Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PUM1	9698	broad.mit.edu	37	1	31409615	31409615	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31409615A>C	uc001bsi.1	-	21	3417	c.3304T>G	c.(3304-3306)TGC>GGC	p.C1102G	PUM1_uc001bsf.1_Missense_Mutation_p.C770G|PUM1_uc001bsg.1_Missense_Mutation_p.C836G|PUM1_uc001bsh.1_Missense_Mutation_p.C1104G|PUM1_uc001bsj.1_Missense_Mutation_p.C1078G|PUM1_uc010oga.1_Missense_Mutation_p.C960G|PUM1_uc001bsk.1_Missense_Mutation_p.C1140G|PUM1_uc010ogb.1_Missense_Mutation_p.C1043G|SNORD103A_uc009vts.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	1102	PUM-HD.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TTCATGGTGCACACCTCATCG	0.522													20	53	---	---	---	---	capture	Missense_Mutation	SNP	31409615	31409615	PUM1	1	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	12720	84
SOAT1	6646	broad.mit.edu	37	1	179304764	179304764	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179304764G>A	uc001gml.2	+	4	364	c.301G>A	c.(301-303)GAA>AAA	p.E101K	SOAT1_uc010pni.1_Missense_Mutation_p.E36K|SOAT1_uc001gmm.2_Missense_Mutation_p.E43K|SOAT1_uc010pnj.1_5'UTR|SOAT1_uc010pnk.1_Missense_Mutation_p.E36K	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	101					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	TTCTGTTCTTGAAGGAGAGAA	0.318													46	122	---	---	---	---	capture	Missense_Mutation	SNP	179304764	179304764	SOAT1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	14802	84
SOAT1	6646	broad.mit.edu	37	1	179304793	179304793	+	Splice_Site	SNP	G	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179304793G>C	uc001gml.2	+	4	392	c.329_splice	c.e4+1	p.K110_splice	SOAT1_uc010pni.1_Splice_Site_p.K45_splice|SOAT1_uc001gmm.2_Splice_Site_p.K52_splice|SOAT1_uc010pnj.1_Splice_Site|SOAT1_uc010pnk.1_Splice_Site_p.K45_splice	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	ATAGAGCGAAGTAAGTATGTG	0.259													34	117	---	---	---	---	capture	Splice_Site	SNP	179304793	179304793	SOAT1	1	G	C	C	C	1	0	0	0	0	0	0	1	0	468	36	5	4	14802	84
KCNT2	343450	broad.mit.edu	37	1	196398829	196398829	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196398829G>T	uc001gtd.1	-	9	757	c.697C>A	c.(697-699)CTT>ATT	p.L233I	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.L233I|KCNT2_uc001gtf.1_Missense_Mutation_p.L233I|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Missense_Mutation_p.L233I|KCNT2_uc009wyv.1_Missense_Mutation_p.L208I	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	233						voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						CAGAAATAAAGGGAGTCAAAG	0.393													4	89	---	---	---	---	capture	Missense_Mutation	SNP	196398829	196398829	KCNT2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	8014	84
CBARA1	10367	broad.mit.edu	37	10	74234889	74234889	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:74234889C>T	uc001jtb.1	-	9	1041	c.908G>A	c.(907-909)CGT>CAT	p.R303H	CBARA1_uc010qjw.1_Missense_Mutation_p.R103H|CBARA1_uc010qjx.1_Missense_Mutation_p.R103H|CBARA1_uc009xqo.1_RNA	NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN	calcium binding atopy-related autoantigen 1	301					calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1						CTGCAGTTTACGCTGAAATTC	0.463													5	15	---	---	---	---	capture	Missense_Mutation	SNP	74234889	74234889	CBARA1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2672	84
MEN1	4221	broad.mit.edu	37	11	64575552	64575552	+	Silent	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64575552G>A	uc001obj.2	-	3	553	c.480C>T	c.(478-480)TCC>TCT	p.S160S	MEN1_uc001obk.2_Silent_p.S160S|MEN1_uc001obl.2_Silent_p.S155S|MEN1_uc001obm.2_Silent_p.S155S|MEN1_uc001obn.2_Silent_p.S160S|MEN1_uc001obo.2_Silent_p.S160S|MEN1_uc001obp.2_Silent_p.S155S|MEN1_uc001obq.2_Silent_p.S160S|MEN1_uc001obr.2_Silent_p.S160S	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	160			S -> F (in MEN1).		DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding			parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						AGGCCACACCGGAGCTGTCCA	0.602			D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				3	32	---	---	---	---	capture	Silent	SNP	64575552	64575552	MEN1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9385	84
MTNR1B	4544	broad.mit.edu	37	11	92715286	92715286	+	Silent	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92715286C>T	uc001pdk.1	+	2	1000	c.897C>T	c.(895-897)TTC>TTT	p.F299F		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	299	Helical; Name=7; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	TGGCTTATTTCAACAGCTGCC	0.522													156	337	---	---	---	---	capture	Silent	SNP	92715286	92715286	MTNR1B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	9862	84
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	T	T	rs121913529		TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:25398284C>T	uc001rgp.1	-	2	216	c.35G>A	c.(34-36)GGT>GAT	p.G12D	KRAS_uc001rgq.1_Missense_Mutation_p.G12D|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			54	34	---	---	---	---	capture	Missense_Mutation	SNP	25398284	25398284	KRAS	12	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8358	84
ADCY6	112	broad.mit.edu	37	12	49169145	49169145	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49169145G>A	uc001rsh.3	-	10	2581	c.1921C>T	c.(1921-1923)CGG>TGG	p.R641W	ADCY6_uc001rsj.3_Missense_Mutation_p.R641W|ADCY6_uc001rsi.3_Missense_Mutation_p.R641W|ADCY6_uc010slw.1_5'Flank	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a	641	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						TGGTCCTTCCGCAGCTGATCA	0.597													37	84	---	---	---	---	capture	Missense_Mutation	SNP	49169145	49169145	ADCY6	12	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	298	84
SLC5A8	160728	broad.mit.edu	37	12	101555815	101555815	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101555815A>G	uc001thz.3	-	13	1957	c.1567T>C	c.(1567-1569)TAC>CAC	p.Y523H		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	523	Helical; (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						GTGCTGAAGTACAGATATGAT	0.358													10	474	---	---	---	---	capture	Missense_Mutation	SNP	101555815	101555815	SLC5A8	12	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	14563	84
GOLGA6A	342096	broad.mit.edu	37	15	74365151	74365151	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74365151A>C	uc002axa.1	-	13	1474	c.1433T>G	c.(1432-1434)CTA>CGA	p.L478R		NM_001038640	NP_001033729	Q9NYA3	GOG6A_HUMAN	golgi autoantigen, golgin subfamily a, 6	478	Potential.										0						GGCAGCTTCTAGGTGCTCCTA	0.612													14	77	---	---	---	---	capture	Missense_Mutation	SNP	74365151	74365151	GOLGA6A	15	A	C	C	C	1	0	0	0	0	1	0	0	0	195	15	4	4	6493	84
GOLGA6D	653643	broad.mit.edu	37	15	75580652	75580652	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75580652G>A	uc010uma.1	+	7	546	c.511G>A	c.(511-513)GAA>AAA	p.E171K	uc010umb.1_5'Flank	NM_001145224	NP_001138696	P0CG33	GOG6D_HUMAN	golgi autoantigen, golgin subfamily a, 6D	171	Potential.										0						GCATATTCAAGAATTGGAGCG	0.557													5	136	---	---	---	---	capture	Missense_Mutation	SNP	75580652	75580652	GOLGA6D	15	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	6496	84
TTLL13	440307	broad.mit.edu	37	15	90802040	90802040	+	Silent	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90802040C>T	uc002bpd.1	+	10	1521	c.1233C>T	c.(1231-1233)CTC>CTT	p.L411L	TTLL13_uc002bpe.1_RNA	NM_001029964	NP_001025135	A6NNM8	TTL13_HUMAN	tubulin tyrosine ligase-like family, member 13	411	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity				0	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			ATGCACTTCTCTGTGATGCTA	0.512													9	181	---	---	---	---	capture	Silent	SNP	90802040	90802040	TTLL13	15	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	16608	84
DNAH3	55567	broad.mit.edu	37	16	21145587	21145587	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21145587A>G	uc010vbe.1	-	7	1075	c.1075T>C	c.(1075-1077)TTT>CTT	p.F359L	DNAH3_uc002die.2_Missense_Mutation_p.F330L	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	359	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TACTCTGCAAACCACAGTTCT	0.527													49	142	---	---	---	---	capture	Missense_Mutation	SNP	21145587	21145587	DNAH3	16	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	4560	84
SPAG5	10615	broad.mit.edu	37	17	26911445	26911445	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26911445G>C	uc002hbq.2	-	12	2307	c.2215C>G	c.(2215-2217)CTA>GTA	p.L739V	SGK494_uc010waq.1_Intron	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	739	Gln-rich.				cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding			central_nervous_system(1)	1	Lung NSC(42;0.00431)					TGACTCTGTAGCTCTTTTAGC	0.512													102	283	---	---	---	---	capture	Missense_Mutation	SNP	26911445	26911445	SPAG5	17	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	14873	84
HNF1B	6928	broad.mit.edu	37	17	36065013	36065013	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36065013G>A	uc002hok.3	-	6	1471	c.1250C>T	c.(1249-1251)ACG>ATG	p.T417M	HNF1B_uc010wdi.1_Missense_Mutation_p.T391M	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1	417					endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GTGGATATTCGTCAAGGTGCT	0.478									Hereditary_Prostate_Cancer				27	57	---	---	---	---	capture	Missense_Mutation	SNP	36065013	36065013	HNF1B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7177	84
FBXL20	84961	broad.mit.edu	37	17	37431297	37431297	+	Silent	SNP	G	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37431297G>T	uc010wed.1	-	10	974	c.753C>A	c.(751-753)TCC>TCA	p.S251S	FBXL20_uc002hrt.2_Silent_p.S251S|FBXL20_uc010cvu.2_Silent_p.S219S	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	251	LRR 7.					cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)			AGGCACAAAGGGATTGTAACT	0.403													20	132	---	---	---	---	capture	Silent	SNP	37431297	37431297	FBXL20	17	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	5663	84
POTEC	388468	broad.mit.edu	37	18	14542851	14542851	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14542851C>T	uc010dln.2	-	1	749	c.295G>A	c.(295-297)GGC>AGC	p.G99S	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	99										skin(3)	3						CACCACTTGCCCATCTTGCTC	0.622													11	319	---	---	---	---	capture	Missense_Mutation	SNP	14542851	14542851	POTEC	18	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	12164	84
KCNG2	26251	broad.mit.edu	37	18	77659449	77659449	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77659449G>A	uc010xfl.1	+	2	1034	c.1034G>A	c.(1033-1035)CGC>CAC	p.R345H		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	345					energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CTGGCCGAGCGCGAGCTGGGC	0.716													4	13	---	---	---	---	capture	Missense_Mutation	SNP	77659449	77659449	KCNG2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7950	84
ITGB1BP3	27231	broad.mit.edu	37	19	3942189	3942189	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3942189G>A	uc002lyz.3	+	8	901	c.611G>A	c.(610-612)CGC>CAC	p.R204H	ITGB1BP3_uc010xia.1_Missense_Mutation_p.R209H	NM_170678	NP_733778	Q9NPI5	NRK2_HUMAN	integrin beta 1 binding protein 3	204					pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|protein binding|ribosylnicotinamide kinase activity			skin(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCCGGCTCGCCCAGCCAGG	0.647													10	15	---	---	---	---	capture	Missense_Mutation	SNP	3942189	3942189	ITGB1BP3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7816	84
CCDC105	126402	broad.mit.edu	37	19	15132177	15132177	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15132177C>T	uc002nae.2	+	4	986	c.887C>T	c.(886-888)GCG>GTG	p.A296V		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	296					microtubule cytoskeleton organization	microtubule				ovary(1)	1						TGCGCCTTGGCGCTAAACGAA	0.597													11	34	---	---	---	---	capture	Missense_Mutation	SNP	15132177	15132177	CCDC105	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2714	84
ZNF208	7757	broad.mit.edu	37	19	22155492	22155492	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22155492A>C	uc002nqp.2	-	5	2193	c.2044T>G	c.(2044-2046)TGT>GGT	p.C682G	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				GCTTTGCCACATTCTTCACAT	0.358													40	102	---	---	---	---	capture	Missense_Mutation	SNP	22155492	22155492	ZNF208	19	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	17646	84
BCL11A	53335	broad.mit.edu	37	2	60679781	60679781	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:60679781G>A	uc002sab.2	-	5	2479	c.2251C>T	c.(2251-2253)CGG>TGG	p.R751W	BCL11A_uc002sac.2_Silent_p.F217F|BCL11A_uc010ypi.1_Missense_Mutation_p.R420W|BCL11A_uc010ypj.1_Silent_p.F767F	NM_018014	NP_060484	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 2	Error:Variant_position_missing_in_Q9H165_after_alignment					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GTACTACGCCGAATGGGGGTG	0.498			T	IGH@	B-CLL								36	75	---	---	---	---	capture	Missense_Mutation	SNP	60679781	60679781	BCL11A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1352	84
ALMS1	7840	broad.mit.edu	37	2	73717955	73717955	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73717955G>C	uc002sje.1	+	12	8983	c.8872G>C	c.(8872-8874)GCT>CCT	p.A2958P	ALMS1_uc002sjf.1_Missense_Mutation_p.A2914P|ALMS1_uc002sjg.2_Missense_Mutation_p.A2344P|ALMS1_uc002sjh.1_Missense_Mutation_p.A2344P	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2956					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GGATTCTATAGCTTCAGACCT	0.438													91	246	---	---	---	---	capture	Missense_Mutation	SNP	73717955	73717955	ALMS1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	535	84
ALMS1	7840	broad.mit.edu	37	2	73717985	73717985	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73717985G>C	uc002sje.1	+	12	9013	c.8902G>C	c.(8902-8904)GAA>CAA	p.E2968Q	ALMS1_uc002sjf.1_Missense_Mutation_p.E2924Q|ALMS1_uc002sjg.2_Missense_Mutation_p.E2354Q|ALMS1_uc002sjh.1_Missense_Mutation_p.E2354Q	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2966					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CATTTCTCTTGAACAATGCCA	0.428													84	216	---	---	---	---	capture	Missense_Mutation	SNP	73717985	73717985	ALMS1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	535	84
TTN	7273	broad.mit.edu	37	2	179623871	179623871	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179623871G>T	uc010zfg.1	-	44	10367	c.10143C>A	c.(10141-10143)GAC>GAA	p.D3381E	TTN_uc010zfh.1_Missense_Mutation_p.D3335E|TTN_uc010zfi.1_Missense_Mutation_p.D3335E|TTN_uc010zfj.1_Missense_Mutation_p.D3335E|TTN_uc002umz.1_Missense_Mutation_p.D42E|TTN_uc002unb.2_Missense_Mutation_p.D3381E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGATTTTCTTGTCTTTGCTGT	0.368													40	115	---	---	---	---	capture	Missense_Mutation	SNP	179623871	179623871	TTN	2	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	16617	84
AOX1	316	broad.mit.edu	37	2	201527627	201527627	+	Missense_Mutation	SNP	G	A	A	rs142723794	byFrequency	TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201527627G>A	uc002uvx.2	+	31	3579	c.3478G>A	c.(3478-3480)GAA>AAA	p.E1160K	AOX1_uc010zhf.1_Missense_Mutation_p.E716K|AOX1_uc010fsu.2_Missense_Mutation_p.E526K	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	1160					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CCAGCCCTTCGAATACTTTGT	0.483													41	89	---	---	---	---	capture	Missense_Mutation	SNP	201527627	201527627	AOX1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	722	84
XRCC5	7520	broad.mit.edu	37	2	216995664	216995664	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:216995664C>T	uc002vfy.2	+	9	1144	c.1004C>T	c.(1003-1005)TCG>TTG	p.S335L	XRCC5_uc002vfz.2_Missense_Mutation_p.S221L	NM_021141	NP_066964	P13010	XRCC5_HUMAN	ATP-dependent DNA helicase II	335	Ku.				double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding			lung(1)|kidney(1)	2		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		AAATATAAATCGGAGGGGAAG	0.368								Direct_reversal_of_damage|NHEJ					41	113	---	---	---	---	capture	Missense_Mutation	SNP	216995664	216995664	XRCC5	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17337	84
LIPI	149998	broad.mit.edu	37	21	15561699	15561699	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:15561699T>C	uc002yjm.2	-	2	161	c.151A>G	c.(151-153)AAG>GAG	p.K51E	LIPI_uc010gkw.1_5'UTR	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	30					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		AAGGAATCCTTTACACTTAGC	0.358													61	143	---	---	---	---	capture	Missense_Mutation	SNP	15561699	15561699	LIPI	21	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	8745	84
SRGAP3	9901	broad.mit.edu	37	3	9055068	9055068	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9055068C>A	uc003brf.1	-	17	2747	c.2071G>T	c.(2071-2073)GAA>TAA	p.E691*	SRGAP3_uc003brg.1_Nonsense_Mutation_p.E667*	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	691					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		AAGATGGCTTCATGATGGATG	0.512			T	RAF1	pilocytic astrocytoma								24	74	---	---	---	---	capture	Nonsense_Mutation	SNP	9055068	9055068	SRGAP3	3	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	15039	84
FANCD2	2177	broad.mit.edu	37	3	10107617	10107617	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10107617C>T	uc003buw.2	+	25	2417	c.2339C>T	c.(2338-2340)TCA>TTA	p.S780L	FANCD2_uc003bux.1_Missense_Mutation_p.S780L|FANCD2_uc003buy.1_Missense_Mutation_p.S780L|FANCD2_uc010hcw.1_RNA	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	780					DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		AAAGAGCGTTCATTCATGTGT	0.403			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				28	82	---	---	---	---	capture	Missense_Mutation	SNP	10107617	10107617	FANCD2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	5611	84
KIAA1211	57482	broad.mit.edu	37	4	57189557	57189557	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57189557C>T	uc003hbk.2	+	9	3593	c.3202C>T	c.(3202-3204)CAG>TAG	p.Q1068*	KIAA1211_uc010iha.2_Nonsense_Mutation_p.Q1061*	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1068										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					GCCGATGCTTCAGAGCAGACA	0.468													21	49	---	---	---	---	capture	Nonsense_Mutation	SNP	57189557	57189557	KIAA1211	4	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	8137	84
ALB	213	broad.mit.edu	37	4	74283255	74283255	+	Missense_Mutation	SNP	G	T	T	rs141626688		TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74283255G>T	uc003hgs.3	+	11	1370	c.1297G>T	c.(1297-1299)GTT>TTT	p.V433F	ALB_uc003hgw.3_Missense_Mutation_p.V241F|ALB_uc011cbe.1_Missense_Mutation_p.V112F|ALB_uc003hgt.3_Missense_Mutation_p.V433F|ALB_uc010iii.2_Missense_Mutation_p.V318F|ALB_uc003hgu.3_Missense_Mutation_p.V283F|ALB_uc003hgv.3_Missense_Mutation_p.V112F|ALB_uc011cbf.1_Missense_Mutation_p.V323F|ALB_uc010iij.2_Intron|ALB_uc003hgx.3_Missense_Mutation_p.V112F	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein	433	Albumin 3.				bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	CAGGCTATTAGTTCGTTACAC	0.398													5	117	---	---	---	---	capture	Missense_Mutation	SNP	74283255	74283255	ALB	4	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	486	84
ATP10B	23120	broad.mit.edu	37	5	160063304	160063304	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160063304C>T	uc003lym.1	-	11	1860	c.1013G>A	c.(1012-1014)TGG>TAG	p.W338*	ATP10B_uc003lyp.2_Nonsense_Mutation_p.W338*|ATP10B_uc011deg.1_Nonsense_Mutation_p.W382*|ATP10B_uc003lyn.2_5'Flank|ATP10B_uc003lyo.2_Nonsense_Mutation_p.W310*	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	338	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTCCCATTCCAGATGCTGTG	0.498													4	101	---	---	---	---	capture	Nonsense_Mutation	SNP	160063304	160063304	ATP10B	5	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	1108	84
CLIC5	53405	broad.mit.edu	37	6	45882089	45882089	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:45882089G>C	uc003oxv.3	-	5	1047	c.941C>G	c.(940-942)CCT>CGT	p.P314R	CLIC5_uc003oxu.3_Missense_Mutation_p.P155R|CLIC5_uc003oxw.2_RNA|CLIC5_uc003oxx.2_Missense_Mutation_p.P155R	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a	314	GST C-terminal.				female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2						CTCTGGTAGAGGGGTGTTCAG	0.512													40	83	---	---	---	---	capture	Missense_Mutation	SNP	45882089	45882089	CLIC5	6	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	3494	84
SNAP91	9892	broad.mit.edu	37	6	84284736	84284736	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84284736G>A	uc011dze.1	-	25	2752	c.2435C>T	c.(2434-2436)GCA>GTA	p.A812V	SNAP91_uc011dzd.1_Missense_Mutation_p.A310V|SNAP91_uc003pkb.2_Missense_Mutation_p.A721V|SNAP91_uc003pkc.2_Missense_Mutation_p.A782V|SNAP91_uc003pkd.2_Missense_Mutation_p.A505V|SNAP91_uc003pka.2_Missense_Mutation_p.A810V	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	812	Pro-rich.				clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TACCAAAGGTGCACTTGGTGG	0.522													6	6	---	---	---	---	capture	Missense_Mutation	SNP	84284736	84284736	SNAP91	6	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	14725	84
EGFR	1956	broad.mit.edu	37	7	55214319	55214319	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55214319C>T	uc003tqk.2	+	4	691	c.445C>T	c.(445-447)CGG>TGG	p.R149W	EGFR_uc003tqh.2_Missense_Mutation_p.R149W|EGFR_uc003tqi.2_Missense_Mutation_p.R149W|EGFR_uc003tqj.2_Missense_Mutation_p.R149W|EGFR_uc010kzg.1_Intron|EGFR_uc011kco.1_Missense_Mutation_p.R96W	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	149	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGGCGCCGTGCGGTTCAGCAA	0.532		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			9	81	---	---	---	---	capture	Missense_Mutation	SNP	55214319	55214319	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4922	84
PIK3CG	5294	broad.mit.edu	37	7	106508473	106508473	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106508473C>T	uc003vdv.3	+	2	552	c.467C>T	c.(466-468)GCG>GTG	p.A156V	PIK3CG_uc003vdu.2_Missense_Mutation_p.A156V|PIK3CG_uc003vdw.2_Missense_Mutation_p.A156V	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	156					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CAGCTCACGGCGCTGATTGGC	0.682													9	20	---	---	---	---	capture	Missense_Mutation	SNP	106508473	106508473	PIK3CG	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11819	84
POLR3D	661	broad.mit.edu	37	8	22106786	22106786	+	Silent	SNP	C	T	T	rs139222181	byFrequency	TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22106786C>T	uc003xbl.2	+	7	968	c.885C>T	c.(883-885)GAC>GAT	p.D295D	POLR3D_uc003xbm.2_Silent_p.D295D|POLR3D_uc011kze.1_Intron	NM_001722	NP_001713	P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	295					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity				0				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		AGGGCGAGGACGGACAGGTGG	0.597													34	86	---	---	---	---	capture	Silent	SNP	22106786	22106786	POLR3D	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12133	84
OR1B1	347169	broad.mit.edu	37	9	125391091	125391091	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125391091G>A	uc011lyz.1	-	1	724	c.724C>T	c.(724-726)CGA>TGA	p.R242*		NM_001004450	NP_001004450	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B,	242	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAGACTGCTCGGCGGCGACCA	0.557													31	24	---	---	---	---	capture	Nonsense_Mutation	SNP	125391091	125391091	OR1B1	9	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	10855	84
NUDT11	55190	broad.mit.edu	37	X	51239120	51239120	+	Silent	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:51239120G>A	uc010njt.2	-	1	340	c.177C>T	c.(175-177)GGC>GGT	p.G59G		NM_018159	NP_060629	Q96G61	NUD11_HUMAN	nudix-type motif 11	59	Nudix box.|Nudix hydrolase.					cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					CCGCCGCACCGCCCGGCTCCT	0.662										HNSCC(48;0.14)			13	10	---	---	---	---	capture	Silent	SNP	51239120	51239120	NUDT11	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10634	84
STAG2	10735	broad.mit.edu	37	X	123197901	123197901	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123197901G>C	uc004etz.3	+	19	2364	c.2025G>C	c.(2023-2025)GAG>GAC	p.E675D	STAG2_uc004eua.2_Missense_Mutation_p.E675D|STAG2_uc004eub.2_Missense_Mutation_p.E675D|STAG2_uc004euc.2_Missense_Mutation_p.E675D|STAG2_uc004eud.2_Missense_Mutation_p.E675D|STAG2_uc004eue.2_Missense_Mutation_p.E675D	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	675					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TTCTGCAAGAGGTATATATTA	0.358													17	37	---	---	---	---	capture	Missense_Mutation	SNP	123197901	123197901	STAG2	23	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	15133	84
DDX26B	203522	broad.mit.edu	37	X	134679466	134679466	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134679466G>A	uc004eyw.3	+	3	671	c.308G>A	c.(307-309)AGA>AAA	p.R103K		NM_182540	NP_872346	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	103	VWFA.										0	Acute lymphoblastic leukemia(192;6.56e-05)					AATCTCAATAGATTAATATCT	0.353													52	169	---	---	---	---	capture	Missense_Mutation	SNP	134679466	134679466	DDX26B	23	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4311	84
SAGE1	55511	broad.mit.edu	37	X	134993470	134993470	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134993470T>A	uc004ezh.2	+	17	2292	c.2125T>A	c.(2125-2127)TGC>AGC	p.C709S	SAGE1_uc010nry.1_Missense_Mutation_p.C678S|SAGE1_uc011mvv.1_Missense_Mutation_p.C333S	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	709										ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TGGTATTTCATGCAGAAGTAC	0.453													86	196	---	---	---	---	capture	Missense_Mutation	SNP	134993470	134993470	SAGE1	23	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	13701	84
PTEN	5728	broad.mit.edu	37	10	89720799	89720802	+	Frame_Shift_Del	DEL	TACT	-	-			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720799_89720802delTACT	uc001kfb.2	+	9	1981_1984	c.950_953delTACT	c.(949-954)GTACTTfs	p.V317fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	317_318	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L318fs*2(17)|p.V317fs*3(16)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.V317fs*6(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*1(1)|p.W274_F341del(1)|p.V317_K322del(1)|p.L318F(1)|p.T318fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAATATCTAGTACTTACTTTAACA	0.333	V317fs*3(SKUT1_SOFT_TISSUE)|V317fs*3(EVSAT_BREAST)|V317fs*3(IGROV1_OVARY)|V317fs*3(ISHIKAWAHERAKLIO02ER_ENDOMETRIUM)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			67	114	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89720799	89720802	PTEN	10	TACT	-	-	-	1	0	1	0	1	0	0	0	0	741	57	5	5	12633	84
DYX1C1	161582	broad.mit.edu	37	15	55790519	55790520	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:55790519_55790520delAA	uc002adc.2	-	2	376_377	c.8_9delTT	c.(7-9)CTTfs	p.L3fs	CCPG1_uc002acy.2_5'UTR|DYX1C1_uc010ugh.1_RNA|DYX1C1_uc010ugi.1_RNA|DYX1C1_uc002adb.2_Frame_Shift_Del_p.L3fs|DYX1C1_uc002add.2_Frame_Shift_Del_p.L3fs	NM_130810	NP_570722	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1 isoform a	3	CS.				neuron migration|regulation of estrogen receptor signaling pathway|regulation of proteasomal protein catabolic process	cytoplasm|nucleus	estrogen receptor binding			skin(1)	1				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		CGCTAACCTGAAGAGGCATTCC	0.599													17	36	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	55790519	55790520	DYX1C1	15	AA	-	-	-	1	0	1	0	1	0	0	0	0	106	9	5	5	4817	84
CREB1	1385	broad.mit.edu	37	2	208434967	208434971	+	Frame_Shift_Del	DEL	GAAGA	-	-			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:208434967_208434971delGAAGA	uc002vcc.2	+	6	720_724	c.469_473delGAAGA	c.(469-474)GAAGAGfs	p.E157fs	CREB1_uc010ziz.1_Frame_Shift_Del_p.E141fs|CREB1_uc002vcd.2_Frame_Shift_Del_p.E143fs|CREB1_uc010zja.1_RNA	NM_134442	NP_604391	P16220	CREB1_HUMAN	cAMP responsive element binding protein 1	157_158	KID.				activation of phospholipase C activity|axon guidance|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway		protein dimerization activity|transcription cofactor activity		EWSR1/CREB1(42)	soft_tissue(42)|breast(1)|central_nervous_system(1)	44				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Bromocriptine(DB01200)|Naloxone(DB01183)	AGAGAAGTCTGAAGAGGAGACTTCA	0.371			T	EWSR1	clear cell sarcoma|angiomatoid fibrous histiocytoma								39	116	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	208434967	208434971	CREB1	2	GAAGA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	3819	84
MLLT3	4300	broad.mit.edu	37	9	20448206	20448206	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-2561-01	TCGA-06-2561-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:20448206delG	uc003zoe.2	-	4	594	c.335delC	c.(334-336)CCAfs	p.P112fs	MLLT3_uc011lne.1_Frame_Shift_Del_p.P80fs|MLLT3_uc011lnf.1_Frame_Shift_Del_p.P109fs|MLLT3_uc003zof.2_Intron|MLLT3_uc011lng.1_Frame_Shift_Del_p.P80fs	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	112	YEATS.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		ATTCACTGGTGGATGGCCTTC	0.448			T	MLL	ALL								112	110	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	20448206	20448206	MLLT3	9	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	9540	84
