation	SNP	100645260	100645260	ABI3BP	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	91	81
ZPLD1	131368	broad.mit.edu	37	3	102157373	102157373	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:102157373G>A	uc003dvs.1	+	9	924	c.42G>A	c.(40-42)GTG>GTA	p.V14V	ZPLD1_uc003dvt.1_Silent_p.V30V|ZPLD1_uc011bhg.1_Silent_p.V14V	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	14						integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						CAATTAGAGTGCTTCCGGGGT	0.433													21	52	---	---	---	---	capture	Silent	SNP	102157373	102157373	ZPLD1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	18097	81
CCDC37	348807	broad.mit.edu	37	3	126153142	126153142	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126153142G>A	uc003eiu.1	+	15	1645	c.1546G>A	c.(1546-1548)GAG>AAG	p.E516K	CCDC37_uc010hsg.1_Missense_Mutation_p.E517K	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	516										ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		CCAGCTGGATGAGCTGCTAGA	0.622													37	51	---	---	---	---	capture	Missense_Mutation	SNP	126153142	126153142	CCDC37	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	2783	81
B3GALNT1	8706	broad.mit.edu	37	3	160804500	160804500	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:160804500G>C	uc003fdv.2	-	5	462	c.43C>G	c.(43-45)CTG>GTG	p.L15V	B3GALNT1_uc003fdw.2_Missense_Mutation_p.L15V|B3GALNT1_uc003fdx.2_Missense_Mutation_p.L15V|B3GALNT1_uc003fdy.2_Missense_Mutation_p.L15V|B3GALNT1_uc003fdz.2_Missense_Mutation_p.L15V|B3GALNT1_uc003fea.2_Missense_Mutation_p.L15V|B3GALNT1_uc011bpa.1_Missense_Mutation_p.L15V	NM_033169	NP_149359	O75752	B3GL1_HUMAN	UDP-Gal:betaGlcNAc beta	15	Cytoplasmic (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			AGGGATCTCAGTGACATCCTA	0.527													9	38	---	---	---	---	capture	Missense_Mutation	SNP	160804500	160804500	B3GALNT1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	1235	81
ZNF391	346157	broad.mit.edu	37	6	27368167	27368167	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27368167G>A	uc003njf.1	+	3	536	c.18G>A	c.(16-18)GGG>GGA	p.G6G		NM_001076781	NP_001070249	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	6					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(2)|skin(1)	3						GCCTCAGAGGGAATACTGCTC	0.423													46	82	---	---	---	---	capture	Silent	SNP	27368167	27368167	ZNF391	6	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	17759	81
CCHCR1	54535	broad.mit.edu	37	6	31124628	31124628	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31124628A>G	uc003nsr.3	-	3	233	c.110T>C	c.(109-111)CTG>CCG	p.L37P	CCHCR1_uc011dne.1_Missense_Mutation_p.L37P|CCHCR1_uc003nsq.3_Intron|CCHCR1_uc003nsp.3_Missense_Mutation_p.L126P|CCHCR1_uc010jsk.1_Missense_Mutation_p.L37P|TCF19_uc003nss.2_5'Flank|TCF19_uc003nst.2_5'Flank	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	37					cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1						GGGTTGGACCAGGGGAATGTC	0.577													3	102	---	---	---	---	capture	Missense_Mutation	SNP	31124628	31124628	CCHCR1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	2850	81
TREML2	79865	broad.mit.edu	37	6	41166083	41166083	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41166083T>C	uc010jxm.1	-	2	319	c.140A>G	c.(139-141)AAA>AGA	p.K47R		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	47	Ig-like V-type.|Extracellular (Potential).				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					CACGCGGTTTTTGTAGCCCTT	0.537													106	194	---	---	---	---	capture	Missense_Mutation	SNP	41166083	41166083	TREML2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	16356	81
C6orf138	442213	broad.mit.edu	37	6	47846894	47846894	+	Silent	SNP	G	A	A	rs147985171	byFrequency	TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47846894G>A	uc011dwm.1	-	3	1720	c.1635C>T	c.(1633-1635)AAC>AAT	p.N545N	C6orf138_uc011dwn.1_Silent_p.N309N	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	562						integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						TGGCACTGACGTTGCTGACTT	0.443													23	34	---	---	---	---	capture	Silent	SNP	47846894	47846894	C6orf138	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2309	81
SGK1	6446	broad.mit.edu	37	6	134493394	134493394	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:134493394G>A	uc003qen.3	-	8	812	c.723C>T	c.(721-723)TTC>TTT	p.F241F	SGK1_uc003qeo.3_Silent_p.F336F|SGK1_uc011ect.1_Silent_p.F231F|SGK1_uc011ecu.1_Silent_p.F197F|SGK1_uc011ecv.1_Silent_p.F255F|SGK1_uc011ecw.1_Silent_p.F269F	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	241	Protein kinase.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TGCAGAGTCCGAAGTCAGTAA	0.448													120	83	---	---	---	---	capture	Silent	SNP	134493394	134493394	SGK1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	14100	81
KBTBD2	25948	broad.mit.edu	37	7	32909459	32909459	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:32909459G>T	uc003tdb.2	-	4	2029	c.1370C>A	c.(1369-1371)ACT>AAT	p.T457N	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	457	Kelch 3.										0			GBM - Glioblastoma multiforme(11;0.0499)			GGACCTACTAGTCTGTCTCAT	0.438													61	118	---	---	---	---	capture	Missense_Mutation	SNP	32909459	32909459	KBTBD2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	7915	81
IKZF1	10320	broad.mit.edu	37	7	50467932	50467932	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50467932C>T	uc003tow.3	+	9	1335	c.1167C>T	c.(1165-1167)TCC>TCT	p.S389S	IKZF1_uc003tox.3_Silent_p.S347S|IKZF1_uc003toy.3_Silent_p.S347S|IKZF1_uc011kck.1_Silent_p.S302S|IKZF1_uc003toz.3_Silent_p.S359S|IKZF1_uc010kyx.2_Silent_p.S129S|IKZF1_uc003tpa.3_Silent_p.S131S	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	389					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GCGAGGCGTCCCCGAGCAACA	0.672			D		ALL								6	35	---	---	---	---	capture	Silent	SNP	50467932	50467932	IKZF1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7537	81
EGFR	1956	broad.mit.edu	37	7	55221821	55221821	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221821G>A	uc003tqk.2	+	7	1111	c.865G>A	c.(865-867)GCC>ACC	p.A289T	EGFR_uc003tqh.2_Missense_Mutation_p.A289T|EGFR_uc003tqi.2_Missense_Mutation_p.A289T|EGFR_uc003tqj.2_Missense_Mutation_p.A289T|EGFR_uc010kzg.1_Missense_Mutation_p.A244T|EGFR_uc011kco.1_Missense_Mutation_p.A236T|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289T(3)|p.A289D(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGCTTTGGTGCCACCTGCGT	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			13	931	---	---	---	---	capture	Missense_Mutation	SNP	55221821	55221821	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	81
SEMA3C	10512	broad.mit.edu	37	7	80387708	80387708	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80387708G>A	uc003uhj.2	-	15	2144	c.1582C>T	c.(1582-1584)CGG>TGG	p.R528W	SEMA3C_uc011kgw.1_Missense_Mutation_p.R546W	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	528					immune response|response to drug	membrane	receptor activity			ovary(1)	1						TAAGGGTCCCGCGCCAGGCAG	0.527													204	179	---	---	---	---	capture	Missense_Mutation	SNP	80387708	80387708	SEMA3C	7	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	13919	81
NPTX2	4885	broad.mit.edu	37	7	98257875	98257875	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98257875C>T	uc003upl.2	+	5	1407	c.1230C>T	c.(1228-1230)GTC>GTT	p.V410V		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	410	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			ACAATAACGTCGATGTGTTCG	0.582													7	26	---	---	---	---	capture	Silent	SNP	98257875	98257875	NPTX2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	10510	81
C7orf51	222950	broad.mit.edu	37	7	100085924	100085924	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100085924C>A	uc003uvd.1	+	4	739	c.580C>A	c.(580-582)CAG>AAG	p.Q194K	C7orf51_uc003uve.1_5'UTR	NM_173564	NP_775835	Q6ZVC0	CG051_HUMAN	hypothetical protein FLJ37538	194										skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCTGCCTCTTCAGCGCCTCAC	0.637													32	124	---	---	---	---	capture	Missense_Mutation	SNP	100085924	100085924	C7orf51	7	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	2377	81
MUC17	140453	broad.mit.edu	37	7	100678887	100678887	+	Missense_Mutation	SNP	C	T	T	rs141608296		TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100678887C>T	uc003uxp.1	+	3	4243	c.4190C>T	c.(4189-4191)CCG>CTG	p.P1397L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1397	Extracellular (Potential).|59 X approximate tandem repeats.|21.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GGAACCACTCCGTTAACAAGT	0.507													107	481	---	---	---	---	capture	Missense_Mutation	SNP	100678887	100678887	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9884	81
FIS1	51024	broad.mit.edu	37	7	100887381	100887381	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100887381A>T	uc003uyj.3	-	2	171	c.85T>A	c.(85-87)TCG>ACG	p.S29T	FIS1_uc010lht.2_RNA|FIS1_uc010lhu.2_Intron	NM_016068	NP_057152	Q9Y3D6	FIS1_HUMAN	tetratricopeptide repeat domain 11	29	Cytoplasmic (Potential).				apoptosis|mitochondrial fission|peroxisome fission	integral to mitochondrial outer membrane|integral to peroxisomal membrane	protein binding				0	Lung NSC(181;0.168)|all_lung(186;0.215)					TTGGACACCGAGCCTGCTGCC	0.512											OREG0018218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	99	---	---	---	---	capture	Missense_Mutation	SNP	100887381	100887381	FIS1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	5842	81
DUS4L	11062	broad.mit.edu	37	7	107214222	107214222	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107214222T>G	uc003veh.2	+	5	645	c.312T>G	c.(310-312)TGT>TGG	p.C104W	DUS4L_uc003veg.2_Intron|DUS4L_uc011klw.1_Intron|DUS4L_uc011klx.1_5'UTR|DUS4L_uc010ljl.2_5'Flank	NM_181581	NP_853559	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like	104					tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0						GTATAGTCTGTCCTTATGCGA	0.383													137	214	---	---	---	---	capture	Missense_Mutation	SNP	107214222	107214222	DUS4L	7	T	G	G	G	1	0	0	0	0	1	0	0	0	751	58	4	4	4763	81
RHOBTB2	23221	broad.mit.edu	37	8	22864290	22864290	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22864290G>A	uc003xcq.2	+	5	1069	c.532G>A	c.(532-534)GCC>ACC	p.A178T	RHOBTB2_uc003xcp.2_Missense_Mutation_p.A200T|RHOBTB2_uc011kzp.1_Missense_Mutation_p.A185T|uc003xcr.2_RNA	NM_015178	NP_055993	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2 isoform 3	178	Rho-like.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			ovary(1)|lung(1)	2		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		TCGGGAGGTGGCCAAGGAGCT	0.577													4	114	---	---	---	---	capture	Missense_Mutation	SNP	22864290	22864290	RHOBTB2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13226	81
TEX15	56154	broad.mit.edu	37	8	30699744	30699744	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30699744T>C	uc003xil.2	-	1	6790	c.6790A>G	c.(6790-6792)AAG>GAG	p.K2264E		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2264										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TGTAAAATCTTCCTTCTGTTA	0.313													3	144	---	---	---	---	capture	Missense_Mutation	SNP	30699744	30699744	TEX15	8	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	15664	81
PLEC	5339	broad.mit.edu	37	8	144993481	144993481	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144993481G>A	uc003zaf.1	-	32	11089	c.10919C>T	c.(10918-10920)GCG>GTG	p.A3640V	PLEC_uc003zab.1_Missense_Mutation_p.A3503V|PLEC_uc003zac.1_Missense_Mutation_p.A3507V|PLEC_uc003zad.2_Missense_Mutation_p.A3503V|PLEC_uc003zae.1_Missense_Mutation_p.A3471V|PLEC_uc003zag.1_Missense_Mutation_p.A3481V|PLEC_uc003zah.2_Missense_Mutation_p.A3489V|PLEC_uc003zaj.2_Missense_Mutation_p.A3530V	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3640	Globular 2.|Plectin 16.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCTGGGGTCCGCCAGGACGCG	0.662													4	153	---	---	---	---	capture	Missense_Mutation	SNP	144993481	144993481	PLEC	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11955	81
MAGEB6	158809	broad.mit.edu	37	X	26212711	26212711	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:26212711G>A	uc004dbr.2	+	2	897	c.748G>A	c.(748-750)GTT>ATT	p.V250I	MAGEB6_uc010ngc.1_Missense_Mutation_p.V30I	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	250	MAGE.									ovary(3)	3						GGCCTTTGGCGTTGAATTGAA	0.517													43	13	---	---	---	---	capture	Missense_Mutation	SNP	26212711	26212711	MAGEB6	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9093	81
TRPM4	54795	broad.mit.edu	37	19	49671909	49671910	+	In_Frame_Ins	INS	-	GCA	GCA			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49671909_49671910insGCA	uc002pmw.2	+	6	784_785	c.712_713insGCA	c.(712-714)GGC>GGCAGC	p.238_239insS	TRPM4_uc010emu.2_In_Frame_Ins_p.238_239insS|TRPM4_uc010yak.1_5'UTR|TRPM4_uc002pmx.2_In_Frame_Ins_p.64_65insS|TRPM4_uc010emv.2_In_Frame_Ins_p.123_124insS|TRPM4_uc010yal.1_5'UTR	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	238_239	Cytoplasmic (Potential).				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GGTGGACGACGGCACACACGGC	0.658													18	39	---	---	---	---	capture_indel	In_Frame_Ins	INS	49671909	49671910	TRPM4	19	-	GCA	GCA	GCA	1	0	1	1	0	0	0	0	0	507	39	5	5	16471	81
LENG1	79165	broad.mit.edu	37	19	54660572	54660573	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54660572_54660573delTC	uc002qdm.2	-	3	516_517	c.503_504delGA	c.(502-504)AGAfs	p.R168fs		NM_024316	NP_077292	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1	168										ovary(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CGCCGTGCTGTCTCTTCTTCCC	0.634													66	110	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	54660572	54660573	LENG1	19	TC	-	-	-	1	0	1	0	1	0	0	0	0	751	58	5	5	8643	81
TMEM67	91147	broad.mit.edu	37	8	94767177	94767178	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:94767177_94767178insG	uc011lgk.1	+	1	106_107	c.35_36insG	c.(34-36)GCGfs	p.A12fs	TMEM67_uc010mau.2_Frame_Shift_Ins_p.A12fs|TMEM67_uc010mav.2_Frame_Shift_Ins_p.A12fs|TMEM67_uc010mat.1_Intron|TMEM67_uc010maw.2_Frame_Shift_Ins_p.A12fs|TMEM67_uc003yga.3_Intron	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	12	Helical; (Potential).				cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			GTGGCAATGGCGGTTTGGTCCC	0.653													7	191	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	94767177	94767178	TMEM67	8	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	16079	81
CDKN2A	1029	broad.mit.edu	37	9	21971124	21971125	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-06-2557-01	TCGA-06-2557-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21971124_21971125delGA	uc003zpk.2	-	2	445_446	c.233_234delTC	c.(232-234)CTCfs	p.L78fs	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Frame_Shift_Del_p.S133fs	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	78	ANK 3.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.L78fs*41(17)|p.?(13)|p.E61_L94del(1)|p.L78fs*68(1)|p.A76fs*64(1)|p.T79fs*41(1)|p.L65fs*38(1)|p.L78fs*67(1)|p.A68fs*3(1)|p.L78H(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGGGTCGGGTGAGAGTGGCGGG	0.723		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			11	9	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	21971124	21971125	CDKN2A	9	GA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	3130	81
