Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MTHFR	4524	broad.mit.edu	37	1	11861244	11861244	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11861244A>G	uc001atc.1	-	3	633	c.449T>C	c.(448-450)CTG>CCG	p.L150P	MTHFR_uc001atb.1_Missense_Mutation_p.L173P	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	150					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	GATGTTCTTCAGGCCCAGCTG	0.602													4	253	---	---	---	---	capture	Missense_Mutation	SNP	11861244	11861244	MTHFR	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9841	83
IFI6	2537	broad.mit.edu	37	1	27992966	27992966	+	Missense_Mutation	SNP	C	T	T	rs74937564		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27992966C>T	uc001boo.1	-	5	442	c.319G>A	c.(319-321)GTC>ATC	p.V107I	IFI6_uc001bon.1_Missense_Mutation_p.V115I|IFI6_uc001bop.1_Missense_Mutation_p.V111I	NM_002038	NP_002029	P09912	IFI6_HUMAN	interferon, alpha-inducible protein 6 isoform a	107					anti-apoptosis|negative regulation of caspase activity|negative regulation of mitochondrial depolarization|release of cytochrome c from mitochondria|type I interferon-mediated signaling pathway	integral to membrane|mitochondrion	protein binding			ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;7.75e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TTACCTATGACGACGCTGCTG	0.537													8	74	---	---	---	---	capture	Missense_Mutation	SNP	27992966	27992966	IFI6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7444	83
LRRC40	55631	broad.mit.edu	37	1	70641517	70641517	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70641517T>G	uc001der.1	-	7	1005	c.953A>C	c.(952-954)GAC>GCC	p.D318A		NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	318	LRR 11.									ovary(1)	1						GTTGCTTAGGTCAAGCCTTTC	0.289													35	53	---	---	---	---	capture	Missense_Mutation	SNP	70641517	70641517	LRRC40	1	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	8913	83
NEXN	91624	broad.mit.edu	37	1	78392171	78392171	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78392171A>T	uc001dic.3	+	7	859	c.562A>T	c.(562-564)AAT>TAT	p.N188Y	NEXN_uc001dia.3_Missense_Mutation_p.N174Y|NEXN_uc009wcb.1_Missense_Mutation_p.N110Y|NEXN_uc001dib.3_Missense_Mutation_p.N124Y|NEXN_uc001did.1_Missense_Mutation_p.N98Y|NEXN_uc001dif.1_Missense_Mutation_p.N80Y	NM_144573	NP_653174	Q0ZGT2	NEXN_HUMAN	nexilin (F actin binding protein)	188	Glu-rich.				regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)		AATGAAAAAGAATTTTGAGGA	0.313													16	95	---	---	---	---	capture	Missense_Mutation	SNP	78392171	78392171	NEXN	1	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	10262	83
WDR63	126820	broad.mit.edu	37	1	85560129	85560129	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85560129C>T	uc001dkt.2	+	10	1255	c.1064C>T	c.(1063-1065)TCG>TTG	p.S355L	WDR63_uc009wcl.2_Missense_Mutation_p.S316L	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	355										upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		ATAGCTGTGTCGGTAGCCGTG	0.418													17	511	---	---	---	---	capture	Missense_Mutation	SNP	85560129	85560129	WDR63	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17195	83
HRNR	388697	broad.mit.edu	37	1	152192836	152192836	+	Silent	SNP	A	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152192836A>G	uc001ezt.1	-	3	1345	c.1269T>C	c.(1267-1269)TCT>TCC	p.S423S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	423	4.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGGCCTGGAGACTGGCCAG	0.617													27	53	---	---	---	---	capture	Silent	SNP	152192836	152192836	HRNR	1	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	7284	83
SPTA1	6708	broad.mit.edu	37	1	158654966	158654966	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158654966C>T	uc001fst.1	-	2	395	c.196G>A	c.(196-198)GGG>AGG	p.G66R		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	66	Spectrin 2.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ATCCACTtccccagatcatct	0.299													56	60	---	---	---	---	capture	Missense_Mutation	SNP	158654966	158654966	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15008	83
ANKRD30A	91074	broad.mit.edu	37	10	37506710	37506710	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:37506710G>A	uc001iza.1	+	33	3102	c.3003G>A	c.(3001-3003)GAG>GAA	p.E1001E		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1057	Potential.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GAATCGAAGAGCAGCATAGGA	0.328													26	32	---	---	---	---	capture	Silent	SNP	37506710	37506710	ANKRD30A	10	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	654	83
ADAMTS14	140766	broad.mit.edu	37	10	72495039	72495039	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:72495039C>T	uc001jrh.2	+	9	1467	c.1467C>T	c.(1465-1467)GGC>GGT	p.G489G	ADAMTS14_uc001jrg.2_Silent_p.G492G|ADAMTS14_uc001jri.1_Silent_p.G12G	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	489	Disintegrin.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						TTGGCAGTGGCTACCAGACCT	0.592													24	6	---	---	---	---	capture	Silent	SNP	72495039	72495039	ADAMTS14	10	C	T	T	T	1	0	0	0	0	0	0	0	1	353	28	2	2	259	83
PTEN	5728	broad.mit.edu	37	10	89692993	89692993	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692993G>T	uc001kfb.2	+	6	1508	c.477G>T	c.(475-477)AGG>AGT	p.R159S		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	159	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R159S(4)|p.R55fs*1(4)|p.R159K(4)|p.?(2)|p.Y27fs*1(2)|p.R159fs*8(2)|p.Y27_N212>Y(2)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGGAAGTAAGGACCAGAGACA	0.358		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			61	33	---	---	---	---	capture	Missense_Mutation	SNP	89692993	89692993	PTEN	10	G	T	T	T	1	0	0	0	0	1	0	0	0	529	41	4	4	12633	83
PTEN	5728	broad.mit.edu	37	10	89720852	89720852	+	Nonsense_Mutation	SNP	C	T	T	rs121909231		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720852C>T	uc001kfb.2	+	9	2034	c.1003C>T	c.(1003-1005)CGA>TGA	p.R335*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	335	C2 tensin-type.			KANKDKANR->AAGADAANA: Reduces growth suppression activity and promotes anchorage-independent growth. Reduces binding to phospholipid membranes in vitro; phosphatase activity towards PtdIns(3,4,5)P3 is not affected.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R335*(21)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.R335fs*8(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.R335fs*4(1)|p.R335fs*7(1)|p.W274_F341del(1)|p.R335R(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAAAGCCAACCGATACTTTTC	0.333		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			7	115	---	---	---	---	capture	Nonsense_Mutation	SNP	89720852	89720852	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	12633	83
COL17A1	1308	broad.mit.edu	37	10	105798253	105798253	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105798253G>A	uc001kxr.2	-	45	3150	c.2981C>T	c.(2980-2982)CCG>CTG	p.P994L		NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	994	Extracellular (Potential).|Triple-helical region.				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGGCCCTGGCGGGCCTGACAC	0.597													103	22	---	---	---	---	capture	Missense_Mutation	SNP	105798253	105798253	COL17A1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3639	83
OR10S1	219873	broad.mit.edu	37	11	123847486	123847486	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123847486G>A	uc001pzm.1	-	1	913	c.913C>T	c.(913-915)CGG>TGG	p.R305W		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCCTTGTTCCGCAAAGTGTAA	0.527													39	131	---	---	---	---	capture	Missense_Mutation	SNP	123847486	123847486	OR10S1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	10822	83
AGAP2	116986	broad.mit.edu	37	12	58125706	58125706	+	Silent	SNP	C	T	T	rs145122115		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58125706C>T	uc001spq.2	-	8	1839	c.1839G>A	c.(1837-1839)CCG>CCA	p.P613P	AGAP2_uc001spp.2_Silent_p.P613P|AGAP2_uc001spr.2_Silent_p.P277P	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	613					axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						TCGGTGAGGACGGGAGGGAAG	0.622													8	346	---	---	---	---	capture	Silent	SNP	58125706	58125706	AGAP2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	368	83
GPR133	283383	broad.mit.edu	37	12	131487809	131487809	+	Missense_Mutation	SNP	C	T	T	rs142314859		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:131487809C>T	uc001uit.3	+	10	1665	c.1106C>T	c.(1105-1107)ACG>ATG	p.T369M	GPR133_uc010tbm.1_Missense_Mutation_p.T401M	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	369	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CACGGCAGCACGCCCCAGGTC	0.622													32	92	---	---	---	---	capture	Missense_Mutation	SNP	131487809	131487809	GPR133	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6577	83
N6AMT2	221143	broad.mit.edu	37	13	21331636	21331636	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:21331636G>A	uc001uno.1	-	2	183	c.102C>T	c.(100-102)GGC>GGT	p.G34G	N6AMT2_uc009zzr.1_Silent_p.G34G|N6AMT2_uc001unp.2_RNA	NM_174928	NP_777588	Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2	34							methyltransferase activity|nucleic acid binding				0		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		TATCATCCTCGCCTGGCTCAA	0.418													45	146	---	---	---	---	capture	Silent	SNP	21331636	21331636	N6AMT2	13	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10025	83
CHD8	57680	broad.mit.edu	37	14	21876530	21876530	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21876530C>G	uc001was.1	-	13	1928	c.1834G>C	c.(1834-1836)GGC>CGC	p.G612R	CHD8_uc001war.1_Missense_Mutation_p.G508R|CHD8_uc001wav.1_Missense_Mutation_p.G54R	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	891	Helicase ATP-binding.				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GCCAGACTGCCATGGTACACA	0.438													41	121	---	---	---	---	capture	Missense_Mutation	SNP	21876530	21876530	CHD8	14	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	3297	83
DHRS2	10202	broad.mit.edu	37	14	24109023	24109023	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24109023C>T	uc001wkt.3	+	4	786	c.339C>T	c.(337-339)GGC>GGT	p.G113G	DHRS2_uc010aku.1_Silent_p.G113G|DHRS2_uc001wku.3_Silent_p.G113G|DHRS2_uc010akv.2_RNA|DHRS2_uc001wkv.3_Silent_p.G113G	NM_182908	NP_878912	Q13268	DHRS2_HUMAN	dehydrogenase/reductase member 2 isoform 1	91					C21-steroid hormone metabolic process|cellular response to oxidative stress|myeloid dendritic cell differentiation|negative regulation of apoptosis|negative regulation of cell proliferation|response to toxin	mitochondrion|nuclear envelope	binding|carbonyl reductase (NADPH) activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00659)		ACTGTGGGGGCGTCGACTTCC	0.637													36	52	---	---	---	---	capture	Silent	SNP	24109023	24109023	DHRS2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4448	83
LRRC16B	90668	broad.mit.edu	37	14	24524519	24524519	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24524519G>A	uc001wlj.2	+	8	762	c.605G>A	c.(604-606)CGA>CAA	p.R202Q		NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	202										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		TTGGAGAGCCGGTAAGCAGAT	0.552													17	114	---	---	---	---	capture	Missense_Mutation	SNP	24524519	24524519	LRRC16B	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8888	83
C15orf2	23742	broad.mit.edu	37	15	24921169	24921169	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24921169G>A	uc001ywo.2	+	1	629	c.155G>A	c.(154-156)CGC>CAC	p.R52H		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	52					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		GGCCTGTTCCGCCGGAACGCC	0.756													10	18	---	---	---	---	capture	Missense_Mutation	SNP	24921169	24921169	C15orf2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1770	83
SOLH	6650	broad.mit.edu	37	16	603459	603459	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:603459C>T	uc002chi.2	+	14	3567	c.3204C>T	c.(3202-3204)ACC>ACT	p.T1068T	SOLH_uc002chj.2_Silent_p.T128T	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	1068					proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				CCAAGGGGACCCACAGCCCCC	0.687													40	40	---	---	---	---	capture	Silent	SNP	603459	603459	SOLH	16	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14817	83
WDR90	197335	broad.mit.edu	37	16	715745	715745	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:715745C>T	uc002cii.1	+	35	4432	c.4378C>T	c.(4378-4380)CGG>TGG	p.R1460W	WDR90_uc002cij.1_Intron|WDR90_uc002cil.1_RNA|WDR90_uc002cin.1_Missense_Mutation_p.R75W|WDR90_uc010uul.1_Missense_Mutation_p.R59W|WDR90_uc002cio.1_Missense_Mutation_p.R59W|WDR90_uc010bqx.1_Missense_Mutation_p.R59W|RHOT2_uc010uum.1_5'Flank|RHOT2_uc002cip.2_5'Flank|RHOT2_uc002ciq.2_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	1460	WD 17.									ovary(1)	1		Hepatocellular(780;0.0218)				TGGGAGTGTGCGGGTGTGGGC	0.672													3	55	---	---	---	---	capture	Missense_Mutation	SNP	715745	715745	WDR90	16	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17218	83
OTOA	146183	broad.mit.edu	37	16	21698817	21698817	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21698817C>T	uc002djh.2	+	7	484	c.483C>T	c.(481-483)CTC>CTT	p.L161L	uc002diq.3_Intron|OTOA_uc010vbj.1_Silent_p.L82L	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	161					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		GCCTGTTTCTCATCACACTGG	0.542													83	124	---	---	---	---	capture	Silent	SNP	21698817	21698817	OTOA	16	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	11206	83
SCNN1G	6340	broad.mit.edu	37	16	23226433	23226433	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23226433C>A	uc002dlm.1	+	13	1732	c.1593C>A	c.(1591-1593)TTC>TTA	p.F531L		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	531	Helical; (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	TGTCCAACTTCGGTGGCCAGC	0.547													40	25	---	---	---	---	capture	Missense_Mutation	SNP	23226433	23226433	SCNN1G	16	C	A	A	A	1	0	0	0	0	1	0	0	0	402	31	4	4	13823	83
ITGAD	3681	broad.mit.edu	37	16	31409190	31409190	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31409190G>A	uc002ebv.1	+	5	436	c.387G>A	c.(385-387)TCG>TCA	p.S129S	ITGAD_uc010vfl.1_Silent_p.S129S|ITGAD_uc010cap.1_Silent_p.S129S|ITGAD_uc002ebw.1_5'UTR	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	129	FG-GAP 2.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						TGCTGGGCTCGCGCTGGGAGA	0.642													15	22	---	---	---	---	capture	Silent	SNP	31409190	31409190	ITGAD	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7807	83
NLRC5	84166	broad.mit.edu	37	16	57054711	57054711	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57054711C>T	uc002ekk.1	+	3	312	c.87C>T	c.(85-87)AAC>AAT	p.N29N	NLRC5_uc010ccq.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	29					defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				AATGGCTGAACGCCAAGATGA	0.562													62	61	---	---	---	---	capture	Silent	SNP	57054711	57054711	NLRC5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10377	83
NLRC5	84166	broad.mit.edu	37	16	57088674	57088674	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57088674C>T	uc002ekk.1	+	25	3743	c.3518C>T	c.(3517-3519)ACG>ATG	p.T1173M	NLRC5_uc002ekn.2_Missense_Mutation_p.T892M|NLRC5_uc002ekl.2_Missense_Mutation_p.T978M|NLRC5_uc002ekm.2_Missense_Mutation_p.T948M|NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekp.1_Missense_Mutation_p.T89M|NLRC5_uc002ekq.1_Translation_Start_Site|NLRC5_uc002ekr.1_Missense_Mutation_p.T89M	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	1173	LRR 12.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				CTGAGCCAGACGGGACTGTCC	0.592													18	442	---	---	---	---	capture	Missense_Mutation	SNP	57088674	57088674	NLRC5	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10377	83
KCTD19	146212	broad.mit.edu	37	16	67325657	67325657	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67325657C>T	uc002esu.2	-	13	2353	c.2302G>A	c.(2302-2304)GTG>ATG	p.V768M	KCTD19_uc002est.2_Missense_Mutation_p.V540M|KCTD19_uc010vjj.1_Missense_Mutation_p.V511M	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain	768						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		CTGCCCACCACGGGGGGGTGA	0.572													26	73	---	---	---	---	capture	Missense_Mutation	SNP	67325657	67325657	KCTD19	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8028	83
PKD1L2	114780	broad.mit.edu	37	16	81187697	81187697	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81187697G>C	uc002fgh.1	-	26	4275	c.4275C>G	c.(4273-4275)CAC>CAG	p.H1425Q	PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1425	Cytoplasmic (Potential).|PLAT.				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GATCAGCCAGGTGGTGGGGCT	0.607													3	13	---	---	---	---	capture	Missense_Mutation	SNP	81187697	81187697	PKD1L2	16	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	11868	83
TP53	7157	broad.mit.edu	37	17	7578280	7578280	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578280G>A	uc002gim.2	-	6	763	c.569C>T	c.(568-570)CCT>CTT	p.P190L	TP53_uc002gig.1_Missense_Mutation_p.P190L|TP53_uc002gih.2_Missense_Mutation_p.P190L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P58L|TP53_uc010cng.1_Missense_Mutation_p.P58L|TP53_uc002gii.1_Missense_Mutation_p.P58L|TP53_uc010cnh.1_Missense_Mutation_p.P190L|TP53_uc010cni.1_Missense_Mutation_p.P190L|TP53_uc002gij.2_Missense_Mutation_p.P190L|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.P97L|TP53_uc002gio.2_Missense_Mutation_p.P58L|TP53_uc010vug.1_Missense_Mutation_p.P151L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	190	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> R (in sporadic cancers; somatic mutation).|P -> H (in a sporadic cancer; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> A (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P190L(21)|p.P190fs*57(8)|p.0?(7)|p.P190del(6)|p.P190S(6)|p.P190T(4)|p.A189_V197delAPPQHLIRV(4)|p.G187fs*16(2)|p.P190A(2)|p.P190R(2)|p.K164_P219del(1)|p.P58fs*>33(1)|p.A189_Q192>E(1)|p.P191fs*18(1)|p.P190fs*19(1)|p.D186_P191delDGLAPP(1)|p.?(1)|p.A189fs*53(1)|p.P190H(1)|p.P190P(1)|p.L188_P191del(1)|p.P97fs*57(1)|p.A189_P190>X(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGCTGAGGAGGGGCCAGACC	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			34	40	---	---	---	---	capture	Missense_Mutation	SNP	7578280	7578280	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	16264	83
TP53	7157	broad.mit.edu	37	17	7578466	7578466	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578466G>T	uc002gim.2	-	5	658	c.464C>A	c.(463-465)ACC>AAC	p.T155N	TP53_uc002gig.1_Missense_Mutation_p.T155N|TP53_uc002gih.2_Missense_Mutation_p.T155N|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.T23N|TP53_uc010cng.1_Missense_Mutation_p.T23N|TP53_uc002gii.1_Missense_Mutation_p.T23N|TP53_uc010cnh.1_Missense_Mutation_p.T155N|TP53_uc010cni.1_Missense_Mutation_p.T155N|TP53_uc002gij.2_Missense_Mutation_p.T155N|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.T62N|TP53_uc002gio.2_Missense_Mutation_p.T23N|TP53_uc010vug.1_Missense_Mutation_p.T116N	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	155	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> M (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.T155N(19)|p.T155P(14)|p.T155I(10)|p.0?(7)|p.T155A(7)|p.T155T(5)|p.P152fs*14(3)|p.G154fs*14(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.T155S(2)|p.P151_V173del23(1)|p.G154_R156delGTR(1)|p.T155fs*26(1)|p.T155fs*25(1)|p.R156_A161del(1)|p.D148_T155delDSTPPPGT(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.T155fs*15(1)|p.R156fs*25(1)|p.T155_R156delTR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCGGACGCGGGTGCCGGGCGG	0.612		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			37	51	---	---	---	---	capture	Missense_Mutation	SNP	7578466	7578466	TP53	17	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	16264	83
ODF4	146852	broad.mit.edu	37	17	8243550	8243550	+	Missense_Mutation	SNP	C	T	T	rs147153349		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8243550C>T	uc002gle.1	+	1	363	c.181C>T	c.(181-183)CGC>TGC	p.R61C		NM_153007	NP_694552	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	61					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)	1						CTTGGGCCAGCGCCAGAACTC	0.592													21	23	---	---	---	---	capture	Missense_Mutation	SNP	8243550	8243550	ODF4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10738	83
MYH13	8735	broad.mit.edu	37	17	10213133	10213133	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10213133G>A	uc002gmk.1	-	34	4761	c.4671C>T	c.(4669-4671)CAC>CAT	p.H1557H		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1557	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TGCTCTCCTCGTGTTCCAAGG	0.498													5	4	---	---	---	---	capture	Silent	SNP	10213133	10213133	MYH13	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9942	83
KRT27	342574	broad.mit.edu	37	17	38936090	38936090	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38936090C>T	uc002hvg.2	-	4	749	c.708G>A	c.(706-708)GCG>GCA	p.A236A		NM_181537	NP_853515	Q7Z3Y8	K1C27_HUMAN	keratin 27	236	Rod.|Linker 12.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.000812)				TGCCTCCAGCCGCGCACTGAA	0.433													23	40	---	---	---	---	capture	Silent	SNP	38936090	38936090	KRT27	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8384	83
SEPT4	5414	broad.mit.edu	37	17	56599396	56599396	+	Silent	SNP	C	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56599396C>A	uc002iwm.1	-	6	857	c.729G>T	c.(727-729)CTG>CTT	p.L243L	SEPT4_uc002iwk.1_Silent_p.L96L|SEPT4_uc010wnw.1_Silent_p.L96L|SEPT4_uc002iwl.1_Silent_p.L96L|SEPT4_uc002iwn.1_Silent_p.L144L|SEPT4_uc002iwo.1_Silent_p.L224L|SEPT4_uc002iwp.1_Silent_p.L224L|SEPT4_uc010wnx.1_Silent_p.L258L|SEPT4_uc010wny.1_Silent_p.L235L|SEPT4_uc010dcy.1_Silent_p.L125L	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1	243					apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCTTTCGGTTCAGGCCACTCT	0.542													15	103	---	---	---	---	capture	Silent	SNP	56599396	56599396	SEPT4	17	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	13959	83
C17orf71	55181	broad.mit.edu	37	17	57290240	57290240	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:57290240A>G	uc002ixi.2	+	3	2098	c.2056A>G	c.(2056-2058)ACC>GCC	p.T686A		NM_018149	NP_060619	Q8ND04	SMG8_HUMAN	SMG8 protein	686					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					AGAACCTCAAACCCAAGGAGA	0.453													133	138	---	---	---	---	capture	Missense_Mutation	SNP	57290240	57290240	C17orf71	17	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	1863	83
PTPRS	5802	broad.mit.edu	37	19	5221107	5221107	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5221107T>C	uc002mbv.2	-	20	3593	c.3359A>G	c.(3358-3360)AAC>AGC	p.N1120S	PTPRS_uc002mbu.1_Missense_Mutation_p.N689S|PTPRS_uc010xin.1_Missense_Mutation_p.N689S|PTPRS_uc002mbw.2_Missense_Mutation_p.N1098S|PTPRS_uc002mbx.2_Missense_Mutation_p.N693S|PTPRS_uc002mby.2_Missense_Mutation_p.N689S	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	1120	Extracellular (Potential).				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		GTTGAGCAGGTTGAAGGCAGT	0.622													47	74	---	---	---	---	capture	Missense_Mutation	SNP	5221107	5221107	PTPRS	19	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	12706	83
EMR1	2015	broad.mit.edu	37	19	6928180	6928180	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6928180G>A	uc002mfw.2	+	17	2285	c.2247G>A	c.(2245-2247)GGG>GGA	p.G749G	EMR1_uc010dvc.2_Silent_p.G684G|EMR1_uc010dvb.2_Silent_p.G697G|EMR1_uc010xji.1_Silent_p.G608G|EMR1_uc010xjj.1_Silent_p.G572G	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	749	Helical; Name=5; (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					CAGAGACAGGGTTCATCTGGA	0.498													6	268	---	---	---	---	capture	Silent	SNP	6928180	6928180	EMR1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	561	44	2	2	5059	83
ZNF333	84449	broad.mit.edu	37	19	14829286	14829286	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14829286A>G	uc002mzn.2	+	12	1281	c.1147A>G	c.(1147-1149)AGG>GGG	p.R383G	ZNF333_uc002mzk.3_Missense_Mutation_p.R274G	NM_032433	NP_115809	Q96JL9	ZN333_HUMAN	zinc finger protein 333	383	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TGACCTTATCAGGCATGAGAA	0.453													3	117	---	---	---	---	capture	Missense_Mutation	SNP	14829286	14829286	ZNF333	19	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	17730	83
OR7A17	26333	broad.mit.edu	37	19	14991924	14991924	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14991924G>A	uc010xob.1	-	1	244	c.244C>T	c.(244-246)CTC>TTC	p.L82F		NM_030901	NP_112163	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A,	82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					ATGTTAATGAGCATCTTTGGG	0.473													6	93	---	---	---	---	capture	Missense_Mutation	SNP	14991924	14991924	OR7A17	19	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	11119	83
PSG5	5673	broad.mit.edu	37	19	43679606	43679606	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43679606G>A	uc002ovu.2	-	4	856	c.725C>T	c.(724-726)CCC>CTC	p.P242L	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Missense_Mutation_p.P117L|PSG5_uc002ovx.2_Missense_Mutation_p.P242L|PSG5_uc002ovv.2_Missense_Mutation_p.P335L|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	242	Ig-like C2-type 2.				female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				GTAAATGCTGGGGAGGTCTGG	0.498													95	128	---	---	---	---	capture	Missense_Mutation	SNP	43679606	43679606	PSG5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	12553	83
ZNF845	91664	broad.mit.edu	37	19	53854397	53854397	+	Missense_Mutation	SNP	G	C	C	rs10415799	by1000genomes	TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53854397G>C	uc010ydv.1	+	4	586	c.469G>C	c.(469-471)GAA>CAA	p.E157Q	ZNF845_uc010ydw.1_Missense_Mutation_p.E157Q	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	157					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTTTCAGACCGAAGGGAAAAT	0.408													5	263	---	---	---	---	capture	Missense_Mutation	SNP	53854397	53854397	ZNF845	19	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	18067	83
LENG8	114823	broad.mit.edu	37	19	54969780	54969780	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54969780C>T	uc002qfv.1	+	14	2353	c.2209C>T	c.(2209-2211)CGC>TGC	p.R737C	LENG8_uc002qfw.2_Intron			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		AGCTCCTGGCCGCAGGCCTCC	0.602													5	10	---	---	---	---	capture	Missense_Mutation	SNP	54969780	54969780	LENG8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	287	23	1	1	8644	83
KIR2DL4	3805	broad.mit.edu	37	19	55316286	55316286	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55316286G>A	uc010yfm.1	+	3	155	c.115G>A	c.(115-117)GCT>ACT	p.A39T	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Missense_Mutation_p.A34T|KIR2DL4_uc002qhg.2_Missense_Mutation_p.A39T|KIR2DL4_uc002qhi.2_Missense_Mutation_p.A39T|KIR2DL4_uc002qhh.2_Intron|KIR2DL4_uc002qhj.2_Missense_Mutation_p.A39T|KIR2DL4_uc002qhf.2_Intron|KIR2DL4_uc010esd.2_Missense_Mutation_p.A39T|KIR2DL4_uc010ese.2_5'Flank	NM_002255	NP_002246	Q99706	KI2L4_HUMAN	killer cell immunoglobulin-like receptor, two	39	Extracellular (Potential).				cellular defense response|regulation of immune response	integral to plasma membrane	protein binding|transmembrane receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0192)		CTGGCCCAGCGCTGTGGTGCC	0.582													25	81	---	---	---	---	capture	Missense_Mutation	SNP	55316286	55316286	KIR2DL4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8240	83
NLRP4	147945	broad.mit.edu	37	19	56369522	56369522	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56369522C>T	uc002qmd.3	+	3	1185	c.763C>T	c.(763-765)CGG>TGG	p.R255W	NLRP4_uc002qmf.2_Missense_Mutation_p.R180W|NLRP4_uc010etf.2_Missense_Mutation_p.R86W	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	255	NACHT.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GATGGAGAAACGGCCGGTGCA	0.577													55	76	---	---	---	---	capture	Missense_Mutation	SNP	56369522	56369522	NLRP4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	10386	83
LTBP1	4052	broad.mit.edu	37	2	33335817	33335817	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:33335817G>A	uc002ros.2	+	4	1032	c.1032G>A	c.(1030-1032)CAG>CAA	p.Q344Q		NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	344					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CACCTTTTCAGCGTGAGTATA	0.423													67	88	---	---	---	---	capture	Silent	SNP	33335817	33335817	LTBP1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	8988	83
KRCC1	51315	broad.mit.edu	37	2	88327482	88327482	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:88327482C>T	uc002sso.1	-	4	995	c.601G>A	c.(601-603)GAG>AAG	p.E201K	KRCC1_uc002ssp.1_Missense_Mutation_p.E201K	NM_016618	NP_057702	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	201	Lys-rich.|Potential.									ovary(1)	1						ATTTCCACCTCTGTTTTCTTT	0.398													21	488	---	---	---	---	capture	Missense_Mutation	SNP	88327482	88327482	KRCC1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8361	83
IL18RAP	8807	broad.mit.edu	37	2	103057838	103057838	+	Splice_Site	SNP	G	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103057838G>T	uc002tbx.2	+	7	1280	c.796_splice	c.e7+1	p.G266_splice	IL18RAP_uc010fiz.2_Splice_Site_p.G124_splice	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein						cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						GTAGAACTTGGTAAGCTGGGC	0.343													41	38	---	---	---	---	capture	Splice_Site	SNP	103057838	103057838	IL18RAP	2	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	7571	83
LRP2	4036	broad.mit.edu	37	2	170009381	170009381	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170009381A>G	uc002ues.2	-	67	12602	c.12389T>C	c.(12388-12390)CTT>CCT	p.L4130P		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4130	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTCCTGCACAAGATTATTGCG	0.478													182	202	---	---	---	---	capture	Missense_Mutation	SNP	170009381	170009381	LRP2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	8872	83
LRP2	4036	broad.mit.edu	37	2	170101420	170101420	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170101420C>T	uc002ues.2	-	22	3426	c.3213G>A	c.(3211-3213)GCG>GCA	p.A1071A	LRP2_uc010zdf.1_Silent_p.A934A	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1071	LDL-receptor class A 9.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CACAGGTGAACGCCGAAGATG	0.473													19	179	---	---	---	---	capture	Silent	SNP	170101420	170101420	LRP2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	8872	83
AOX1	316	broad.mit.edu	37	2	201478598	201478598	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201478598C>T	uc002uvx.2	+	15	1621	c.1520C>T	c.(1519-1521)GCG>GTG	p.A507V	AOX1_uc010zhf.1_Missense_Mutation_p.A63V|AOX1_uc010fsu.2_5'UTR	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	507					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TTGGGCTCGGCGCCAGGTGGG	0.473													42	52	---	---	---	---	capture	Missense_Mutation	SNP	201478598	201478598	AOX1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	722	83
MAPK1	5594	broad.mit.edu	37	22	22142672	22142672	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22142672G>A	uc002zvn.2	-	6	970	c.730C>T	c.(730-732)CTT>TTT	p.L244F	MAPK1_uc002zvo.2_Missense_Mutation_p.L244F|MAPK1_uc010gtk.1_Intron	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	244	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	GGGGATCCAAGAATACCTATC	0.353													71	88	---	---	---	---	capture	Missense_Mutation	SNP	22142672	22142672	MAPK1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	9184	83
IL2RB	3560	broad.mit.edu	37	22	37524496	37524496	+	Silent	SNP	G	T	T	rs143704470		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37524496G>T	uc003aqv.1	-	10	1427	c.1296C>A	c.(1294-1296)CCC>CCA	p.P432P		NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor	432	Cytoplasmic (Potential).				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CGAGGAGACTGGGGGAGAAGA	0.662													9	46	---	---	---	---	capture	Silent	SNP	37524496	37524496	IL2RB	22	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	7610	83
TMPPE	643853	broad.mit.edu	37	3	33134390	33134390	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:33134390C>A	uc003cfk.2	-	2	1489	c.1298G>T	c.(1297-1299)GGG>GTG	p.G433V	GLB1_uc003cfh.1_Intron|GLB1_uc003cfi.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron|TMPPE_uc011axl.1_Missense_Mutation_p.G296V	NM_001039770	NP_001034859	Q6ZT21	TMPPE_HUMAN	transmembrane protein with	433						integral to membrane	metal ion binding				0						CATGGGTATCCCGTAGTAGGC	0.592													24	31	---	---	---	---	capture	Missense_Mutation	SNP	33134390	33134390	TMPPE	3	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	16121	83
TMF1	7110	broad.mit.edu	37	3	69075241	69075241	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:69075241T>C	uc003dnn.2	-	14	3012	c.2765A>G	c.(2764-2766)AAG>AGG	p.K922R	TMF1_uc011bfx.1_Missense_Mutation_p.K925R	NM_007114	NP_009045	P82094	TMF1_HUMAN	TATA element modulatory factor 1	922	Potential.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		AGAAAATGGCTTGCGTTCCTT	0.393													6	88	---	---	---	---	capture	Missense_Mutation	SNP	69075241	69075241	TMF1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	16111	83
CPN2	1370	broad.mit.edu	37	3	194062679	194062679	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194062679G>A	uc003fts.2	-	2	843	c.753C>T	c.(751-753)AAC>AAT	p.N251N		NM_001080513	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	251	LRR 7.				protein stabilization	extracellular region	enzyme regulator activity			ovary(5)	5	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		GCGTGATGGCGTTGCGTTGCA	0.602													12	13	---	---	---	---	capture	Silent	SNP	194062679	194062679	CPN2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3775	83
RGS12	6002	broad.mit.edu	37	4	3432638	3432638	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3432638C>T	uc003ggw.2	+	17	4974	c.4070C>T	c.(4069-4071)CCG>CTG	p.P1357L	RGS12_uc003ggv.2_Missense_Mutation_p.P1357L|RGS12_uc003ggy.1_3'UTR|RGS12_uc003ggz.2_Missense_Mutation_p.P709L|RGS12_uc011bvs.1_3'UTR|RGS12_uc003gha.2_Missense_Mutation_p.P699L|RGS12_uc010icv.2_Missense_Mutation_p.P556L	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	1357						condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCTTGCTGCCGCCGCCCTCC	0.667													15	28	---	---	---	---	capture	Missense_Mutation	SNP	3432638	3432638	RGS12	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13187	83
GABRB1	2560	broad.mit.edu	37	4	47405592	47405592	+	Silent	SNP	G	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47405592G>T	uc003gxh.2	+	7	1073	c.699G>T	c.(697-699)CTG>CTT	p.L233L	GABRB1_uc011bze.1_Silent_p.L163L	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	233	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	ATCCACGACTGTCACTAAGTT	0.398													5	181	---	---	---	---	capture	Silent	SNP	47405592	47405592	GABRB1	4	G	T	T	T	1	0	0	0	0	0	0	0	1	613	48	4	4	6108	83
PDGFRA	5156	broad.mit.edu	37	4	55133901	55133901	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55133901G>A	uc003han.3	+	7	1445	c.1114G>A	c.(1114-1116)GAA>AAA	p.E372K	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.E266K|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	372	Ig-like C2-type 4.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	AAAGATTCAGGAAATAAGGTA	0.463			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			214	726	---	---	---	---	capture	Missense_Mutation	SNP	55133901	55133901	PDGFRA	4	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11564	83
PDGFRA	5156	broad.mit.edu	37	4	55144136	55144136	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55144136G>C	uc003han.3	+	14	2296	c.1965G>C	c.(1963-1965)TTG>TTC	p.L655F	PDGFRA_uc003haa.2_Missense_Mutation_p.L415F|PDGFRA_uc010igq.1_Missense_Mutation_p.L549F|PDGFRA_uc003ham.2_RNA|PDGFRA_uc003hao.1_Missense_Mutation_p.L34F	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	655	Protein kinase.|Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GGCCACATTTGAACATTGTAA	0.458			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			112	774	---	---	---	---	capture	Missense_Mutation	SNP	55144136	55144136	PDGFRA	4	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	11564	83
GRID2	2895	broad.mit.edu	37	4	94411879	94411879	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:94411879G>A	uc011cdt.1	+	12	2206	c.1948G>A	c.(1948-1950)GCA>ACA	p.A650T	GRID2_uc011cdu.1_Missense_Mutation_p.A555T	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	650	Helical; (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	ATCTTACACGGCAAACCTCGC	0.438													4	187	---	---	---	---	capture	Missense_Mutation	SNP	94411879	94411879	GRID2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6705	83
NEUROG2	63973	broad.mit.edu	37	4	113436257	113436257	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113436257C>T	uc003ias.2	-	2	702	c.375G>A	c.(373-375)ATG>ATA	p.M125I		NM_024019	NP_076924	Q9H2A3	NGN2_HUMAN	neurogenin 2	125	Helix-loop-helix motif.|Basic motif.				positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent	nucleus	E-box binding			skin(2)|central_nervous_system(1)	3		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00168)		TGAGGTTGTGCATGCGGTTTC	0.672													33	60	---	---	---	---	capture	Missense_Mutation	SNP	113436257	113436257	NEUROG2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	10260	83
PRDM9	56979	broad.mit.edu	37	5	23526957	23526957	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23526957G>A	uc003jgo.2	+	11	1942	c.1760G>A	c.(1759-1761)CGG>CAG	p.R587Q		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	587	C2H2-type 4.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GAGTGTGGGCGGGGCTTTAGC	0.607										HNSCC(3;0.000094)			50	77	---	---	---	---	capture	Missense_Mutation	SNP	23526957	23526957	PRDM9	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12359	83
C5orf39	389289	broad.mit.edu	37	5	43040058	43040058	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:43040058C>A	uc003jnf.2	-	1	390	c.91G>T	c.(91-93)GAA>TAA	p.E31*	C5orf39_uc010ivj.1_RNA|LOC153684_uc003jng.2_5'Flank|LOC153684_uc003jni.2_5'Flank	NM_001014279	NP_001014301	Q3ZCQ2	AX2R_HUMAN	annexin II receptor	31							receptor activity				0						CCACGATCTTCTGAACTCACA	0.567											OREG0016598	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	91	---	---	---	---	capture	Nonsense_Mutation	SNP	43040058	43040058	C5orf39	5	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	2274	83
MAP3K1	4214	broad.mit.edu	37	5	56168506	56168506	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56168506T>C	uc003jqw.3	+	8	1963	c.1462T>C	c.(1462-1464)TGT>CGT	p.C488R		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	488	RING-type.				cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		ACCTTTAATATGTCCCCTTTG	0.279													61	86	---	---	---	---	capture	Missense_Mutation	SNP	56168506	56168506	MAP3K1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	9157	83
GPR98	84059	broad.mit.edu	37	5	89989726	89989726	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89989726C>T	uc003kju.2	+	33	7249	c.7153C>T	c.(7153-7155)CTG>TTG	p.L2385L	GPR98_uc003kjt.2_Silent_p.L91L|GPR98_uc003kjv.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2385	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTTTGGTCGGCTGTTGTTGTT	0.428													14	17	---	---	---	---	capture	Silent	SNP	89989726	89989726	GPR98	5	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	6654	83
FBN2	2201	broad.mit.edu	37	5	127728841	127728841	+	Silent	SNP	G	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127728841G>T	uc003kuu.2	-	10	1891	c.1452C>A	c.(1450-1452)ATC>ATA	p.I484I	FBN2_uc003kuv.2_Silent_p.I451I	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	484					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTCCAGTGATGATAGGTCCCT	0.498													76	114	---	---	---	---	capture	Silent	SNP	127728841	127728841	FBN2	5	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	5649	83
PCDHGB4	8641	broad.mit.edu	37	5	140768969	140768969	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140768969C>T	uc003lkc.1	+	1	1518	c.1518C>T	c.(1516-1518)AGC>AGT	p.S506S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.S506S	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	506	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCCATAAGCGCGGAGAGCG	0.662													41	58	---	---	---	---	capture	Silent	SNP	140768969	140768969	PCDHGB4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11468	83
UHRF1BP1	54887	broad.mit.edu	37	6	34827265	34827265	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34827265G>A	uc003oju.3	+	14	3366	c.3132G>A	c.(3130-3132)GTG>GTA	p.V1044V	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1044										ovary(3)	3						AGGAAGCTGTGTCCCTGACTA	0.517													80	130	---	---	---	---	capture	Silent	SNP	34827265	34827265	UHRF1BP1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	16850	83
ZNF735	730291	broad.mit.edu	37	7	63680474	63680474	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63680474G>A	uc011kdn.1	+	4	1045	c.1045G>A	c.(1045-1047)GGA>AGA	p.G349R		NM_001159524	NP_001152996	P0CB33	ZN735_HUMAN	zinc finger protein 735	349					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AATTCATACTGGAGAGAAACC	0.403													21	57	---	---	---	---	capture	Missense_Mutation	SNP	63680474	63680474	ZNF735	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	18001	83
TAF6	6878	broad.mit.edu	37	7	99706049	99706049	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99706049G>A	uc003uti.2	-	13	1480	c.1399C>T	c.(1399-1401)CGG>TGG	p.R467W	AP4M1_uc003utd.2_Intron|TAF6_uc003utg.2_Missense_Mutation_p.R389W|TAF6_uc003uth.2_Missense_Mutation_p.R524W|TAF6_uc003utk.2_Missense_Mutation_p.R467W|TAF6_uc011kji.1_Missense_Mutation_p.R504W|TAF6_uc003utj.2_Missense_Mutation_p.R457W|TAF6_uc003utl.2_Missense_Mutation_p.R467W|TAF6_uc003utm.2_Missense_Mutation_p.R467W	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha	467					negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCCTGGGCCCGAGCCTTGACC	0.642													55	156	---	---	---	---	capture	Missense_Mutation	SNP	99706049	99706049	TAF6	7	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	15418	83
GRM8	2918	broad.mit.edu	37	7	126173406	126173406	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126173406A>G	uc003vlr.2	-	8	2341	c.2030T>C	c.(2029-2031)TTT>TCT	p.F677S	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.F677S|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	677	Cytoplasmic (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CCCCTGCTCAAATATTCGGTG	0.502										HNSCC(24;0.065)			45	103	---	---	---	---	capture	Missense_Mutation	SNP	126173406	126173406	GRM8	7	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	6736	83
UBN2	254048	broad.mit.edu	37	7	138969015	138969015	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138969015C>A	uc011kqr.1	+	15	3364	c.3364C>A	c.(3364-3366)CAG>AAG	p.Q1122K		NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2	1122	Ser-rich.									ovary(1)|skin(1)	2						CATCAGCAGACAGTCTCCCAC	0.498													4	150	---	---	---	---	capture	Missense_Mutation	SNP	138969015	138969015	UBN2	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	16775	83
ARHGEF10	9639	broad.mit.edu	37	8	1871717	1871717	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1871717G>A	uc003wpr.2	+	20	2521	c.2343G>A	c.(2341-2343)GCG>GCA	p.A781A	ARHGEF10_uc003wpq.1_Silent_p.A805A|ARHGEF10_uc003wps.2_Silent_p.A743A|ARHGEF10_uc003wpv.2_Silent_p.A514A|ARHGEF10_uc010lre.2_Silent_p.A461A	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	806					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		TCAGAGCTGCGGACTGCTGCA	0.418													4	157	---	---	---	---	capture	Silent	SNP	1871717	1871717	ARHGEF10	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	887	83
CTHRC1	115908	broad.mit.edu	37	8	104390318	104390318	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104390318C>T	uc003ylk.2	+	3	535	c.436C>T	c.(436-438)CGG>TGG	p.R146W		NM_138455	NP_612464	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	146						collagen				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)			TGGCTCACTTCGGCTAAAATG	0.373													15	265	---	---	---	---	capture	Missense_Mutation	SNP	104390318	104390318	CTHRC1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	3973	83
DOCK8	81704	broad.mit.edu	37	9	439266	439266	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:439266G>C	uc003zgf.2	+	40	5213	c.5101G>C	c.(5101-5103)GAG>CAG	p.E1701Q	DOCK8_uc010mgu.2_Missense_Mutation_p.E1003Q|DOCK8_uc010mgv.2_Missense_Mutation_p.E1601Q|DOCK8_uc003zgk.2_Missense_Mutation_p.E1159Q	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1701	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CAATGTGCTGGAGGAGTCTGT	0.552													3	196	---	---	---	---	capture	Missense_Mutation	SNP	439266	439266	DOCK8	9	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	4649	83
KIAA1797	54914	broad.mit.edu	37	9	20821058	20821058	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:20821058T>C	uc003zog.1	+	16	2144	c.1781T>C	c.(1780-1782)ATA>ACA	p.I594T	KIAA1797_uc003zoh.1_Missense_Mutation_p.I30T	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	594						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		ATCAGAGATATATGTAAGCAG	0.363													8	254	---	---	---	---	capture	Missense_Mutation	SNP	20821058	20821058	KIAA1797	9	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8180	83
TAF1L	138474	broad.mit.edu	37	9	32630579	32630579	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32630579C>T	uc003zrg.1	-	1	5089	c.4999G>A	c.(4999-5001)GAT>AAT	p.D1667N	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1667					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCATACATATCAGGAGGCTGA	0.463													149	230	---	---	---	---	capture	Missense_Mutation	SNP	32630579	32630579	TAF1L	9	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	15411	83
ZNF658	26149	broad.mit.edu	37	9	40772401	40772401	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:40772401T>A	uc004abs.2	-	5	3026	c.2874A>T	c.(2872-2874)AGA>AGT	p.R958S	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Missense_Mutation_p.R958S	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	958	C2H2-type 21.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CTGTGTGAATTCTTTGATGTA	0.438													129	122	---	---	---	---	capture	Missense_Mutation	SNP	40772401	40772401	ZNF658	9	T	A	A	A	1	0	0	0	0	1	0	0	0	803	62	4	4	17947	83
TNFSF8	944	broad.mit.edu	37	9	117666360	117666360	+	Missense_Mutation	SNP	C	T	T	rs145748228		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117666360C>T	uc004bji.1	-	4	743	c.556G>A	c.(556-558)GTA>ATA	p.V186I		NM_001244	NP_001235	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily,	186	Extracellular (Potential).				cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding			lung(3)|skin(2)|ovary(1)	6						TTCTGGTATACGTGTTTCGTT	0.418													21	204	---	---	---	---	capture	Missense_Mutation	SNP	117666360	117666360	TNFSF8	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16194	83
BCOR	54880	broad.mit.edu	37	X	39923055	39923055	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39923055C>T	uc004den.3	-	8	3945	c.3653G>A	c.(3652-3654)TGG>TAG	p.W1218*	BCOR_uc004dep.3_Nonsense_Mutation_p.W1184*|BCOR_uc004deo.3_Nonsense_Mutation_p.W1166*|BCOR_uc010nhb.2_5'Flank|BCOR_uc004dem.3_Nonsense_Mutation_p.W1184*	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1218					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						CTGCTGCTCCCATCGTTCTCT	0.542													66	8	---	---	---	---	capture	Nonsense_Mutation	SNP	39923055	39923055	BCOR	23	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	1375	83
TAF1	6872	broad.mit.edu	37	X	70680612	70680612	+	Silent	SNP	C	T	T			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70680612C>T	uc004dzu.3	+	37	5406	c.5355C>T	c.(5353-5355)GAC>GAT	p.D1785D	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Silent_p.D1806D|TAF1_uc004dzv.3_Silent_p.D993D|TAF1_uc010nle.1_RNA|TAF1_uc010nlf.1_Silent_p.D210D|TAF1_uc004dzx.2_RNA|TAF1_uc004dzy.2_RNA|TAF1_uc004dzw.1_RNA|TAF1_uc010nlg.1_RNA	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1785	Asp/Glu-rich (acidic tail).|Protein kinase 2.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				ATGAGGGAGACGGTGGGGAGG	0.507													7	2	---	---	---	---	capture	Silent	SNP	70680612	70680612	TAF1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15401	83
CYLC1	1538	broad.mit.edu	37	X	83128394	83128394	+	Silent	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:83128394G>A	uc004eei.1	+	4	699	c.678G>A	c.(676-678)AGG>AGA	p.R226R	CYLC1_uc004eeh.1_Silent_p.R225R	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	226					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						ATTTGAAGAGGTCAAAGACTA	0.318													3	33	---	---	---	---	capture	Silent	SNP	83128394	83128394	CYLC1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	4101	83
PCDH11X	27328	broad.mit.edu	37	X	91132792	91132792	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91132792G>A	uc004efk.1	+	2	2398	c.1553G>A	c.(1552-1554)CGT>CAT	p.R518H	PCDH11X_uc004efl.1_Missense_Mutation_p.R518H|PCDH11X_uc004efo.1_Missense_Mutation_p.R518H|PCDH11X_uc010nmv.1_Missense_Mutation_p.R518H|PCDH11X_uc004efm.1_Missense_Mutation_p.R518H|PCDH11X_uc004efn.1_Missense_Mutation_p.R518H|PCDH11X_uc004efh.1_Missense_Mutation_p.R518H|PCDH11X_uc004efj.1_Missense_Mutation_p.R518H	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	518	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CTGGATTGTCGTACAGGCATG	0.433													60	10	---	---	---	---	capture	Missense_Mutation	SNP	91132792	91132792	PCDH11X	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11411	83
RASGRP2	10235	broad.mit.edu	37	11	64497600	64497600	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64497600delC	uc009ypu.2	-	13	1706	c.1479delG	c.(1477-1479)GGGfs	p.G493fs	RASGRP2_uc001oat.2_Frame_Shift_Del_p.G395fs|RASGRP2_uc001oau.2_Frame_Shift_Del_p.G348fs|RASGRP2_uc009ypv.2_Frame_Shift_Del_p.G493fs|RASGRP2_uc009ypw.2_Frame_Shift_Del_p.G493fs	NM_001098671	NP_001092141	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2	493					platelet activation|Ras protein signal transduction|regulation of cell growth|regulation of small GTPase mediated signal transduction	cell junction|cytosol|ruffle membrane|synapse|synaptosome	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity				0						AGCCCATGCGCCCCCCCAACA	0.642													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	64497600	64497600	RASGRP2	11	C	-	-	-	1	0	1	0	1	0	0	0	0	327	26	5	5	12970	83
CASKIN2	57513	broad.mit.edu	37	17	73498060	73498062	+	In_Frame_Del	DEL	GGA	-	-	rs150879399		TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73498060_73498062delGGA	uc002joc.2	-	18	3643_3645	c.3093_3095delTCC	c.(3091-3096)CCTCCA>CCA	p.1031_1032PP>P	CASKIN2_uc010wsc.1_In_Frame_Del_p.949_950PP>P	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	1031_1032	Pro-rich.					cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCTAGAAGCTGGAGGAGACTCGC	0.690													32	55	---	---	---	---	capture_indel	In_Frame_Del	DEL	73498060	73498062	CASKIN2	17	GGA	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	2643	83
UBR3	130507	broad.mit.edu	37	2	170929938	170929940	+	In_Frame_Del	DEL	GAA	-	-			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170929938_170929940delGAA	uc010zdi.1	+	36	5020_5022	c.5020_5022delGAA	c.(5020-5022)GAAdel	p.E1677del	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_In_Frame_Del_p.E498del|UBR3_uc002uft.3_In_Frame_Del_p.E534del|UBR3_uc010zdj.1_In_Frame_Del_p.E368del|UBR3_uc002ufu.3_In_Frame_Del_p.E183del	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1677					sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						TGTCTAAAAGGAAGAAGAAGAAT	0.379													84	180	---	---	---	---	capture_indel	In_Frame_Del	DEL	170929938	170929940	UBR3	2	GAA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	16785	83
CLOCK	9575	broad.mit.edu	37	4	56304530	56304532	+	In_Frame_Del	DEL	CTG	-	-			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:56304530_56304532delCTG	uc003haz.1	-	23	3204_3206	c.2278_2280delCAG	c.(2278-2280)CAGdel	p.Q760del	CLOCK_uc003hba.1_In_Frame_Del_p.Q760del|CLOCK_uc010igu.1_RNA	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	760	Gln-rich.				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			cctgggagctctgctgctgctgc	0.315													9	1296	---	---	---	---	capture_indel	In_Frame_Del	DEL	56304530	56304532	CLOCK	4	CTG	-	-	-	1	0	1	0	1	0	0	0	0	415	32	5	5	3514	83
MYO6	4646	broad.mit.edu	37	6	76599857	76599858	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76599857_76599858insA	uc003pih.1	+	26	3021_3022	c.2742_2743insA	c.(2740-2745)CAGAAAfs	p.Q914fs	MYO6_uc003pig.1_Frame_Shift_Ins_p.Q914fs|MYO6_uc003pii.1_Frame_Shift_Ins_p.Q914fs	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	914_915	Potential.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GTGCATTACAGAAAAAAAAACA	0.381													8	85	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	76599857	76599858	MYO6	6	-	A	A	A	1	0	1	1	0	0	0	0	0	425	33	5	5	9991	83
TG	7038	broad.mit.edu	37	8	134042090	134042090	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-2559-01	TCGA-06-2559-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:134042090delG	uc003ytw.2	+	41	7102	c.7061delG	c.(7060-7062)TGGfs	p.W2354fs	TG_uc010mdw.2_Frame_Shift_Del_p.W1113fs|TG_uc011ljb.1_Frame_Shift_Del_p.W723fs|TG_uc011ljc.1_Frame_Shift_Del_p.W487fs	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2354					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGTGGCAACTGGGGGCTGCTG	0.577													43	48	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	134042090	134042090	TG	8	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	15698	83
