Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AADACL4	343066	broad.mit.edu	37	1	12726621	12726621	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12726621G>A	uc001auf.2	+	4	1099	c.1099G>A	c.(1099-1101)GTG>ATG	p.V367M		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	367	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		GGGGGTCCGCGTGACATGGTA	0.493													7	286	---	---	---	---	capture	Missense_Mutation	SNP	12726621	12726621	AADACL4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13	82
CNKSR1	10256	broad.mit.edu	37	1	26507045	26507045	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26507045C>T	uc001bln.3	+	2	212	c.154C>T	c.(154-156)CGG>TGG	p.R52W	CNKSR1_uc010oex.1_RNA|CNKSR1_uc001blm.3_Missense_Mutation_p.R52W|CNKSR1_uc009vsd.2_5'UTR|CNKSR1_uc009vse.2_5'UTR|CNKSR1_uc001blo.2_5'UTR	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	52	SAM.				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGCTGTGCGGTCTCTGGG	0.622													4	162	---	---	---	---	capture	Missense_Mutation	SNP	26507045	26507045	CNKSR1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3571	82
CYP4B1	1580	broad.mit.edu	37	1	47264924	47264924	+	Silent	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47264924T>C	uc001cqm.3	+	1	255	c.171T>C	c.(169-171)CAT>CAC	p.H57H	CYP4B1_uc009vyl.1_5'UTR|CYP4B1_uc001cqn.3_Silent_p.H57H|CYP4B1_uc009vym.2_Silent_p.H57H|CYP4B1_uc010omk.1_5'UTR	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	57					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TTTTTGGACATGCCCTCGAGG	0.572													12	8	---	---	---	---	capture	Silent	SNP	47264924	47264924	CYP4B1	1	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	4145	82
C1orf175	374977	broad.mit.edu	37	1	55166995	55166995	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55166995C>T	uc010ooe.1	+	19	3609	c.3285C>T	c.(3283-3285)GAC>GAT	p.D1095D	C1orf175_uc001cxq.2_RNA|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Silent_p.D613D|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc009vzq.1_RNA|C1orf175_uc001cxt.1_RNA|C1orf175_uc009vzr.1_Silent_p.D297D	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977	1095	HEAT 3.					integral to membrane	binding				0						ACTTCAGCGACGTGAGGACCT	0.592													11	25	---	---	---	---	capture	Silent	SNP	55166995	55166995	C1orf175	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1998	82
CD101	9398	broad.mit.edu	37	1	117552685	117552685	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117552685C>T	uc010oxb.1	+	2	315	c.257C>T	c.(256-258)ACG>ATG	p.T86M	CD101_uc009whd.2_Missense_Mutation_p.T86M|CD101_uc010oxc.1_Missense_Mutation_p.T86M|CD101_uc010oxd.1_Missense_Mutation_p.T86M	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	86	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GCAGTATATACGCAGCGGGTG	0.532													65	92	---	---	---	---	capture	Missense_Mutation	SNP	117552685	117552685	CD101	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2933	82
ACP6	51205	broad.mit.edu	37	1	147119358	147119358	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147119358G>A	uc001epr.2	-	10	1618	c.1154C>T	c.(1153-1155)CCG>CTG	p.P385L		NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor	385					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					GCAACCTCTCGGCACCTGCTC	0.522													50	80	---	---	---	---	capture	Missense_Mutation	SNP	147119358	147119358	ACP6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	165	82
AQP10	89872	broad.mit.edu	37	1	154295505	154295505	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154295505C>T	uc001feu.2	+	3	320	c.280C>T	c.(280-282)CGC>TGC	p.R94C	AQP10_uc001fev.2_Missense_Mutation_p.R94C|ATP8B2_uc001few.2_5'Flank	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	94	Cytoplasmic (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CATCGTTGGACGCCTCCCCTG	0.468													75	158	---	---	---	---	capture	Missense_Mutation	SNP	154295505	154295505	AQP10	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	815	82
CAMK1G	57172	broad.mit.edu	37	1	209773439	209773439	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209773439G>A	uc001hhd.2	+	3	306	c.204G>A	c.(202-204)GAG>GAA	p.E68E	CAMK1G_uc001hhf.3_Silent_p.E68E|CAMK1G_uc001hhe.2_Silent_p.E68E	NM_020439	NP_065172	Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	68	Protein kinase.					Golgi membrane|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		TGGAGAATGAGATTGCTGTGT	0.453													34	290	---	---	---	---	capture	Silent	SNP	209773439	209773439	CAMK1G	1	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	2574	82
GJC2	57165	broad.mit.edu	37	1	228345795	228345795	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228345795C>T	uc001hsk.2	+	2	511	c.336C>T	c.(334-336)CGC>CGT	p.R112R		NM_020435	NP_065168	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	112	Cytoplasmic (Potential).				cell death	connexon complex|integral to membrane					0		Prostate(94;0.0405)				Agcggcgccgcgccctccgcc	0.537													5	5	---	---	---	---	capture	Silent	SNP	228345795	228345795	GJC2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6352	82
OR2L8	391190	broad.mit.edu	37	1	248112821	248112821	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248112821T>C	uc001idt.1	+	1	662	c.662T>C	c.(661-663)CTC>CCC	p.L221P	OR2L13_uc001ids.2_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GGCCAGGTTCTCTTTGCTGTC	0.463													12	90	---	---	---	---	capture	Missense_Mutation	SNP	248112821	248112821	OR2L8	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10913	82
CUBN	8029	broad.mit.edu	37	10	17083094	17083094	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:17083094T>C	uc001ioo.2	-	27	4007	c.3955A>G	c.(3955-3957)AAC>GAC	p.N1319D		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1319	CUB 8.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AATGTGTAGTTCACAGTGTTG	0.383													8	210	---	---	---	---	capture	Missense_Mutation	SNP	17083094	17083094	CUBN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	4011	82
A1CF	29974	broad.mit.edu	37	10	52587910	52587910	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:52587910T>A	uc001jjj.2	-	7	938	c.750A>T	c.(748-750)GAA>GAT	p.E250D	A1CF_uc010qhn.1_Missense_Mutation_p.E258D|A1CF_uc001jji.2_Missense_Mutation_p.E250D|A1CF_uc001jjh.2_Missense_Mutation_p.E258D|A1CF_uc010qho.1_Missense_Mutation_p.E258D|A1CF_uc009xov.2_Missense_Mutation_p.E250D	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	250	RRM 3.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						TATTGTTGAATTCCTTTTCAA	0.234													52	43	---	---	---	---	capture	Missense_Mutation	SNP	52587910	52587910	A1CF	10	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	2	82
PTEN	5728	broad.mit.edu	37	10	89692904	89692904	+	Nonsense_Mutation	SNP	C	T	T	rs121909224		TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692904C>T	uc001kfb.2	+	6	1419	c.388C>T	c.(388-390)CGA>TGA	p.R130*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(65)|p.R130*(61)|p.R130Q(43)|p.R130fs*4(12)|p.R130L(7)|p.R130P(4)|p.R55fs*1(4)|p.K128_R130del(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.R130R(1)|p.F56fs*2(1)|p.G129fs*50(1)|p.G129fs*51(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGGAAAGGGACGAACTGGTGT	0.403	R130G(OV56_OVARY)|R130G(KMBC2_URINARY_TRACT)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			76	37	---	---	---	---	capture	Nonsense_Mutation	SNP	89692904	89692904	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	82
OR51G1	79324	broad.mit.edu	37	11	4945014	4945014	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4945014T>A	uc010qyr.1	-	1	556	c.556A>T	c.(556-558)ATC>TTC	p.I186F		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	186	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCTTCATGATCTCCAGGTGA	0.522													44	27	---	---	---	---	capture	Missense_Mutation	SNP	4945014	4945014	OR51G1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	11002	82
FADS3	3995	broad.mit.edu	37	11	61646097	61646097	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61646097C>G	uc001nsm.2	-	5	787	c.634G>C	c.(634-636)GCC>CCC	p.A212P	FADS3_uc001nsn.2_Missense_Mutation_p.A88P	NM_021727	NP_068373	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	212	Cytoplasmic (Potential).				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	heme binding|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water			ovary(1)|pancreas(1)	2						CACCAGTGGGCGGAGAAGCCC	0.667													28	45	---	---	---	---	capture	Missense_Mutation	SNP	61646097	61646097	FADS3	11	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	5321	82
DNAJC4	3338	broad.mit.edu	37	11	64001432	64001432	+	Silent	SNP	C	T	T	rs138996784	by1000genomes	TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64001432C>T	uc001nys.2	+	6	1056	c.594C>T	c.(592-594)AAC>AAT	p.N198N	uc001nyr.1_5'Flank|DNAJC4_uc001nyt.2_Silent_p.N199N|DNAJC4_uc001nyu.2_Silent_p.N198N|VEGFB_uc001nyw.2_5'Flank|VEGFB_uc001nyx.2_5'Flank	NM_005528	NP_005519	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	198					protein folding|response to unfolded protein	integral to membrane|membrane fraction	heat shock protein binding|unfolded protein binding				0						CCTTCTACAACGAAGCCCGGG	0.547													69	143	---	---	---	---	capture	Silent	SNP	64001432	64001432	DNAJC4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4605	82
FAT3	120114	broad.mit.edu	37	11	92533806	92533806	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92533806C>T	uc001pdj.3	+	9	7644	c.7627C>T	c.(7627-7629)CGA>TGA	p.R2543*		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2543	Cadherin 23.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGCCAAGGATCGATTCCTCAT	0.488										TCGA Ovarian(4;0.039)			12	22	---	---	---	---	capture	Nonsense_Mutation	SNP	92533806	92533806	FAT3	11	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	5637	82
CNTN5	53942	broad.mit.edu	37	11	99690432	99690432	+	Silent	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:99690432G>T	uc001pga.2	+	4	552	c.213G>T	c.(211-213)GGG>GGT	p.G71G	CNTN5_uc009ywv.1_Silent_p.G71G|CNTN5_uc001pfz.2_Silent_p.G71G|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	71					cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GCTGGCTAGGGGCAGCTCAGA	0.378													6	61	---	---	---	---	capture	Silent	SNP	99690432	99690432	CNTN5	11	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	3609	82
CLDN25	644672	broad.mit.edu	37	11	113650596	113650596	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113650596A>G	uc009yyw.1	+	1	79	c.79A>G	c.(79-81)ACC>GCC	p.T27A		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	27	Helical; (Potential).					integral to membrane|tight junction	structural molecule activity				0						CTCCTGTGTTACCACCATCCT	0.557													22	193	---	---	---	---	capture	Missense_Mutation	SNP	113650596	113650596	CLDN25	11	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	3450	82
ACSM4	341392	broad.mit.edu	37	12	7476137	7476137	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7476137G>C	uc001qsx.1	+	9	1289	c.1289G>C	c.(1288-1290)TGT>TCT	p.C430S		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	430					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						CGGCCCTTCTGTTTCTTCTCT	0.229													33	63	---	---	---	---	capture	Missense_Mutation	SNP	7476137	7476137	ACSM4	12	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	186	82
CD163	9332	broad.mit.edu	37	12	7636017	7636017	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7636017G>A	uc001qsz.3	-	12	3162	c.3034C>T	c.(3034-3036)CGC>TGC	p.R1012C	CD163_uc001qta.3_Missense_Mutation_p.R1012C|CD163_uc009zfw.2_Missense_Mutation_p.R1045C	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	1012	SRCR 9.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TGGCCCCAGCGTCTGGCAGGA	0.512													41	56	---	---	---	---	capture	Missense_Mutation	SNP	7636017	7636017	CD163	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2938	82
KIAA1467	57613	broad.mit.edu	37	12	13208635	13208635	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13208635A>G	uc001rbi.2	+	2	211	c.188A>G	c.(187-189)GAT>GGT	p.D63G	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	63						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		CCCGACTCAGATGCTGAGGTT	0.562													59	84	---	---	---	---	capture	Missense_Mutation	SNP	13208635	13208635	KIAA1467	12	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	8157	82
PTPRB	5787	broad.mit.edu	37	12	70949924	70949924	+	Silent	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70949924A>G	uc001swb.3	-	17	4095	c.4065T>C	c.(4063-4065)CCT>CCC	p.P1355P	PTPRB_uc010sto.1_Silent_p.P1265P|PTPRB_uc010stp.1_Silent_p.P1265P|PTPRB_uc001swc.3_Silent_p.P1573P|PTPRB_uc001swa.3_Silent_p.P1485P	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1355	Fibronectin type-III 16.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GTATCTTGTCAGGCTCTAAAG	0.438													3	49	---	---	---	---	capture	Silent	SNP	70949924	70949924	PTPRB	12	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	12691	82
FSCB	84075	broad.mit.edu	37	14	44974610	44974610	+	Silent	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:44974610A>T	uc001wvn.2	-	1	1890	c.1581T>A	c.(1579-1581)CTT>CTA	p.L527L		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	527	Ala-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TAGCTGCTAGAAGCTGAATTT	0.493													8	83	---	---	---	---	capture	Silent	SNP	44974610	44974610	FSCB	14	A	T	T	T	1	0	0	0	0	0	0	0	1	106	9	4	4	6009	82
SYT16	83851	broad.mit.edu	37	14	62536340	62536340	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:62536340C>T	uc001xfu.1	+	2	740	c.543C>T	c.(541-543)GAC>GAT	p.D181D	SYT16_uc010tsd.1_Silent_p.D181D	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	181										central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TTGGGGATGACGAAGAGCTGT	0.483													98	173	---	---	---	---	capture	Silent	SNP	62536340	62536340	SYT16	14	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15360	82
SERPINA5	5104	broad.mit.edu	37	14	95054156	95054156	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95054156T>C	uc001ydm.2	+	3	667	c.457T>C	c.(457-459)TAC>CAC	p.Y153H	SERPINA5_uc010ave.2_Missense_Mutation_p.Y153H|SERPINA5_uc001ydn.1_Missense_Mutation_p.Y153H	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade	153					fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	GAAGACGCTGTACCTGGCAGA	0.537													9	104	---	---	---	---	capture	Missense_Mutation	SNP	95054156	95054156	SERPINA5	14	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	13985	82
WDR72	256764	broad.mit.edu	37	15	53994476	53994476	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:53994476G>A	uc002acj.2	-	12	1466	c.1424C>T	c.(1423-1425)TCG>TTG	p.S475L	WDR72_uc010bfi.1_Missense_Mutation_p.S475L	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	475	WD 6.									lung(1)|skin(1)	2				all cancers(107;0.0511)		GTCTAATTTCGAAGAGAGACC	0.383													102	60	---	---	---	---	capture	Missense_Mutation	SNP	53994476	53994476	WDR72	15	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17203	82
HERC1	8925	broad.mit.edu	37	15	63948072	63948072	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63948072C>T	uc002amp.2	-	50	10101	c.9953G>A	c.(9952-9954)CGA>CAA	p.R3318Q		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	3318					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						AGCAATTCCTCGGAGAAAGCT	0.448													18	3	---	---	---	---	capture	Missense_Mutation	SNP	63948072	63948072	HERC1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6983	82
ACSM2B	348158	broad.mit.edu	37	16	20548638	20548638	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20548638T>C	uc002dhj.3	-	15	1886	c.1676A>G	c.(1675-1677)CAA>CGA	p.Q559R	ACSM2B_uc002dhk.3_Missense_Mutation_p.Q559R	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	559					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						TTTGGTTCGTTGAATTTTCCC	0.483													78	416	---	---	---	---	capture	Missense_Mutation	SNP	20548638	20548638	ACSM2B	16	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	184	82
IL21R	50615	broad.mit.edu	37	16	27441407	27441407	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27441407G>A	uc002doq.1	+	2	248	c.15G>A	c.(13-15)TGG>TGA	p.W5*	IL21R_uc002dor.1_Nonsense_Mutation_p.W5*|IL21R_uc002dos.1_Nonsense_Mutation_p.W5*	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	5					natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						CGCGTGGCTGGGCCGCCCCCT	0.716			T	BCL6	NHL								8	21	---	---	---	---	capture	Nonsense_Mutation	SNP	27441407	27441407	IL21R	16	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	7594	82
RILP	83547	broad.mit.edu	37	17	1551765	1551765	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1551765G>T	uc002ftd.2	-	5	994	c.700C>A	c.(700-702)CGC>AGC	p.R234S	SCARF1_uc002fsy.1_5'Flank|SCARF1_uc002fsz.1_5'Flank|SCARF1_uc002fta.1_5'Flank|SCARF1_uc010cjv.1_5'Flank	NM_031430	NP_113618	Q96NA2	RILP_HUMAN	Rab interacting lysosomal protein	234					endosome to lysosome transport|protein transport	late endosome membrane|lysosomal membrane|phagocytic vesicle membrane	Rab GTPase binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TCCGAGGGGCGCCCGAGCTGC	0.637													28	38	---	---	---	---	capture	Missense_Mutation	SNP	1551765	1551765	RILP	17	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	13252	82
TP53	7157	broad.mit.edu	37	17	7577097	7577097	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577097C>G	uc002gim.2	-	8	1035	c.841G>C	c.(841-843)GAC>CAC	p.D281H	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.D281H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D149H|TP53_uc010cng.1_Missense_Mutation_p.D149H|TP53_uc002gii.1_Missense_Mutation_p.D149H|TP53_uc010cnh.1_Missense_Mutation_p.D281H|TP53_uc010cni.1_Missense_Mutation_p.D281H|TP53_uc002gij.2_Missense_Mutation_p.D281H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	281	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> A (in sporadic cancers; somatic mutation).|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.D281E(25)|p.D281H(19)|p.D281N(18)|p.D281G(10)|p.0?(7)|p.D281Y(6)|p.D281D(5)|p.D281V(3)|p.D281fs*63(2)|p.?(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.D281R(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGCGCCGGTCTCTCCCAGGA	0.547		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			34	18	---	---	---	---	capture	Missense_Mutation	SNP	7577097	7577097	TP53	17	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	16264	82
KDM6B	23135	broad.mit.edu	37	17	7752755	7752755	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7752755C>T	uc002giw.1	+	11	3525	c.3149C>T	c.(3148-3150)CCA>CTA	p.P1050L	KDM6B_uc002gix.2_Missense_Mutation_p.P352L	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1050	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						CCCACAGCTCCAGCCCCTCCA	0.677													10	16	---	---	---	---	capture	Missense_Mutation	SNP	7752755	7752755	KDM6B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	8060	82
GRB7	2886	broad.mit.edu	37	17	37902194	37902194	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37902194C>A	uc002hsr.2	+	13	1549	c.1299C>A	c.(1297-1299)CAC>CAA	p.H433Q	GRB7_uc002hss.2_Missense_Mutation_p.H433Q|GRB7_uc010cwc.2_Missense_Mutation_p.H433Q|GRB7_uc002hst.2_Intron	NM_005310	NP_005301	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	433	SH2.				blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TCTGGTTCCACGGGCGCATTT	0.617													7	297	---	---	---	---	capture	Missense_Mutation	SNP	37902194	37902194	GRB7	17	C	A	A	A	1	0	0	0	0	1	0	0	0	246	19	4	4	6692	82
GSDMA	284110	broad.mit.edu	37	17	38133285	38133285	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38133285C>T	uc002htl.1	+	12	1430	c.1312C>T	c.(1312-1314)CTT>TTT	p.L438F	GSDMA_uc002htm.1_Missense_Mutation_p.L438F	NM_178171	NP_835465	Q96QA5	GSDMA_HUMAN	gasdermin 1	438					apoptosis|induction of apoptosis	perinuclear region of cytoplasm					0						CCTCTCTCTCCTTCAGCAGCT	0.557													20	126	---	---	---	---	capture	Missense_Mutation	SNP	38133285	38133285	GSDMA	17	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	6748	82
KRTAP4-9	100132386	broad.mit.edu	37	17	39262218	39262218	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39262218C>A	uc010wfp.1	+	1	578	c.578C>A	c.(577-579)ACC>AAC	p.T193N		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	193						keratin filament					0						TATCGCCCAACCTGTGTCATC	0.483													2	3	---	---	---	---	capture	Missense_Mutation	SNP	39262218	39262218	KRTAP4-9	17	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	8477	82
MPO	4353	broad.mit.edu	37	17	56355275	56355275	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56355275C>T	uc002ivu.1	-	7	1294	c.1117G>A	c.(1117-1119)GGC>AGC	p.G373S		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	373					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	AGGGCCCGGCCGTTGTCTTGG	0.652													35	51	---	---	---	---	capture	Missense_Mutation	SNP	56355275	56355275	MPO	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9644	82
DNAH17	8632	broad.mit.edu	37	17	76420030	76420030	+	Missense_Mutation	SNP	G	A	A	rs143246806	byFrequency	TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76420030G>A	uc010dhp.1	-	26	4568	c.4346C>T	c.(4345-4347)GCG>GTG	p.A1449V	PGS1_uc002jvm.2_Intron|PGS1_uc010wtt.1_Intron|PGS1_uc010dho.2_Intron|PGS1_uc002jvn.2_Intron|PGS1_uc002jvo.2_Intron|DNAH17_uc002jvq.2_Missense_Mutation_p.A734V|DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GATCCACTTCGCTGCCTTCTC	0.279													129	153	---	---	---	---	capture	Missense_Mutation	SNP	76420030	76420030	DNAH17	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4558	82
TCF4	6925	broad.mit.edu	37	18	52921829	52921829	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:52921829C>T	uc002lfz.2	-	15	1861	c.1249G>A	c.(1249-1251)GAC>AAC	p.D417N	TCF4_uc002lfw.3_Missense_Mutation_p.D257N|TCF4_uc010xdu.1_Missense_Mutation_p.D287N|TCF4_uc010xdv.1_Missense_Mutation_p.D287N|TCF4_uc002lfx.2_Missense_Mutation_p.D346N|TCF4_uc010xdw.1_Missense_Mutation_p.D287N|TCF4_uc002lfy.2_Missense_Mutation_p.D375N|TCF4_uc010xdx.1_Missense_Mutation_p.D393N|TCF4_uc010dph.1_Missense_Mutation_p.D417N|TCF4_uc010xdy.1_Missense_Mutation_p.D393N|TCF4_uc002lga.2_Missense_Mutation_p.D519N|TCF4_uc002lgb.1_Missense_Mutation_p.D257N|TCF4_uc010dpi.2_Missense_Mutation_p.D423N|TCF4_uc002lfv.2_Missense_Mutation_p.D200N	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b	417					positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CCATGCATGTCCCCATGACCA	0.502													41	18	---	---	---	---	capture	Missense_Mutation	SNP	52921829	52921829	TCF4	18	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	15580	82
SOCS6	9306	broad.mit.edu	37	18	67992070	67992070	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67992070A>G	uc002lkr.1	+	2	482	c.166A>G	c.(166-168)ATC>GTC	p.I56V	SOCS6_uc010dqq.2_Missense_Mutation_p.I56V	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	56					defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CAGCTGCGATATCAACGGTGA	0.428													52	83	---	---	---	---	capture	Missense_Mutation	SNP	67992070	67992070	SOCS6	18	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	14810	82
HMHA1	23526	broad.mit.edu	37	19	1083208	1083208	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1083208G>A	uc002lqz.1	+	21	3042	c.2811G>A	c.(2809-2811)ACG>ACA	p.T937T	HMHA1_uc010xgd.1_Silent_p.T953T|HMHA1_uc010xge.1_Silent_p.T805T|HMHA1_uc002lra.1_Silent_p.T777T|HMHA1_uc002lrb.1_Silent_p.T820T|HMHA1_uc002lrc.1_Silent_p.T572T|HMHA1_uc002lrd.1_Silent_p.T13T|HMHA1_uc010dsd.1_Silent_p.T43T	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	937	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGGCCCACGCTGCTTCGGC	0.672													8	11	---	---	---	---	capture	Silent	SNP	1083208	1083208	HMHA1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7165	82
FARSA	2193	broad.mit.edu	37	19	13035595	13035595	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13035595G>A	uc002mvs.2	-	10	1101	c.1053C>T	c.(1051-1053)TTC>TTT	p.F351F	FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Silent_p.F320F|FARSA_uc010dyy.1_Silent_p.F272F	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	351					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	GGTCGATGGAGAAGTACTTGA	0.612													5	169	---	---	---	---	capture	Silent	SNP	13035595	13035595	FARSA	19	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	5625	82
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													3	24	---	---	---	---	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	82
TTC15	51112	broad.mit.edu	37	2	3482694	3482694	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3482694G>T	uc002qxm.1	+	11	2161	c.1955G>T	c.(1954-1956)AGA>ATA	p.R652I	TTC15_uc002qxn.1_Missense_Mutation_p.R652I|TTC15_uc010ewm.1_Missense_Mutation_p.R658I	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15	652	TPR 3.						binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)		ATGGATCCAAGAAACGCAGTG	0.532													22	39	---	---	---	---	capture	Missense_Mutation	SNP	3482694	3482694	TTC15	2	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	16564	82
RNF144A	9781	broad.mit.edu	37	2	7154885	7154885	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:7154885A>G	uc002qys.2	+	5	725	c.283A>G	c.(283-285)AAG>GAG	p.K95E	RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144	95	IBR-type.					Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		AAGATATAAAAAGCTACAATT	0.368													12	184	---	---	---	---	capture	Missense_Mutation	SNP	7154885	7154885	RNF144A	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	13337	82
THADA	63892	broad.mit.edu	37	2	43802136	43802136	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:43802136C>T	uc002rsw.3	-	11	1420	c.1068G>A	c.(1066-1068)CTG>CTA	p.L356L	THADA_uc002rsx.3_Silent_p.L356L|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Silent_p.L66L|THADA_uc002rta.2_Silent_p.L66L|THADA_uc002rtb.1_Silent_p.L356L|THADA_uc002rtc.3_Silent_p.L356L|THADA_uc002rtd.2_Silent_p.L356L	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	356							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AGATTCTAGACAGAAACATTT	0.373													67	125	---	---	---	---	capture	Silent	SNP	43802136	43802136	THADA	2	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	15725	82
TTC30B	150737	broad.mit.edu	37	2	178416069	178416069	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:178416069A>T	uc002uln.2	-	1	1456	c.1423T>A	c.(1423-1425)TAC>AAC	p.Y475N	TTC30B_uc010zfc.1_Missense_Mutation_p.Y247N	NM_152517	NP_689730	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	475	TPR 7.				cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			GCTTCTTTGTATTTGTTTTCC	0.393													24	393	---	---	---	---	capture	Missense_Mutation	SNP	178416069	178416069	TTC30B	2	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	16581	82
MYO1B	4430	broad.mit.edu	37	2	192265141	192265141	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192265141A>G	uc010fsg.2	+	22	2584	c.2329A>G	c.(2329-2331)AAG>GAG	p.K777E	MYO1B_uc002usq.2_Missense_Mutation_p.K777E|MYO1B_uc002usr.2_Missense_Mutation_p.K777E|MYO1B_uc002usu.2_Missense_Mutation_p.K51E|MYO1B_uc002usv.2_5'Flank	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	777	IQ 3.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			GAAGCATCAAAAGCGCTGTAA	0.473													57	124	---	---	---	---	capture	Missense_Mutation	SNP	192265141	192265141	MYO1B	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	9979	82
DNAH7	56171	broad.mit.edu	37	2	196852773	196852773	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:196852773A>G	uc002utj.3	-	13	1635	c.1534T>C	c.(1534-1536)TTC>CTC	p.F512L		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	512	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCTGCGAGGAAGTTATCAACA	0.338													4	76	---	---	---	---	capture	Missense_Mutation	SNP	196852773	196852773	DNAH7	2	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	4562	82
CXCR1	3577	broad.mit.edu	37	2	219029097	219029097	+	Missense_Mutation	SNP	G	A	A	rs61755739		TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219029097G>A	uc002vhc.2	-	2	957	c.838C>T	c.(838-840)CGC>TGC	p.R280C		NM_000634	NP_000625	P25024	CXCR1_HUMAN	interleukin 8 receptor alpha	280	Extracellular (Potential).				dendritic cell chemotaxis|inflammatory response	integral to membrane|plasma membrane	interleukin-8 receptor activity			lung(2)	2						ATGTTGTTGCGGCGCTCACAG	0.572													41	89	---	---	---	---	capture	Missense_Mutation	SNP	219029097	219029097	CXCR1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4050	82
TRIP12	9320	broad.mit.edu	37	2	230724206	230724206	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:230724206C>T	uc002vpw.1	-	3	292	c.183G>A	c.(181-183)GGG>GGA	p.G61G	TRIP12_uc002vpx.1_Silent_p.G103G|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_RNA|TRIP12_uc010fxh.1_Silent_p.G61G	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	61					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TAGGCACCTGCCCCGTTTTTT	0.453													162	284	---	---	---	---	capture	Silent	SNP	230724206	230724206	TRIP12	2	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	16439	82
C20orf54	113278	broad.mit.edu	37	20	744614	744614	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:744614C>T	uc002wed.3	-	3	940	c.601G>A	c.(601-603)GGA>AGA	p.G201R	C20orf54_uc002wee.2_Missense_Mutation_p.G201R	NM_033409	NP_212134	Q9NQ40	RFT2_HUMAN	hypothetical protein LOC113278 precursor	201					sensory perception of sound	integral to plasma membrane	riboflavin transporter activity			ovary(2)	2						GCTTCCATTCCGGGGAGGGCG	0.587													6	12	---	---	---	---	capture	Missense_Mutation	SNP	744614	744614	C20orf54	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2095	82
PCSK2	5126	broad.mit.edu	37	20	17434509	17434509	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:17434509C>T	uc002wpm.2	+	9	1328	c.1008C>T	c.(1006-1008)AAC>AAT	p.N336N	PCSK2_uc002wpl.2_Silent_p.N317N|PCSK2_uc010zrm.1_Silent_p.N301N	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	336	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CAGCCATCAACGACGGCAGGA	0.617													38	68	---	---	---	---	capture	Silent	SNP	17434509	17434509	PCSK2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11504	82
PRIC285	85441	broad.mit.edu	37	20	62198633	62198633	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62198633G>A	uc002yfm.2	-	7	2970	c.2078C>T	c.(2077-2079)GCG>GTG	p.A693V	PRIC285_uc002yfl.1_Missense_Mutation_p.A124V	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	693					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			GTGGTCGCCCGCCAGCACGAG	0.682													16	12	---	---	---	---	capture	Missense_Mutation	SNP	62198633	62198633	PRIC285	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12381	82
SAMSN1	64092	broad.mit.edu	37	21	15858270	15858270	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:15858270A>T	uc002yju.1	-	8	1167	c.1085T>A	c.(1084-1086)ATG>AAG	p.M362K	SAMSN1_uc010gky.1_Missense_Mutation_p.M194K|SAMSN1_uc002yjv.1_Missense_Mutation_p.M430K	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	362					negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CTTATGTACCATGTCAGACAG	0.398													98	177	---	---	---	---	capture	Missense_Mutation	SNP	15858270	15858270	SAMSN1	21	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	13722	82
RBMS3	27303	broad.mit.edu	37	3	30032579	30032579	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:30032579G>T	uc003cel.2	+	14	1416	c.1186G>T	c.(1186-1188)GTT>TTT	p.V396F	RBMS3_uc003cek.2_Missense_Mutation_p.V380F|RBMS3_uc010hfq.2_Missense_Mutation_p.V393F|RBMS3_uc003cem.2_Missense_Mutation_p.V378F|RBMS3_uc010hfr.2_Missense_Mutation_p.V380F	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting	396						cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)				TTAGGGTGTTGTTGCTGATAC	0.493													25	60	---	---	---	---	capture	Missense_Mutation	SNP	30032579	30032579	RBMS3	3	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	13045	82
CLASP2	23122	broad.mit.edu	37	3	33584995	33584995	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:33584995G>A	uc003cfu.2	-	31	3688	c.3334C>T	c.(3334-3336)CGA>TGA	p.R1112*	CLASP2_uc003cfs.2_Nonsense_Mutation_p.R319*|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Nonsense_Mutation_p.R712*	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	1121										ovary(3)|central_nervous_system(1)	4						GCTGGTGATCGTGGTGTTGGT	0.373													6	147	---	---	---	---	capture	Nonsense_Mutation	SNP	33584995	33584995	CLASP2	3	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	3420	82
STAB1	23166	broad.mit.edu	37	3	52550236	52550236	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52550236G>A	uc003dej.2	+	38	4200	c.4126G>A	c.(4126-4128)GGG>AGG	p.G1376R	STAB1_uc003dek.1_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1376	Laminin EGF-like 1.|Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GGGCCGCTACGGGCCCAACTG	0.697													24	30	---	---	---	---	capture	Missense_Mutation	SNP	52550236	52550236	STAB1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15127	82
FAM116A	201627	broad.mit.edu	37	3	57646541	57646541	+	Silent	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:57646541A>G	uc003dja.2	-	7	716	c.645T>C	c.(643-645)CCT>CCC	p.P215P		NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627	215										pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)		GCACTGGGGCAGGCCATCGAT	0.303													24	39	---	---	---	---	capture	Silent	SNP	57646541	57646541	FAM116A	3	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	5361	82
C3orf67	200844	broad.mit.edu	37	3	58739528	58739528	+	Missense_Mutation	SNP	C	T	T	rs139574013		TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58739528C>T	uc003dkt.1	-	15	1956	c.1547G>A	c.(1546-1548)CGT>CAT	p.R516H	C3orf67_uc003dkr.1_RNA|C3orf67_uc003dks.1_Missense_Mutation_p.R457H	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		GGAATCTGGACGCTGCTCAGC	0.388													41	74	---	---	---	---	capture	Missense_Mutation	SNP	58739528	58739528	C3orf67	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2221	82
PPP4R2	151987	broad.mit.edu	37	3	73114106	73114106	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:73114106C>T	uc003dph.1	+	8	812	c.742C>T	c.(742-744)CTC>TTC	p.L248F	PPP4R2_uc003dpi.1_Missense_Mutation_p.L191F	NM_174907	NP_777567	Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	248					mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		GGTAAAAAGACTCAGGTTTGA	0.433													45	73	---	---	---	---	capture	Missense_Mutation	SNP	73114106	73114106	PPP4R2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	12305	82
ABCC5	10057	broad.mit.edu	37	3	183667646	183667646	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183667646C>T	uc003fmg.2	-	22	3287	c.3122G>A	c.(3121-3123)CGT>CAT	p.R1041H	ABCC5_uc011bqt.1_Missense_Mutation_p.R569H|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	1041	ABC transmembrane type-1 2.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATTGTCCAGACGCTTCAGCTC	0.562													28	80	---	---	---	---	capture	Missense_Mutation	SNP	183667646	183667646	ABCC5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	56	82
HTR3E	285242	broad.mit.edu	37	3	183824315	183824315	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183824315G>T	uc010hxq.2	+	9	1671	c.1205G>T	c.(1204-1206)GGG>GTG	p.G402V	HTR3E_uc003fml.3_Missense_Mutation_p.G387V|HTR3E_uc003fmm.2_Missense_Mutation_p.G417V|HTR3E_uc010hxr.2_Missense_Mutation_p.G428V|HTR3E_uc003fmn.2_Missense_Mutation_p.G402V	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	402	Cytoplasmic (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GAGCTGACAGGGGGCTCAGAA	0.612													25	42	---	---	---	---	capture	Missense_Mutation	SNP	183824315	183824315	HTR3E	3	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	7373	82
RGS12	6002	broad.mit.edu	37	4	3427237	3427237	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3427237T>G	uc003ggw.2	+	14	4185	c.3281T>G	c.(3280-3282)CTG>CGG	p.L1094R	RGS12_uc003ggv.2_Missense_Mutation_p.L1094R|RGS12_uc003ggy.1_Missense_Mutation_p.L492R|RGS12_uc003ggz.2_Missense_Mutation_p.L446R|RGS12_uc010icu.1_Missense_Mutation_p.L293R|RGS12_uc011bvs.1_Missense_Mutation_p.L436R|RGS12_uc003gha.2_Missense_Mutation_p.L436R|RGS12_uc010icv.2_Missense_Mutation_p.L293R|RGS12_uc003ghb.2_Missense_Mutation_p.L293R	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	1094	RBD 2.					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATATCGAGTCTGGACGGACAG	0.572													5	345	---	---	---	---	capture	Missense_Mutation	SNP	3427237	3427237	RGS12	4	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	13187	82
CLNK	116449	broad.mit.edu	37	4	10567771	10567771	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10567771T>C	uc003gmo.3	-	6	291	c.154A>G	c.(154-156)AGA>GGA	p.R52G	CLNK_uc003gmp.2_Missense_Mutation_p.R10G	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer	52					immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						GCAAAGTTTCTTTCCTAAGCA	0.458													126	186	---	---	---	---	capture	Missense_Mutation	SNP	10567771	10567771	CLNK	4	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	3512	82
CORIN	10699	broad.mit.edu	37	4	47625643	47625643	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47625643C>A	uc003gxm.2	-	19	2578	c.2485G>T	c.(2485-2487)GGC>TGC	p.G829C	CORIN_uc011bzf.1_Missense_Mutation_p.G690C|CORIN_uc011bzg.1_Missense_Mutation_p.G762C	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	829	Extracellular (Potential).|Peptidase S1.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity	p.G829G(1)		ovary(1)|central_nervous_system(1)	2						AGGACACAGCCACAGATATGT	0.527													5	80	---	---	---	---	capture	Missense_Mutation	SNP	47625643	47625643	CORIN	4	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	3717	82
PDHA2	5161	broad.mit.edu	37	4	96761557	96761557	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96761557C>T	uc003htr.3	+	1	319	c.256C>T	c.(256-258)CGC>TGC	p.R86C		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	86					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	GAAATTCATTCGCGGTTTCTG	0.517													4	178	---	---	---	---	capture	Missense_Mutation	SNP	96761557	96761557	PDHA2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11568	82
ENPEP	2028	broad.mit.edu	37	4	111464226	111464226	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111464226G>T	uc003iab.3	+	13	2342	c.2000G>T	c.(1999-2001)AGA>ATA	p.R667I		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	667	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	GCCTTGGCAAGGTGCGTTTTA	0.328													96	161	---	---	---	---	capture	Missense_Mutation	SNP	111464226	111464226	ENPEP	4	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	5083	82
BRIX1	55299	broad.mit.edu	37	5	34924991	34924991	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:34924991C>G	uc003jja.2	+	9	727	c.703C>G	c.(703-705)CGT>GGT	p.R235G		NM_018321	NP_060791	Q8TDN6	BRX1_HUMAN	BRIX	235	Brix.				ribosome biogenesis|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|protein binding				0						AATAGGACCTCGTTTTGTCTT	0.358													41	70	---	---	---	---	capture	Missense_Mutation	SNP	34924991	34924991	BRIX1	5	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	1503	82
CHSY3	337876	broad.mit.edu	37	5	129244015	129244015	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:129244015C>T	uc003kvd.2	+	2	1048	c.1048C>T	c.(1048-1050)CGC>TGC	p.R350C		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	350	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		AAGATGCGTTCGCCGTTTTGG	0.438													38	52	---	---	---	---	capture	Missense_Mutation	SNP	129244015	129244015	CHSY3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3378	82
CSNK1A1	1452	broad.mit.edu	37	5	148929730	148929730	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148929730C>T	uc003lqx.1	-	2	618	c.138G>A	c.(136-138)AAG>AAA	p.K46K	CSNK1A1_uc011dcc.1_5'UTR|CSNK1A1_uc003lqv.1_5'UTR|CSNK1A1_uc003lqw.1_Silent_p.K46K|CSNK1A1_uc003lqy.1_Silent_p.K46K|CSNK1A1_uc010jha.1_Silent_p.K46K	NM_001892	NP_001883	P48729	KC1A_HUMAN	casein kinase 1, alpha 1 isoform 2	46	Protein kinase.	ATP (By similarity).			cell division|mitosis|Wnt receptor signaling pathway	centrosome|condensed chromosome kinetochore|cytosol|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GAGATTCTAGCTTCACTGCCA	0.502													53	120	---	---	---	---	capture	Silent	SNP	148929730	148929730	CSNK1A1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	3915	82
DSP	1832	broad.mit.edu	37	6	7569463	7569463	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7569463C>T	uc003mxp.1	+	12	1743	c.1464C>T	c.(1462-1464)AAC>AAT	p.N488N	DSP_uc003mxq.1_Silent_p.N488N	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	488	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGGACAACAACGAGCGCAGCA	0.527													41	97	---	---	---	---	capture	Silent	SNP	7569463	7569463	DSP	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4736	82
SRPK1	6732	broad.mit.edu	37	6	35855829	35855829	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35855829G>C	uc003olj.2	-	5	485	c.362C>G	c.(361-363)GCA>GGA	p.A121G	SRPK1_uc011dtg.1_Missense_Mutation_p.A105G|SRPK1_uc003olh.2_Missense_Mutation_p.A14G|SRPK1_uc003oli.2_Missense_Mutation_p.A14G	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1	121	Protein kinase.				cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TTCATCTAGTGCTGTTTCAGT	0.338													12	21	---	---	---	---	capture	Missense_Mutation	SNP	35855829	35855829	SRPK1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	15051	82
CDKN1A	1026	broad.mit.edu	37	6	36652137	36652137	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36652137G>A	uc003omm.3	+	2	381	c.259G>A	c.(259-261)GAT>AAT	p.D87N	CDKN1A_uc011dtq.1_Missense_Mutation_p.D121N|CDKN1A_uc003oml.2_Missense_Mutation_p.D87N|CDKN1A_uc003omn.2_Missense_Mutation_p.D87N	NM_000389	NP_000380	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A	87					cell cycle arrest|cellular response to extracellular stimulus|cellular response to ionizing radiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of fibroblast proliferation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|S phase of mitotic cell cycle|stress-induced premature senescence	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleoplasm|PCNA-p21 complex	cyclin-dependent protein kinase activating kinase activity|cyclin-dependent protein kinase inhibitor activity|metal ion binding			ovary(1)|breast(1)	2						GCGAGGCCGGGATGAGTTGGG	0.657									Multiple_Endocrine_Neoplasia_type_1				16	26	---	---	---	---	capture	Missense_Mutation	SNP	36652137	36652137	CDKN1A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3128	82
PKHD1	5314	broad.mit.edu	37	6	51910848	51910848	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51910848G>T	uc003pah.1	-	24	2822	c.2546C>A	c.(2545-2547)ACC>AAC	p.T849N	PKHD1_uc003pai.2_Missense_Mutation_p.T849N	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	849	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CCAGGACAAGGTCCACACGTG	0.463													11	96	---	---	---	---	capture	Missense_Mutation	SNP	51910848	51910848	PKHD1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11874	82
HCRTR2	3062	broad.mit.edu	37	6	55113582	55113582	+	Silent	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55113582A>G	uc003pcl.2	+	2	684	c.369A>G	c.(367-369)GGA>GGG	p.G123G	HCRTR2_uc010jzv.2_RNA|HCRTR2_uc010jzw.1_Silent_p.G58G	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	123	Extracellular (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GGTTTTTTGGACAGTCCCTTT	0.428													17	427	---	---	---	---	capture	Silent	SNP	55113582	55113582	HCRTR2	6	A	G	G	G	1	0	0	0	0	0	0	0	1	119	10	3	3	6929	82
SYNE1	23345	broad.mit.edu	37	6	152652051	152652051	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152652051T>C	uc010kiw.2	-	78	14371	c.13769A>G	c.(13768-13770)AAC>AGC	p.N4590S	SYNE1_uc003qot.3_Missense_Mutation_p.N4519S|SYNE1_uc003qou.3_Missense_Mutation_p.N4590S|SYNE1_uc010kiz.2_Missense_Mutation_p.N345S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4590	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATTCATTAGGTTGATTTCAGG	0.353										HNSCC(10;0.0054)			128	224	---	---	---	---	capture	Missense_Mutation	SNP	152652051	152652051	SYNE1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	15333	82
ADCYAP1R1	117	broad.mit.edu	37	7	31126052	31126052	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31126052T>A	uc003tca.1	+	10	947	c.724T>A	c.(724-726)TTC>ATC	p.F242I	ADCYAP1R1_uc003tcb.1_Missense_Mutation_p.F221I|ADCYAP1R1_uc003tcc.1_Missense_Mutation_p.F242I|ADCYAP1R1_uc003tcd.1_Missense_Mutation_p.F242I|ADCYAP1R1_uc003tce.1_Missense_Mutation_p.F242I|ADCYAP1R1_uc003tcf.1_5'Flank	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1	242	Helical; Name=3; (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						GTCCAACTACTTCTGGCTGTT	0.542													7	126	---	---	---	---	capture	Missense_Mutation	SNP	31126052	31126052	ADCYAP1R1	7	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	303	82
HECW1	23072	broad.mit.edu	37	7	43485123	43485123	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43485123G>A	uc003tid.1	+	11	2957	c.2352G>A	c.(2350-2352)CCG>CCA	p.P784P	HECW1_uc011kbi.1_Silent_p.P784P	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	784					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	p.L784I(1)		ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						AAAGAAGCCCGGAAGGTCTGG	0.612													5	30	---	---	---	---	capture	Silent	SNP	43485123	43485123	HECW1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6968	82
GNAT3	346562	broad.mit.edu	37	7	80091827	80091827	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80091827G>A	uc011kgu.1	-	6	711	c.711C>T	c.(709-711)GAC>GAT	p.D237D	CD36_uc003uhc.2_Intron	NM_001102386	NP_001095856	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha	237					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|rhodopsin mediated phototransduction|sensory perception of sweet taste|sensory perception of umami taste	cytoplasm|heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						CCACTTCTTCGTCTTCCACGA	0.408													62	186	---	---	---	---	capture	Silent	SNP	80091827	80091827	GNAT3	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6449	82
SEMA3C	10512	broad.mit.edu	37	7	80378254	80378254	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80378254A>G	uc003uhj.2	-	17	2364	c.1802T>C	c.(1801-1803)ATC>ACC	p.I601T	SEMA3C_uc011kgw.1_Missense_Mutation_p.I619T	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	601	Ig-like C2-type.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						CAGCCACTTGATAGATGCCTG	0.453													46	115	---	---	---	---	capture	Missense_Mutation	SNP	80378254	80378254	SEMA3C	7	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	13919	82
CACNA2D1	781	broad.mit.edu	37	7	81635118	81635118	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81635118G>C	uc003uhr.1	-	17	1734	c.1478C>G	c.(1477-1479)TCT>TGT	p.S493C		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	493	Extracellular (Potential).|Cache.					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	ATCTTCCAAAGACACATCTAC	0.328													45	108	---	---	---	---	capture	Missense_Mutation	SNP	81635118	81635118	CACNA2D1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	2524	82
KEL	3792	broad.mit.edu	37	7	142658027	142658027	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142658027G>A	uc003wcb.2	-	4	598	c.388C>T	c.(388-390)CGG>TGG	p.R130W		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	130	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					AGTATTCTCCGAAGTCGGTTT	0.502													34	400	---	---	---	---	capture	Missense_Mutation	SNP	142658027	142658027	KEL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	8064	82
ARHGEF10	9639	broad.mit.edu	37	8	1871955	1871955	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1871955G>A	uc003wpr.2	+	21	2581	c.2403G>A	c.(2401-2403)ACG>ACA	p.T801T	ARHGEF10_uc003wpq.1_Silent_p.T825T|ARHGEF10_uc003wps.2_Silent_p.T763T|ARHGEF10_uc003wpv.2_Silent_p.T534T|ARHGEF10_uc010lre.2_Silent_p.T481T	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	826					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GGCGACCGACGTTCTTTACAG	0.488													6	151	---	---	---	---	capture	Silent	SNP	1871955	1871955	ARHGEF10	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	887	82
WRN	7486	broad.mit.edu	37	8	30977768	30977768	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30977768G>C	uc003xio.3	+	21	3246	c.2458G>C	c.(2458-2460)GCT>CCT	p.A820P	WRN_uc010lvk.2_Missense_Mutation_p.A287P	NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	820	Helicase C-terminal.				base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GTGTGTCATAGCTACCATAGC	0.353			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				140	231	---	---	---	---	capture	Missense_Mutation	SNP	30977768	30977768	WRN	8	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	17283	82
SDC2	6383	broad.mit.edu	37	8	97614730	97614730	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:97614730C>G	uc003yhv.1	+	3	898	c.280C>G	c.(280-282)CAG>GAG	p.Q94E	SDC2_uc011lgu.1_Missense_Mutation_p.Q65E	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	94	Extracellular (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)	GCTGAATATACAGAACAAGAT	0.423													50	107	---	---	---	---	capture	Missense_Mutation	SNP	97614730	97614730	SDC2	8	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	13845	82
RGS22	26166	broad.mit.edu	37	8	101059740	101059740	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101059740G>A	uc003yjb.1	-	11	1969	c.1774C>T	c.(1774-1776)CGG>TGG	p.R592W	RGS22_uc003yja.1_Missense_Mutation_p.R411W|RGS22_uc003yjc.1_Missense_Mutation_p.R580W|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	592					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AAAAGCTCCCGCTTCCAAGGC	0.383													68	94	---	---	---	---	capture	Missense_Mutation	SNP	101059740	101059740	RGS22	8	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	13197	82
FAM83A	84985	broad.mit.edu	37	8	124206323	124206323	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124206323C>T	uc003ypv.2	+	4	2722	c.708C>T	c.(706-708)TTC>TTT	p.F236F	FAM83A_uc003ypw.2_Silent_p.F236F|FAM83A_uc003ypy.2_Silent_p.F180F|FAM83A_uc003ypx.2_Silent_p.F236F|FAM83A_uc003ypz.2_Silent_p.F236F	NM_032899	NP_116288	Q86UY5	FA83A_HUMAN	hypothetical protein LOC84985 isoform a	236										ovary(3)|skin(1)	4	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GCAGGAAATTCGCTGGCCAAA	0.473													44	60	---	---	---	---	capture	Silent	SNP	124206323	124206323	FAM83A	8	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	5579	82
ZNF322B	387328	broad.mit.edu	37	9	99961445	99961445	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99961445G>A	uc004axd.1	-	1	466	c.349C>T	c.(349-351)CAT>TAT	p.H117Y	uc004axb.2_5'Flank|ZNF322B_uc004axc.1_5'Flank|uc010msl.1_Intron	NM_199005	NP_945356			zinc finger protein 322B												0		Acute lymphoblastic leukemia(62;0.158)				GTTCTCTGATGTCCTGAAAGC	0.408													9	581	---	---	---	---	capture	Missense_Mutation	SNP	99961445	99961445	ZNF322B	9	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	17722	82
OR13C8	138802	broad.mit.edu	37	9	107332231	107332231	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107332231G>A	uc011lvo.1	+	1	783	c.783G>A	c.(781-783)AAG>AAA	p.K261K		NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGTACGCAAAGCCTGAGTCTA	0.453													14	162	---	---	---	---	capture	Silent	SNP	107332231	107332231	OR13C8	9	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	10842	82
PIR	8544	broad.mit.edu	37	X	15509315	15509315	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15509315C>T	uc004cwu.2	-	2	304	c.66G>A	c.(64-66)GCG>GCA	p.A22A	PIR_uc004cwv.2_Silent_p.A22A|BMX_uc004cww.2_Intron	NM_003662	NP_003653	O00625	PIR_HUMAN	pirin	22					transcription from RNA polymerase II promoter	cytoplasm|nucleus	metal ion binding|protein binding|quercetin 2,3-dioxygenase activity|transcription cofactor activity			ovary(1)	1	Hepatocellular(33;0.183)					TCCGGACCCTCGCTCCAACCC	0.522													136	241	---	---	---	---	capture	Silent	SNP	15509315	15509315	PIR	23	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11847	82
KLHL34	257240	broad.mit.edu	37	X	21675201	21675201	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21675201C>T	uc004czz.1	-	1	1248	c.706G>A	c.(706-708)GTG>ATG	p.V236M		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	236	BACK.									ovary(1)	1						CCCGAGTACACGCGCCGCAGT	0.667													13	21	---	---	---	---	capture	Missense_Mutation	SNP	21675201	21675201	KLHL34	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8307	82
FAM47B	170062	broad.mit.edu	37	X	34962438	34962438	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34962438A>T	uc004ddi.1	+	1	1508	c.1490A>T	c.(1489-1491)AAG>ATG	p.K497M		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	497										ovary(3)|breast(1)	4						CAAGACCAAAAGATTAAGAAG	0.468													72	117	---	---	---	---	capture	Missense_Mutation	SNP	34962438	34962438	FAM47B	23	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	5518	82
CXorf27	25763	broad.mit.edu	37	X	37850145	37850145	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37850145A>T	uc004ddt.3	+	1	76	c.53A>T	c.(52-54)CAA>CTA	p.Q18L		NM_012274	NP_036406	O75409	HYPM_HUMAN	Huntingtin interacting protein M	18							DNA binding			central_nervous_system(1)	1						AACCAGACTCAAGACCCTTCT	0.458													8	53	---	---	---	---	capture	Missense_Mutation	SNP	37850145	37850145	CXorf27	23	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	4065	82
BCOR	54880	broad.mit.edu	37	X	39921626	39921626	+	Silent	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39921626T>C	uc004den.3	-	10	4486	c.4194A>G	c.(4192-4194)AGA>AGG	p.R1398R	BCOR_uc004dep.3_Silent_p.R1364R|BCOR_uc004deo.3_Silent_p.R1346R|BCOR_uc010nhb.2_Silent_p.R106R|BCOR_uc004dem.3_Silent_p.R1364R	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1398					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						CCGGCCGCTTTCTGAATCTCC	0.587													3	11	---	---	---	---	capture	Silent	SNP	39921626	39921626	BCOR	23	T	C	C	C	1	0	0	0	0	0	0	0	1	803	62	3	3	1375	82
DGKK	139189	broad.mit.edu	37	X	50134485	50134485	+	Silent	SNP	A	C	C			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50134485A>C	uc010njr.1	-	11	1854	c.1794T>G	c.(1792-1794)CCT>CCG	p.P598P		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	598	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					GGATGTCCAGAGGTGACTTGC	0.537													116	209	---	---	---	---	capture	Silent	SNP	50134485	50134485	DGKK	23	A	C	C	C	1	0	0	0	0	0	0	0	1	132	11	4	4	4430	82
NAP1L2	4674	broad.mit.edu	37	X	72433530	72433530	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:72433530T>A	uc004ebi.2	-	1	1155	c.799A>T	c.(799-801)AAG>TAG	p.K267*	NAP1L2_uc011mqj.1_Nonsense_Mutation_p.K125*	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	267					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					GTCAGGAGCTTCAGAATAGGC	0.368													43	102	---	---	---	---	capture	Nonsense_Mutation	SNP	72433530	72433530	NAP1L2	23	T	A	A	A	1	0	0	0	0	0	1	0	0	806	62	5	4	10065	82
PCDH11X	27328	broad.mit.edu	37	X	91132696	91132696	+	Missense_Mutation	SNP	C	T	T	rs62621113		TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91132696C>T	uc004efk.1	+	2	2302	c.1457C>T	c.(1456-1458)ACG>ATG	p.T486M	PCDH11X_uc004efl.1_Missense_Mutation_p.T486M|PCDH11X_uc004efo.1_Missense_Mutation_p.T486M|PCDH11X_uc010nmv.1_Missense_Mutation_p.T486M|PCDH11X_uc004efm.1_Missense_Mutation_p.T486M|PCDH11X_uc004efn.1_Missense_Mutation_p.T486M|PCDH11X_uc004efh.1_Missense_Mutation_p.T486M|PCDH11X_uc004efj.1_Missense_Mutation_p.T486M	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	486	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						ATCCAGTTGACGAAAGTAAGT	0.438													31	150	---	---	---	---	capture	Missense_Mutation	SNP	91132696	91132696	PCDH11X	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11411	82
FAM70A	55026	broad.mit.edu	37	X	119410875	119410875	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119410875G>A	uc004eso.3	-	8	839	c.612C>T	c.(610-612)TAC>TAT	p.Y204Y	FAM70A_uc004esp.3_Silent_p.Y180Y|FAM70A_uc010nqo.2_Intron	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1	204						integral to membrane				lung(1)|breast(1)	2						CGATGTATTCGTAGTACCCAC	0.582													76	175	---	---	---	---	capture	Silent	SNP	119410875	119410875	FAM70A	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5553	82
EVI5	7813	broad.mit.edu	37	1	93159365	93159366	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93159365_93159366insT	uc001dox.2	-	9	1232_1233	c.1222_1223insA	c.(1222-1224)ATGfs	p.M408fs	EVI5_uc010otf.1_Frame_Shift_Ins_p.M408fs|EVI5_uc001doy.1_RNA	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	408	Dimerization.|Targeting to the centrosomes.|Potential.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TTACTTTTTCATTTTTTTTGAA	0.317													17	242	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	93159365	93159366	EVI5	1	-	T	T	T	1	0	1	1	0	0	0	0	0	104	8	5	5	5244	82
KCNN3	3782	broad.mit.edu	37	1	154680586	154680588	+	In_Frame_Del	DEL	GCT	-	-			TCGA-06-2558-01	TCGA-06-2558-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154680586_154680588delGCT	uc001ffp.2	-	8	2374_2376	c.2060_2062delAGC	c.(2059-2064)CAGCTC>CTC	p.Q687del	KCNN3_uc001ffo.2_In_Frame_Del_p.Q382del	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	692	Poly-Gln.					integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			GCAGACAGGAGCTGCTGCTGCTG	0.640													7	218	---	---	---	---	capture_indel	In_Frame_Del	DEL	154680586	154680588	KCNN3	1	GCT	-	-	-	1	0	1	0	1	0	0	0	0	442	34	5	5	8002	82
