Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PLCH2	9651	broad.mit.edu	37	1	2411404	2411404	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2411404G>A	uc001aji.1	+	3	777	c.503G>A	c.(502-504)CGC>CAC	p.R168H	PLCH2_uc010nyz.1_5'Flank|PLCH2_uc009vle.1_5'Flank|PLCH2_uc001ajj.1_5'Flank|PLCH2_uc001ajk.1_5'Flank	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	168					intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CGCCGCCAGCGCACCAGGGAC	0.687													22	20	---	---	---	---	capture	Missense_Mutation	SNP	2411404	2411404	PLCH2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11941	86
NCDN	23154	broad.mit.edu	37	1	36028235	36028235	+	Splice_Site	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36028235G>A	uc001bza.2	+	5	1512	c.1385_splice	c.e5+1	p.R462_splice	NCDN_uc001bzb.2_Splice_Site_p.R462_splice|NCDN_uc001bzc.2_Splice_Site_p.R445_splice	NM_001014839	NP_001014839	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1						neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACGCTCTCCGGTGAGTCTGTA	0.597													15	21	---	---	---	---	capture	Splice_Site	SNP	36028235	36028235	NCDN	1	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	10121	86
KIAA0754	643314	broad.mit.edu	37	1	39876294	39876294	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39876294G>A	uc009vvt.1	+	1	1119	c.357G>A	c.(355-357)CGG>CGA	p.R119R	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	Error:Variant_position_missing_in_O94854_after_alignment											0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCAGAAGGCGGCCAAATGCAG	0.478													4	175	---	---	---	---	capture	Silent	SNP	39876294	39876294	KIAA0754	1	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	8114	86
C1orf173	127254	broad.mit.edu	37	1	75108729	75108729	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75108729C>A	uc001dgg.2	-	4	516	c.297G>T	c.(295-297)GAG>GAT	p.E99D		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	99										ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TCTGGATTCGCTCCTTCCTAG	0.323													54	83	---	---	---	---	capture	Missense_Mutation	SNP	75108729	75108729	C1orf173	1	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	1996	86
ZZZ3	26009	broad.mit.edu	37	1	78098001	78098001	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78098001G>A	uc001dhq.2	-	5	1515	c.1039C>T	c.(1039-1041)CCA>TCA	p.P347S	ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Missense_Mutation_p.P347S|ZZZ3_uc001dhp.2_Missense_Mutation_p.P347S	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	347					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						CCGGAGGCTGGCATACTCTCA	0.443													5	243	---	---	---	---	capture	Missense_Mutation	SNP	78098001	78098001	ZZZ3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	18132	86
ANKRD35	148741	broad.mit.edu	37	1	145558841	145558841	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145558841C>T	uc001eob.1	+	7	568	c.460C>T	c.(460-462)CGT>TGT	p.R154C	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Translation_Start_Site	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	154	ANK 4.									ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCAGGATGGACGTACACCCCT	0.557													72	109	---	---	---	---	capture	Missense_Mutation	SNP	145558841	145558841	ANKRD35	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	660	86
SPRR1A	6698	broad.mit.edu	37	1	152957774	152957774	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152957774A>T	uc009wnu.1	+	2	146	c.68A>T	c.(67-69)CAA>CTA	p.Q23L	SPRR1A_uc001faw.2_Missense_Mutation_p.Q23L	NM_005987	NP_005978	P35321	SPR1A_HUMAN	small proline-rich protein 1A	23	2.|2 X 12 AA approximate repeats.				keratinization|peptide cross-linking	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity				0	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGGTGAAACAACCTTGCCAG	0.572													62	101	---	---	---	---	capture	Missense_Mutation	SNP	152957774	152957774	SPRR1A	1	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	14987	86
C1orf116	79098	broad.mit.edu	37	1	207195575	207195575	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207195575C>T	uc001hfd.2	-	4	1793	c.1534G>A	c.(1534-1536)GGC>AGC	p.G512S	C1orf116_uc009xcb.1_Missense_Mutation_p.G266S	NM_023938	NP_076427	Q9BW04	SARG_HUMAN	specifically androgen-regulated protein isoform	512						cytoplasm|plasma membrane	receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Prostate(682;0.19)					AAGAAGGAGCCCTTTCCCAGA	0.567													18	19	---	---	---	---	capture	Missense_Mutation	SNP	207195575	207195575	C1orf116	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	1971	86
HIST3H3	8290	broad.mit.edu	37	1	228612678	228612678	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228612678G>A	uc001hsx.1	-	1	349	c.349C>T	c.(349-351)CGG>TGG	p.R117W		NM_003493	NP_003484	Q16695	H31T_HUMAN	histone cluster 3, H3	117					nucleosome assembly|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0		Prostate(94;0.0724)				ATGGTGACCCGTTTGGCATGG	0.627													38	56	---	---	---	---	capture	Missense_Mutation	SNP	228612678	228612678	HIST3H3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	7109	86
HIST3H2A	92815	broad.mit.edu	37	1	228645127	228645127	+	Silent	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228645127C>T	uc001hsy.2	-	1	434	c.392G>A	c.(391-393)TGA>TAA	p.*131*	HIST3H2BB_uc001hsz.2_5'Flank	NM_033445	NP_254280	Q7L7L0	H2A3_HUMAN	histone cluster 3, H2a	131					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1		Prostate(94;0.183)				cgggcggccTCACTTGCCCTT	0.502													9	10	---	---	---	---	capture	Silent	SNP	228645127	228645127	HIST3H2A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	7107	86
OR2C3	81472	broad.mit.edu	37	1	247695195	247695195	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247695195A>G	uc009xgy.2	-	2	981	c.619T>C	c.(619-621)TTT>CTT	p.F207L	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			AGGACAACAAAGACAAAGCTG	0.532													25	37	---	---	---	---	capture	Missense_Mutation	SNP	247695195	247695195	OR2C3	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	10897	86
IDE	3416	broad.mit.edu	37	10	94267958	94267958	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:94267958C>G	uc001kia.2	-	8	1141	c.1065G>C	c.(1063-1065)TGG>TGC	p.W355C		NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor	355					beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GAGTATTAACCCAGCCTGCAA	0.358													107	148	---	---	---	---	capture	Missense_Mutation	SNP	94267958	94267958	IDE	10	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	7418	86
SLK	9748	broad.mit.edu	37	10	105762134	105762134	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105762134C>A	uc001kxo.1	+	9	1232	c.1198C>A	c.(1198-1200)CAT>AAT	p.H400N	SLK_uc001kxp.1_Missense_Mutation_p.H400N	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	400	Glu-rich.				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TATTAATGAACATATTACCGA	0.388													4	140	---	---	---	---	capture	Missense_Mutation	SNP	105762134	105762134	SLK	10	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	14640	86
SIRT3	23410	broad.mit.edu	37	11	233173	233173	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:233173A>C	uc001lok.3	-	3	550	c.516T>G	c.(514-516)GAT>GAG	p.D172E	SIRT3_uc001loj.3_Missense_Mutation_p.D30E|SIRT3_uc010qvm.1_Missense_Mutation_p.D108E|SIRT3_uc010qvn.1_Missense_Mutation_p.D91E|SIRT3_uc010qvo.1_Missense_Mutation_p.D172E|SIRT3_uc010qvp.1_Missense_Mutation_p.D172E|SIRT3_uc010qvq.1_Missense_Mutation_p.D30E|SIRT3_uc009ybt.1_RNA	NM_012239	NP_036371	Q9NTG7	SIRT3_HUMAN	sirtuin 3 isoform a	172	Deacetylase sirtuin-type.				chromatin silencing|protein ADP-ribosylation|protein deacetylation	mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|protein binding|zinc ion binding			urinary_tract(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		GGTACGGGAGATCGTACTGCT	0.532													20	34	---	---	---	---	capture	Missense_Mutation	SNP	233173	233173	SIRT3	11	A	C	C	C	1	0	0	0	0	1	0	0	0	154	12	4	4	14232	86
OR51M1	390059	broad.mit.edu	37	11	5411176	5411176	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5411176C>G	uc010qzc.1	+	1	548	c.548C>G	c.(547-549)TCT>TGT	p.S183C	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	183						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TACTGTGGATCTGTGGTCCTC	0.517													110	152	---	---	---	---	capture	Missense_Mutation	SNP	5411176	5411176	OR51M1	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	11007	86
VWCE	220001	broad.mit.edu	37	11	61048379	61048379	+	Silent	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61048379C>T	uc001nra.2	-	8	1395	c.1116G>A	c.(1114-1116)AGG>AGA	p.R372R	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	372						extracellular region	calcium ion binding			ovary(1)	1						ACTCAGGGCCCCTGGGTGAGG	0.677													8	8	---	---	---	---	capture	Silent	SNP	61048379	61048379	VWCE	11	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	17127	86
SCNN1A	6337	broad.mit.edu	37	12	6463925	6463925	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6463925G>T	uc001qnx.2	-	7	1522	c.1233C>A	c.(1231-1233)TAC>TAA	p.Y411*	SCNN1A_uc001qnv.2_Nonsense_Mutation_p.Y111*|SCNN1A_uc001qnw.2_Nonsense_Mutation_p.Y470*|SCNN1A_uc010sfb.1_Nonsense_Mutation_p.Y434*	NM_001038	NP_001029	P37088	SCNNA_HUMAN	sodium channel, nonvoltage-gated 1 alpha isoform	411	Extracellular (By similarity).				excretion|response to stimulus|sensory perception of taste	apical plasma membrane	WW domain binding				0					Amiloride(DB00594)|Triamterene(DB00384)	CCTGCTGTGTGTACTTTGAAG	0.557													37	54	---	---	---	---	capture	Nonsense_Mutation	SNP	6463925	6463925	SCNN1A	12	G	T	T	T	1	0	0	0	0	0	1	0	0	620	48	5	4	13820	86
CLEC1A	51267	broad.mit.edu	37	12	10224014	10224014	+	Missense_Mutation	SNP	C	T	T	rs147882348	by1000genomes	TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10224014C>T	uc001qxb.2	-	6	845	c.761G>A	c.(760-762)CGT>CAT	p.R254H	CLEC1A_uc009zhf.2_Missense_Mutation_p.R166H|CLEC1A_uc001qxc.2_Missense_Mutation_p.R166H|CLEC1A_uc001qxd.2_Missense_Mutation_p.R211H|CLEC1A_uc010sgx.1_Missense_Mutation_p.R152H	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1	254	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2						ACAGACACAACGCTTCAATTC	0.488													109	194	---	---	---	---	capture	Missense_Mutation	SNP	10224014	10224014	CLEC1A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3470	86
KRT18	3875	broad.mit.edu	37	12	53343221	53343221	+	Silent	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53343221C>T	uc001sbe.2	+	2	333	c.264C>T	c.(262-264)AAC>AAT	p.N88N	KRT18_uc009zmn.1_Silent_p.N88N|KRT18_uc001sbf.1_Translation_Start_Site|KRT18_uc001sbg.2_Silent_p.N88N|KRT18_uc009zmo.2_Silent_p.N88N|KRT8_uc009zml.1_Intron|KRT8_uc009zmm.1_Intron	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	88	Coil 1A.|Rod.|Interaction with TRADD.|Necessary for interaction with PNN.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						AAAGCCTGAACGACCGCCTGG	0.647													20	34	---	---	---	---	capture	Silent	SNP	53343221	53343221	KRT18	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8375	86
PTPRR	5801	broad.mit.edu	37	12	71094985	71094985	+	Silent	SNP	G	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:71094985G>T	uc001swi.1	-	7	1542	c.1126C>A	c.(1126-1128)CGA>AGA	p.R376R	PTPRR_uc001swh.1_Silent_p.R131R|PTPRR_uc009zrs.2_Silent_p.R225R|PTPRR_uc010stq.1_Silent_p.R264R|PTPRR_uc010str.1_Silent_p.R225R	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	376	Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GTGAGAATTCGGCTGGCTGAC	0.458													46	77	---	---	---	---	capture	Silent	SNP	71094985	71094985	PTPRR	12	G	T	T	T	1	0	0	0	0	0	0	0	1	506	39	4	4	12705	86
WSCD2	9671	broad.mit.edu	37	12	108600179	108600179	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108600179C>T	uc001tms.2	+	3	1240	c.496C>T	c.(496-498)CGG>TGG	p.R166W	WSCD2_uc001tmt.2_Missense_Mutation_p.R166W	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	166	WSC 1.					integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						CTGTGCTGAACGGTAGGGTCC	0.527													30	58	---	---	---	---	capture	Missense_Mutation	SNP	108600179	108600179	WSCD2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	17288	86
TMEM132D	121256	broad.mit.edu	37	12	130184469	130184469	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130184469C>T	uc009zyl.1	-	2	1182	c.854G>A	c.(853-855)CGT>CAT	p.R285H		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	285	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GTTGTCCAGACGCAGTTCTCT	0.522													31	41	---	---	---	---	capture	Missense_Mutation	SNP	130184469	130184469	TMEM132D	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15931	86
FAM70B	348013	broad.mit.edu	37	13	114502323	114502323	+	Silent	SNP	C	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114502323C>G	uc001vuh.2	+	5	381	c.354C>G	c.(352-354)CCC>CCG	p.P118P		NM_182614	NP_872420	Q8WV15	FA70B_HUMAN	family with sequence similarity 70, member B	118						integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)			AACCGAGGCCCCTCACCACGG	0.542													29	23	---	---	---	---	capture	Silent	SNP	114502323	114502323	FAM70B	13	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	5554	86
OR11H6	122748	broad.mit.edu	37	14	20692418	20692418	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20692418C>A	uc010tlc.1	+	1	550	c.550C>A	c.(550-552)CTT>ATT	p.L184I		NM_001004480	NP_001004480	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		TATCTCCCAACTTCCCTTCTG	0.507													42	33	---	---	---	---	capture	Missense_Mutation	SNP	20692418	20692418	OR11H6	14	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	10833	86
MAPKBP1	23005	broad.mit.edu	37	15	42106769	42106769	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42106769G>A	uc001zok.3	+	11	1306	c.1020G>A	c.(1018-1020)GCG>GCA	p.A340A	MAPKBP1_uc001zoj.3_Silent_p.A334A|MAPKBP1_uc010bcj.2_Intron|MAPKBP1_uc010bci.2_Silent_p.A334A|MAPKBP1_uc010udb.1_Silent_p.A222A|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_Intron	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein	340										central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CTGGAGTGGCGAATGCCAGGT	0.488													123	179	---	---	---	---	capture	Silent	SNP	42106769	42106769	MAPKBP1	15	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	9205	86
MAPKBP1	23005	broad.mit.edu	37	15	42111074	42111074	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42111074G>A	uc001zok.3	+	21	2514	c.2228G>A	c.(2227-2229)CGT>CAT	p.R743H	MAPKBP1_uc001zoj.3_Missense_Mutation_p.R737H|MAPKBP1_uc010bcj.2_Missense_Mutation_p.R244H|MAPKBP1_uc010bci.2_Missense_Mutation_p.R737H|MAPKBP1_uc010udb.1_Missense_Mutation_p.R576H|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_Missense_Mutation_p.R244H	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein	743										central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		ATGAGGCAGCGTCTGGCCGAG	0.602													19	30	---	---	---	---	capture	Missense_Mutation	SNP	42111074	42111074	MAPKBP1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9205	86
ATP8B4	79895	broad.mit.edu	37	15	50339659	50339659	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50339659A>T	uc001zxu.2	-	4	232	c.90T>A	c.(88-90)GAT>GAA	p.D30E	ATP8B4_uc010ber.2_5'UTR|ATP8B4_uc010ufd.1_5'UTR|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	30	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	p.D30D(1)		skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GGATACGATTATCCTGGAAAA	0.373													35	60	---	---	---	---	capture	Missense_Mutation	SNP	50339659	50339659	ATP8B4	15	A	T	T	T	1	0	0	0	0	1	0	0	0	206	16	4	4	1188	86
PTX4	390667	broad.mit.edu	37	16	1536134	1536134	+	Missense_Mutation	SNP	C	T	T	rs149572258		TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1536134C>T	uc010uvf.1	-	3	1228	c.1228G>A	c.(1228-1230)GAC>AAC	p.D410N		NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN	neuronal pentraxin II-like	415	Pentaxin.					extracellular region	metal ion binding				0						TCGGAGCTGTCGAATCCGCCC	0.652													19	29	---	---	---	---	capture	Missense_Mutation	SNP	1536134	1536134	PTX4	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12718	86
SRRM2	23524	broad.mit.edu	37	16	2817214	2817214	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2817214G>C	uc002crk.2	+	11	7234	c.6685G>C	c.(6685-6687)GCC>CCC	p.A2229P	SRRM2_uc002crj.1_Missense_Mutation_p.A2133P|SRRM2_uc002crl.1_Missense_Mutation_p.A2229P|SRRM2_uc010bsu.1_Missense_Mutation_p.A2133P	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	2229	Ala-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						AGCCAACCTTGCCAGCAGGAT	0.612													32	47	---	---	---	---	capture	Missense_Mutation	SNP	2817214	2817214	SRRM2	16	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	15061	86
DNAH3	55567	broad.mit.edu	37	16	21033373	21033373	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21033373C>T	uc010vbe.1	-	40	5696	c.5696G>A	c.(5695-5697)CGC>CAC	p.R1899H		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1899	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ACAATGAAGGCGACCAAATTC	0.458													30	31	---	---	---	---	capture	Missense_Mutation	SNP	21033373	21033373	DNAH3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4560	86
POLR2A	5430	broad.mit.edu	37	17	7404279	7404279	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7404279G>A	uc002ghf.3	+	12	2136	c.1902G>A	c.(1900-1902)GAG>GAA	p.E634E		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	634					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				agaatggggagctgatcatgg	0.393													28	50	---	---	---	---	capture	Silent	SNP	7404279	7404279	POLR2A	17	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	12117	86
TP53	7157	broad.mit.edu	37	17	7578541	7578541	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578541A>G	uc002gim.2	-	5	583	c.389T>C	c.(388-390)CTC>CCC	p.L130P	TP53_uc002gig.1_Missense_Mutation_p.L130P|TP53_uc002gih.2_Missense_Mutation_p.L130P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'UTR|TP53_uc010cng.1_5'UTR|TP53_uc002gii.1_5'UTR|TP53_uc010cnh.1_Missense_Mutation_p.L130P|TP53_uc010cni.1_Missense_Mutation_p.L130P|TP53_uc002gij.2_Missense_Mutation_p.L130P|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.L37P|TP53_uc002gio.2_5'UTR|TP53_uc010vug.1_Missense_Mutation_p.L91P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	130	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		L -> H (in sporadic cancers; somatic mutation).|L -> F (in sporadic cancers; somatic mutation).|L -> I (in a sporadic cancer; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.L130V(11)|p.L130F(7)|p.L130R(7)|p.0?(7)|p.Y126_K132delYSPALNK(6)|p.L130L(4)|p.L130H(3)|p.Y126_N131delYSPALN(3)|p.L130fs*19(2)|p.N131fs*27(2)|p.L130fs*41(2)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.A129_L130insXX(1)|p.A129_N131delALN(1)|p.L130P(1)|p.V73fs*9(1)|p.Y126fs*18(1)|p.L130fs*39(1)|p.L130fs*16(1)|p.A129_K132delALNK(1)|p.L130_M133delLNKM(1)|p.L130fs*40(1)|p.S127fs*36(1)|p.L130del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CATCTTGTTGAGGGCAGGGGA	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			16	25	---	---	---	---	capture	Missense_Mutation	SNP	7578541	7578541	TP53	17	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	16264	86
C17orf39	79018	broad.mit.edu	37	17	17943061	17943061	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:17943061G>A	uc002gsg.1	+	1	451	c.283G>A	c.(283-285)GGT>AGT	p.G95S	ATPAF2_uc002gsd.1_5'Flank|ATPAF2_uc002gse.1_5'Flank|ATPAF2_uc002gsf.1_5'Flank|ATPAF2_uc010vxf.1_5'Flank	NM_024052	NP_076957	Q8IVV7	CQ039_HUMAN	hypothetical protein LOC79018	95	Pro-rich.									skin(1)	1	all_neural(463;0.228)					CCCGCCGGCCGGTGCCTCCGC	0.766													4	5	---	---	---	---	capture	Missense_Mutation	SNP	17943061	17943061	C17orf39	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1840	86
KCNJ12	3768	broad.mit.edu	37	17	21319772	21319772	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21319772A>T	uc002gyv.1	+	3	1823	c.1118A>T	c.(1117-1119)AAC>ATC	p.N373I		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	373	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CCCAGCGCCAACTCCTTCTGC	0.622										Prostate(3;0.18)			10	65	---	---	---	---	capture	Missense_Mutation	SNP	21319772	21319772	KCNJ12	17	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	7968	86
ACACA	31	broad.mit.edu	37	17	35614745	35614745	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35614745C>T	uc002hnm.2	-	14	1786	c.1595G>A	c.(1594-1596)CGC>CAC	p.R532H	ACACA_uc002hnk.2_Missense_Mutation_p.R454H|ACACA_uc002hnl.2_Missense_Mutation_p.R474H|ACACA_uc002hnn.2_Missense_Mutation_p.R532H|ACACA_uc002hno.2_Missense_Mutation_p.R569H|ACACA_uc010cuz.2_Missense_Mutation_p.R532H	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	532	Biotin carboxylation.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CTTATTGCTGCGGAAATTTAG	0.413													61	62	---	---	---	---	capture	Missense_Mutation	SNP	35614745	35614745	ACACA	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	106	86
KRT33A	3883	broad.mit.edu	37	17	39503142	39503142	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39503142C>T	uc002hwk.1	-	5	867	c.830G>A	c.(829-831)CGC>CAC	p.R277H		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	277	Coil 2.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				ATTGACCGTGCGTCTCAGCTC	0.582													83	125	---	---	---	---	capture	Missense_Mutation	SNP	39503142	39503142	KRT33A	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8389	86
JUP	3728	broad.mit.edu	37	17	39681243	39681243	+	Missense_Mutation	SNP	G	A	A	rs138005000	byFrequency	TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39681243G>A	uc010wfs.1	-	6	1009	c.1001C>T	c.(1000-1002)ACG>ATG	p.T334M	KRT19_uc002hxd.3_Missense_Mutation_p.T171M	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin	Error:Variant_position_missing_in_P14923_after_alignment					adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		AGCCTGTTCCGTCTCAAACCT	0.587													62	103	---	---	---	---	capture	Missense_Mutation	SNP	39681243	39681243	JUP	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7895	86
EPN3	55040	broad.mit.edu	37	17	48614388	48614388	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48614388G>A	uc002ira.3	+	2	906	c.471G>A	c.(469-471)GAG>GAA	p.E157E	EPN3_uc010wms.1_Silent_p.E212E|EPN3_uc010wmt.1_RNA|EPN3_uc010wmu.1_Silent_p.E157E	NM_017957	NP_060427	Q9H201	EPN3_HUMAN	epsin 3	157						clathrin-coated vesicle|nucleus|perinuclear region of cytoplasm	lipid binding			ovary(1)	1	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			TGGCACTGGAGGGCATCGGCA	0.657													4	12	---	---	---	---	capture	Silent	SNP	48614388	48614388	EPN3	17	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	5142	86
APBA3	9546	broad.mit.edu	37	19	3759564	3759564	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3759564T>C	uc002lyp.1	-	3	788	c.611A>G	c.(610-612)CAG>CGG	p.Q204R		NM_004886	NP_004877	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding,	204					intracellular signal transduction|protein transport	intracellular|membrane	protein binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCACCCTCCTGGGGGGCAGG	0.632													4	19	---	---	---	---	capture	Missense_Mutation	SNP	3759564	3759564	APBA3	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	751	86
CLPP	8192	broad.mit.edu	37	19	6366351	6366351	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6366351C>T	uc002mem.1	+	5	761	c.638C>T	c.(637-639)ACC>ATC	p.T213I	CLPP_uc002men.1_Missense_Mutation_p.T15I	NM_006012	NP_006003	Q16740	CLPP_HUMAN	caseinolytic peptidase, ATP-dependent,	213					proteolysis	mitochondrial matrix	ATP binding|protein binding|serine-type endopeptidase activity			ovary(1)	1						GCCAAGCACACCAAACAGAGC	0.557													10	34	---	---	---	---	capture	Missense_Mutation	SNP	6366351	6366351	CLPP	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	3517	86
VAV1	7409	broad.mit.edu	37	19	6772889	6772889	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6772889C>A	uc002mfu.1	+	1	168	c.71C>A	c.(70-72)ACC>AAC	p.T24N	VAV1_uc010xjh.1_Missense_Mutation_p.T24N|VAV1_uc010dva.1_Missense_Mutation_p.T24N	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	24	CH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						CACCGCGTGACCTGGGATGGG	0.662													18	64	---	---	---	---	capture	Missense_Mutation	SNP	6772889	6772889	VAV1	19	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	17013	86
CYP4F8	11283	broad.mit.edu	37	19	15730340	15730340	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15730340T>C	uc002nbi.2	+	4	447	c.383T>C	c.(382-384)CTG>CCG	p.L128P	CYP4F8_uc010xoi.1_3'UTR|CYP4F8_uc010xoj.1_Intron	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,	128					prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						TACAAGACCCTGAAGCCCTGG	0.537													3	86	---	---	---	---	capture	Missense_Mutation	SNP	15730340	15730340	CYP4F8	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4151	86
PSG7	5676	broad.mit.edu	37	19	43433692	43433692	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43433692A>T	uc002ovl.3	-	4	713	c.611T>A	c.(610-612)CTA>CAA	p.L204Q	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_5'Flank|PSG7_uc002out.1_Missense_Mutation_p.L23Q|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Missense_Mutation_p.L82Q	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	204	Ig-like C2-type 1.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				GACACCAAATAGGTAGAGGGT	0.522													217	556	---	---	---	---	capture	Missense_Mutation	SNP	43433692	43433692	PSG7	19	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	12555	86
MYBPC2	4606	broad.mit.edu	37	19	50945481	50945481	+	Silent	SNP	C	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50945481C>A	uc002psf.2	+	9	864	c.813C>A	c.(811-813)GGC>GGA	p.G271G		NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	271	Ig-like C2-type 2.				cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		TGGACAGAGGCAACAAGATCA	0.522													4	14	---	---	---	---	capture	Silent	SNP	50945481	50945481	MYBPC2	19	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	9922	86
RNF181	51255	broad.mit.edu	37	2	85824255	85824255	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85824255A>G	uc002spv.1	+	4	406	c.356A>G	c.(355-357)GAG>GGG	p.E119G		NM_016494	NP_057578	Q9P0P0	RN181_HUMAN	ring finger protein 181	119							ligase activity|zinc ion binding				0						TGCCGCTATGAGCTGCCCACT	0.522													3	162	---	---	---	---	capture	Missense_Mutation	SNP	85824255	85824255	RNF181	2	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	13357	86
ANAPC1	64682	broad.mit.edu	37	2	112608394	112608394	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:112608394T>C	uc002thi.2	-	14	1856	c.1609A>G	c.(1609-1611)ACT>GCT	p.T537A		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	537					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						GGCTTTGGAGTACTAACGCCA	0.433													4	193	---	---	---	---	capture	Missense_Mutation	SNP	112608394	112608394	ANAPC1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	595	86
ANAPC1	64682	broad.mit.edu	37	2	112608407	112608407	+	Silent	SNP	T	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:112608407T>A	uc002thi.2	-	14	1843	c.1596A>T	c.(1594-1596)CTA>CTT	p.L532L		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	532					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						TAACGCCATCTAGTGGAGTAC	0.433													4	165	---	---	---	---	capture	Silent	SNP	112608407	112608407	ANAPC1	2	T	A	A	A	1	0	0	0	0	0	0	0	1	678	53	4	4	595	86
LY75	4065	broad.mit.edu	37	2	160755444	160755444	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160755444C>T	uc002ubc.3	-	2	290	c.221G>A	c.(220-222)CGG>CAG	p.R74Q	LY75_uc002ubb.3_Missense_Mutation_p.R74Q|LY75_uc010fos.2_Missense_Mutation_p.R74Q|LY75_uc010fot.1_Missense_Mutation_p.R74Q	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	74	Extracellular (Potential).|Ricin B-type lectin.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		ATGAAAGAGCCGATGCTGGGA	0.493													59	97	---	---	---	---	capture	Missense_Mutation	SNP	160755444	160755444	LY75	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9014	86
LRP2	4036	broad.mit.edu	37	2	170090092	170090092	+	Missense_Mutation	SNP	G	A	A	rs140789320	by1000genomes	TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170090092G>A	uc002ues.2	-	30	5140	c.4927C>T	c.(4927-4929)CGG>TGG	p.R1643W		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1643	LDL-receptor class B 13.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TAGGGGTGCCGTATAATCTGT	0.498													27	53	---	---	---	---	capture	Missense_Mutation	SNP	170090092	170090092	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	8872	86
TRIP12	9320	broad.mit.edu	37	2	230663714	230663714	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:230663714A>C	uc002vpw.1	-	22	3243	c.3134T>G	c.(3133-3135)TTG>TGG	p.L1045W	TRIP12_uc002vpx.1_Missense_Mutation_p.L1093W|TRIP12_uc002vpy.1_Missense_Mutation_p.L775W|TRIP12_uc010zlz.1_RNA	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1045					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTTTGGATTCAAGCTTGCCAG	0.448													33	125	---	---	---	---	capture	Missense_Mutation	SNP	230663714	230663714	TRIP12	2	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	16439	86
TRIP12	9320	broad.mit.edu	37	2	230663734	230663734	+	Silent	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:230663734T>C	uc002vpw.1	-	22	3223	c.3114A>G	c.(3112-3114)AAA>AAG	p.K1038K	TRIP12_uc002vpx.1_Silent_p.K1086K|TRIP12_uc002vpy.1_Silent_p.K768K|TRIP12_uc010zlz.1_RNA	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1038					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GGAAAGAAGATTTAGGTGACT	0.398													34	127	---	---	---	---	capture	Silent	SNP	230663734	230663734	TRIP12	2	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	16439	86
TRIP12	9320	broad.mit.edu	37	2	230663763	230663763	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:230663763T>C	uc002vpw.1	-	22	3194	c.3085A>G	c.(3085-3087)AAA>GAA	p.K1029E	TRIP12_uc002vpx.1_Missense_Mutation_p.K1077E|TRIP12_uc002vpy.1_Missense_Mutation_p.K759E|TRIP12_uc010zlz.1_RNA	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1029					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GTGGGGCTTTTAGCTATGAAA	0.343													29	94	---	---	---	---	capture	Missense_Mutation	SNP	230663763	230663763	TRIP12	2	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	16439	86
TGM3	7053	broad.mit.edu	37	20	2298103	2298103	+	Missense_Mutation	SNP	C	A	A	rs147913958		TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2298103C>A	uc002wfx.3	+	7	1052	c.955C>A	c.(955-957)CCC>ACC	p.P319T		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	319					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	CATGGGAAACCCCCTGGACAA	0.507													103	276	---	---	---	---	capture	Missense_Mutation	SNP	2298103	2298103	TGM3	20	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	15716	86
FAM65C	140876	broad.mit.edu	37	20	49221267	49221267	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49221267C>T	uc002xvm.2	-	12	1307	c.989G>A	c.(988-990)GGC>GAC	p.G330D	FAM65C_uc010zyt.1_Missense_Mutation_p.G334D|FAM65C_uc010zyu.1_RNA|FAM65C_uc002xvn.1_Missense_Mutation_p.G330D	NM_080829	NP_543019	Q96MK2	FA65C_HUMAN	hypothetical protein LOC140876	330										ovary(2)	2						AGAAAACTTGCCCGTGGGGCT	0.592													4	91	---	---	---	---	capture	Missense_Mutation	SNP	49221267	49221267	FAM65C	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5549	86
TRPM2	7226	broad.mit.edu	37	21	45789188	45789188	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45789188G>A	uc002zet.1	+	6	946	c.733G>A	c.(733-735)GGC>AGC	p.G245S	TRPM2_uc002zeu.1_Missense_Mutation_p.G245S|TRPM2_uc002zew.1_Missense_Mutation_p.G245S|TRPM2_uc010gpt.1_Missense_Mutation_p.G245S|TRPM2_uc002zex.1_Missense_Mutation_p.G31S	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	245	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CGCCACCTGGGGCACTGTCCA	0.667													16	21	---	---	---	---	capture	Missense_Mutation	SNP	45789188	45789188	TRPM2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16469	86
ZBED4	9889	broad.mit.edu	37	22	50280049	50280049	+	Silent	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50280049C>T	uc003bix.2	+	2	3209	c.2739C>T	c.(2737-2739)TCC>TCT	p.S913S		NM_014838	NP_055653	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	913						cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity			ovary(2)	2		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		ACGAGATGTCCGTCGAGTGTA	0.587													3	82	---	---	---	---	capture	Silent	SNP	50280049	50280049	ZBED4	22	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17400	86
GRIP2	80852	broad.mit.edu	37	3	14558595	14558595	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14558595C>T	uc011avi.1	-	12	1577	c.1577G>A	c.(1576-1578)CGA>CAA	p.R526Q	GRIP2_uc011avh.1_Missense_Mutation_p.R57Q	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	428					synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						TTCCCTTCTTCGCTGCCTCCT	0.572													6	13	---	---	---	---	capture	Missense_Mutation	SNP	14558595	14558595	GRIP2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6721	86
TLR9	54106	broad.mit.edu	37	3	52255367	52255367	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52255367G>T	uc003dda.1	-	2	3599	c.2965C>A	c.(2965-2967)CGC>AGC	p.R989S	TLR9_uc003ddb.2_Missense_Mutation_p.R1086S	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor	989	TIR.|Cytoplasmic (Potential).				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)	ACACTCTGGCGGCAGAGGCGC	0.687													24	28	---	---	---	---	capture	Missense_Mutation	SNP	52255367	52255367	TLR9	3	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	15843	86
TNIP3	79931	broad.mit.edu	37	4	122075742	122075742	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:122075742C>G	uc010ing.2	-	5	652	c.456G>C	c.(454-456)AAG>AAC	p.K152N	TNIP3_uc010inh.2_Missense_Mutation_p.K152N|TNIP3_uc011cgj.1_Missense_Mutation_p.K210N|TNIP3_uc010ini.2_Missense_Mutation_p.K152N	NM_024873	NP_079149	Q96KP6	TNIP3_HUMAN	TNFAIP3 interacting protein 3	152	Potential.									ovary(1)	1						CGTAATGTTCCTTTTCCTTGT	0.343													79	102	---	---	---	---	capture	Missense_Mutation	SNP	122075742	122075742	TNIP3	4	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	16199	86
BRD9	65980	broad.mit.edu	37	5	865623	865623	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:865623G>C	uc003jbq.2	-	15	1766	c.1599C>G	c.(1597-1599)GAC>GAG	p.D533E	BRD9_uc003jbl.2_Missense_Mutation_p.D417E|BRD9_uc003jbm.2_RNA|BRD9_uc003jbn.2_RNA|BRD9_uc011cmb.1_Missense_Mutation_p.D480E|BRD9_uc003jbo.2_Missense_Mutation_p.D437E	NM_023924	NP_076413	Q9H8M2	BRD9_HUMAN	bromodomain containing 9 isoform 1	533							nucleic acid binding				0			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CTTCGTGCAGGTCCTGCAGGA	0.617													44	94	---	---	---	---	capture	Missense_Mutation	SNP	865623	865623	BRD9	5	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	1495	86
MARVELD2	153562	broad.mit.edu	37	5	68728420	68728420	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68728420G>A	uc003jwq.2	+	4	1308	c.1249G>A	c.(1249-1251)GCA>ACA	p.A417T	MARVELD2_uc010ixf.2_Missense_Mutation_p.A405T|MARVELD2_uc003jwr.1_Missense_Mutation_p.A417T|MARVELD2_uc003jws.1_RNA	NM_001038603	NP_001033692	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2 isoform 1	417	Cytoplasmic (Potential).				sensory perception of sound	integral to membrane|tight junction					0		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		ACTGAGAACAGCAAAAATGAA	0.448													3	102	---	---	---	---	capture	Missense_Mutation	SNP	68728420	68728420	MARVELD2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	9231	86
SLCO6A1	133482	broad.mit.edu	37	5	101816005	101816005	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101816005G>T	uc003knn.2	-	2	664	c.492C>A	c.(490-492)TTC>TTA	p.F164L	SLCO6A1_uc003kno.2_Missense_Mutation_p.F164L|SLCO6A1_uc003knp.2_Missense_Mutation_p.F164L|SLCO6A1_uc003knq.2_Missense_Mutation_p.F164L	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	164	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TGTCTCCATAGAATGCTATAA	0.338													75	108	---	---	---	---	capture	Missense_Mutation	SNP	101816005	101816005	SLCO6A1	5	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	14624	86
CHSY3	337876	broad.mit.edu	37	5	129519964	129519964	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:129519964G>A	uc003kvd.2	+	3	1129	c.1129G>A	c.(1129-1131)GGT>AGT	p.G377S		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	377	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CAATCGGAAGGGTTACATCCA	0.338													45	52	---	---	---	---	capture	Missense_Mutation	SNP	129519964	129519964	CHSY3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	3378	86
FBXO38	81545	broad.mit.edu	37	5	147784293	147784293	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147784293T>G	uc003lpf.1	+	6	758	c.638T>G	c.(637-639)CTT>CGT	p.L213R	FBXO38_uc003lpg.1_Missense_Mutation_p.L213R|FBXO38_uc003lph.2_Missense_Mutation_p.L213R	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	213						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTAAGGCACCTTTATATGAAG	0.348													54	59	---	---	---	---	capture	Missense_Mutation	SNP	147784293	147784293	FBXO38	5	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	5692	86
SLIT3	6586	broad.mit.edu	37	5	168212916	168212916	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168212916G>A	uc003mab.2	-	12	1567	c.1147C>T	c.(1147-1149)CTG>TTG	p.L383L	SLIT3_uc010jjg.2_Silent_p.L383L|SLIT3_uc010jji.2_Silent_p.L383L|SLIT3_uc003mac.1_Silent_p.L180L	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	383	LRR 10.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTCACAGCAGCTGTAGGGAC	0.493													23	47	---	---	---	---	capture	Silent	SNP	168212916	168212916	SLIT3	5	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	14633	86
NSD1	64324	broad.mit.edu	37	5	176638305	176638305	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176638305G>A	uc003mfr.3	+	5	3043	c.2905G>A	c.(2905-2907)GGA>AGA	p.G969R	NSD1_uc003mft.3_Missense_Mutation_p.G700R|NSD1_uc003mfs.1_Missense_Mutation_p.G866R|NSD1_uc011dfx.1_Missense_Mutation_p.G617R	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	969					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AGAGAAAAAGGGAGATGGCAC	0.512			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			41	51	---	---	---	---	capture	Missense_Mutation	SNP	176638305	176638305	NSD1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10576	86
PNPLA1	285848	broad.mit.edu	37	6	36259268	36259268	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36259268G>A	uc010jwf.2	+	2	377	c.377G>A	c.(376-378)CGC>CAC	p.R126H	PNPLA1_uc003olw.1_Missense_Mutation_p.R31H|PNPLA1_uc010jwe.1_Missense_Mutation_p.R31H	NM_001145717	NP_001139189	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	126	Patatin.				lipid catabolic process		hydrolase activity			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4						AGCCTCACCCGCTTAACGGAC	0.602													27	36	---	---	---	---	capture	Missense_Mutation	SNP	36259268	36259268	PNPLA1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12067	86
PRICKLE4	29964	broad.mit.edu	37	6	41753983	41753983	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41753983A>G	uc011duf.1	+	7	948	c.700A>G	c.(700-702)AGC>GGC	p.S234G	PRICKLE4_uc003ord.2_RNA|TOMM6_uc003org.2_5'Flank|TOMM6_uc011dug.1_5'Flank	NM_013397	NP_037529	Q2TBC4	PRIC4_HUMAN	over-expressed breast tumor protein	194	LIM zinc-binding 2.					nucleus	zinc ion binding				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCCTGGGGGAAGCCCCTGCTG	0.672													20	27	---	---	---	---	capture	Missense_Mutation	SNP	41753983	41753983	PRICKLE4	6	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	12385	86
TIAM2	26230	broad.mit.edu	37	6	155572049	155572049	+	Silent	SNP	A	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155572049A>C	uc003qqb.2	+	24	5227	c.3954A>C	c.(3952-3954)GTA>GTC	p.V1318V	TIAM2_uc003qqe.2_Silent_p.V1318V|TIAM2_uc010kjj.2_Silent_p.V880V|TIAM2_uc003qqf.2_Silent_p.V694V|TIAM2_uc011efl.1_Silent_p.V654V|TIAM2_uc003qqg.2_Silent_p.V630V|TIAM2_uc003qqh.2_Silent_p.V243V	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1318					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CAATCTAGGTAACAGAACTTT	0.423													72	109	---	---	---	---	capture	Silent	SNP	155572049	155572049	TIAM2	6	A	C	C	C	1	0	0	0	0	0	0	0	1	158	13	4	4	15776	86
HECW1	23072	broad.mit.edu	37	7	43485067	43485067	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43485067G>A	uc003tid.1	+	11	2901	c.2296G>A	c.(2296-2298)GCT>ACT	p.A766T	HECW1_uc011kbi.1_Missense_Mutation_p.A766T	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	766					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CACGAACGGCGCTGGGCCGTG	0.652													30	41	---	---	---	---	capture	Missense_Mutation	SNP	43485067	43485067	HECW1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6968	86
ZPBP	11055	broad.mit.edu	37	7	50121433	50121433	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50121433G>A	uc003tou.2	-	3	341	c.271C>T	c.(271-273)CGA>TGA	p.R91*	ZPBP_uc011kci.1_Nonsense_Mutation_p.R17*|ZPBP_uc010kyw.2_Nonsense_Mutation_p.R91*	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	91					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					TCAGCATTTCGCAGTTGTTGC	0.338													60	110	---	---	---	---	capture	Nonsense_Mutation	SNP	50121433	50121433	ZPBP	7	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	18095	86
EGFR	1956	broad.mit.edu	37	7	55221710	55221710	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221710C>T	uc003tqk.2	+	7	1000	c.754C>T	c.(754-756)CGC>TGC	p.R252C	EGFR_uc003tqh.2_Missense_Mutation_p.R252C|EGFR_uc003tqi.2_Missense_Mutation_p.R252C|EGFR_uc003tqj.2_Missense_Mutation_p.R252C|EGFR_uc010kzg.1_Missense_Mutation_p.R207C|EGFR_uc011kco.1_Missense_Mutation_p.R199C|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	252	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.R252C(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	ATAGGTCTGCCGCAAATTCCG	0.582		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			873	47	---	---	---	---	capture	Missense_Mutation	SNP	55221710	55221710	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4922	86
CCDC146	57639	broad.mit.edu	37	7	76922321	76922321	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76922321T>C	uc003uga.2	+	18	2595	c.2468T>C	c.(2467-2469)CTT>CCT	p.L823P	CCDC146_uc010ldp.2_Missense_Mutation_p.L537P|CCDC146_uc003ugc.2_Missense_Mutation_p.L160P	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	823	Potential.									ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				ATGATGGCTCTTGTTGCTGAG	0.398													54	110	---	---	---	---	capture	Missense_Mutation	SNP	76922321	76922321	CCDC146	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	2754	86
PCLO	27445	broad.mit.edu	37	7	82387898	82387898	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82387898G>A	uc003uhx.2	-	25	15711	c.15422C>T	c.(15421-15423)ACG>ATG	p.T5141M		NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	5064					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TCTTCAATGCGTTTGAGTAGG	0.378													160	447	---	---	---	---	capture	Missense_Mutation	SNP	82387898	82387898	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11486	86
SLC26A3	1811	broad.mit.edu	37	7	107427951	107427951	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107427951G>C	uc003ver.2	-	7	950	c.739C>G	c.(739-741)CTA>GTA	p.L247V	SLC26A3_uc003ves.2_Missense_Mutation_p.L212V	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	247					excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						ACAGAGTATAGTACCTACAAT	0.323													42	129	---	---	---	---	capture	Missense_Mutation	SNP	107427951	107427951	SLC26A3	7	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	14410	86
KEL	3792	broad.mit.edu	37	7	142649696	142649696	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142649696C>A	uc003wcb.2	-	10	1313	c.1103G>T	c.(1102-1104)GGG>GTG	p.G368V		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	368	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					CACCACCAGCCCTAAGATCAT	0.537													42	74	---	---	---	---	capture	Missense_Mutation	SNP	142649696	142649696	KEL	7	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	8064	86
KCNH2	3757	broad.mit.edu	37	7	150649545	150649545	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150649545C>T	uc003wic.2	-	6	1538	c.1525G>A	c.(1525-1527)GAC>AAC	p.D509N	KCNH2_uc003wib.2_Missense_Mutation_p.D169N|KCNH2_uc011kux.1_Missense_Mutation_p.D413N|KCNH2_uc003wid.2_Missense_Mutation_p.D169N|KCNH2_uc003wie.2_Missense_Mutation_p.D509N	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	509	Helical; Name=Segment S3; (Potential).				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)	ATGAGCAGGTCGAAGGGGATG	0.632													22	38	---	---	---	---	capture	Missense_Mutation	SNP	150649545	150649545	KCNH2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7954	86
CYP7B1	9420	broad.mit.edu	37	8	65517309	65517309	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:65517309C>T	uc003xvj.2	-	5	1367	c.1163G>A	c.(1162-1164)CGA>CAA	p.R388Q		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	388					bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				GTCTCCCTTTCGCACACAGTA	0.453													50	55	---	---	---	---	capture	Missense_Mutation	SNP	65517309	65517309	CYP7B1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4157	86
RIMS2	9699	broad.mit.edu	37	8	104922392	104922392	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104922392C>T	uc003yls.2	+	3	1230	c.989C>T	c.(988-990)ACG>ATG	p.T330M	RIMS2_uc003ylp.2_Missense_Mutation_p.T552M|RIMS2_uc003ylw.2_Missense_Mutation_p.T360M|RIMS2_uc003ylq.2_Missense_Mutation_p.T360M|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_5'Flank	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTGGATCATACGTCTTGGCAT	0.388										HNSCC(12;0.0054)			70	111	---	---	---	---	capture	Missense_Mutation	SNP	104922392	104922392	RIMS2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13260	86
CSMD3	114788	broad.mit.edu	37	8	113988286	113988286	+	Silent	SNP	A	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113988286A>T	uc003ynu.2	-	7	1281	c.1122T>A	c.(1120-1122)CCT>CCA	p.P374P	CSMD3_uc003ynt.2_Silent_p.P334P|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	374	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TAACATCTGCAGGTGTGCTAG	0.493										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			70	83	---	---	---	---	capture	Silent	SNP	113988286	113988286	CSMD3	8	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	3911	86
COL14A1	7373	broad.mit.edu	37	8	121326264	121326264	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121326264C>T	uc003yox.2	+	38	4814	c.4549C>T	c.(4549-4551)CCC>TCC	p.P1517S	COL14A1_uc003yoz.2_Missense_Mutation_p.P482S	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	1517	Triple-helical region 1 (COL2).				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TCAAGGAATGCCCGTGAGTTG	0.468													4	222	---	---	---	---	capture	Missense_Mutation	SNP	121326264	121326264	COL14A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3636	86
CXorf23	256643	broad.mit.edu	37	X	19968952	19968952	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:19968952C>T	uc004czp.2	-	7	1664	c.1664G>A	c.(1663-1665)CGA>CAA	p.R555Q	CXorf23_uc010nfn.2_RNA|CXorf23_uc011mjg.1_Missense_Mutation_p.R120Q|CXorf23_uc004czo.2_Missense_Mutation_p.R505Q	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643	555						mitochondrion				lung(1)|skin(1)	2						AATGTCATGTCGTAGGTCATT	0.368													73	121	---	---	---	---	capture	Missense_Mutation	SNP	19968952	19968952	CXorf23	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4063	86
OPHN1	4983	broad.mit.edu	37	X	67421527	67421527	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:67421527T>C	uc004dww.3	-	11	1253	c.959A>G	c.(958-960)TAC>TGC	p.Y320C	OPHN1_uc011mpg.1_Missense_Mutation_p.Y320C	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1	320	PH.				axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						TCTCACACAGTACTTCAGTGT	0.418													101	131	---	---	---	---	capture	Missense_Mutation	SNP	67421527	67421527	OPHN1	23	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10779	86
LPAR4	2846	broad.mit.edu	37	X	78011289	78011289	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78011289C>A	uc010nme.2	+	2	1328	c.923C>A	c.(922-924)CCT>CAT	p.P308H		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	308	Helical; Name=7; (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3						TGTTTTGACCCTTTCATCTAT	0.418													85	145	---	---	---	---	capture	Missense_Mutation	SNP	78011289	78011289	LPAR4	23	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	8823	86
POF1B	79983	broad.mit.edu	37	X	84634326	84634326	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84634326T>C	uc004eer.2	-	2	280	c.134A>G	c.(133-135)AAA>AGA	p.K45R	POF1B_uc004ees.2_Missense_Mutation_p.K45R	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	45							actin binding				0						CACTACATTTTTTTCTGGAGG	0.577													17	32	---	---	---	---	capture	Missense_Mutation	SNP	84634326	84634326	POF1B	23	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	12085	86
GUCY2F	2986	broad.mit.edu	37	X	108673542	108673542	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:108673542G>A	uc004eod.3	-	8	2061	c.1785C>T	c.(1783-1785)TTC>TTT	p.F595F	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	595	Protein kinase.|Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						ATACCATTTCGAACACATCAC	0.388													187	305	---	---	---	---	capture	Silent	SNP	108673542	108673542	GUCY2F	23	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	6827	86
LAMP2	3920	broad.mit.edu	37	X	119565295	119565295	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119565295G>A	uc004est.3	-	9	1296	c.1116C>T	c.(1114-1116)GAC>GAT	p.D372D	LAMP2_uc004ess.3_Intron|LAMP2_uc011mtz.1_Intron	NM_002294	NP_002285	P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2 isoform	372	Lumenal (Potential).|Second lumenal domain.				platelet activation|platelet degranulation	endosome membrane|integral to membrane|late endosome|lysosomal membrane|membrane fraction|plasma membrane|platelet dense granule membrane				ovary(1)	1						GGAAGTTGTCGTCATCTGCAC	0.438													123	167	---	---	---	---	capture	Silent	SNP	119565295	119565295	LAMP2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8538	86
GRIA3	2892	broad.mit.edu	37	X	122532507	122532507	+	Silent	SNP	C	T	T	rs148850386	byFrequency	TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122532507C>T	uc004etq.3	+	8	1226	c.933C>T	c.(931-933)CAC>CAT	p.H311H	GRIA3_uc004etr.3_Silent_p.H311H|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Silent_p.H295H	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	311	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	CATTGACACACGACGCAATAC	0.423													24	46	---	---	---	---	capture	Silent	SNP	122532507	122532507	GRIA3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6702	86
SMARCA1	6594	broad.mit.edu	37	X	128657225	128657225	+	Silent	SNP	G	A	A			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:128657225G>A	uc004eun.3	-	1	236	c.123C>T	c.(121-123)GCC>GCT	p.A41A	SMARCA1_uc004eup.3_Silent_p.A41A|SMARCA1_uc011muk.1_Silent_p.A41A|SMARCA1_uc011mul.1_Silent_p.A41A	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	41					ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						CGGTGGCCGCGGCGGCCGCTC	0.667													19	38	---	---	---	---	capture	Silent	SNP	128657225	128657225	SMARCA1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14660	86
MAGEC1	9947	broad.mit.edu	37	X	140995644	140995644	+	Silent	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140995644C>T	uc004fbt.2	+	4	2740	c.2454C>T	c.(2452-2454)CCC>CCT	p.P818P	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	818							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					GCTCCTTCCCCTCCTCCACTT	0.557										HNSCC(15;0.026)			179	286	---	---	---	---	capture	Silent	SNP	140995644	140995644	MAGEC1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	9094	86
AFF2	2334	broad.mit.edu	37	X	148035181	148035181	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148035181C>T	uc004fcp.2	+	10	1948	c.1469C>T	c.(1468-1470)TCG>TTG	p.S490L	AFF2_uc004fcq.2_Missense_Mutation_p.S480L|AFF2_uc004fcr.2_Missense_Mutation_p.S451L|AFF2_uc011mxb.1_Missense_Mutation_p.S455L|AFF2_uc004fcs.2_Missense_Mutation_p.S457L|AFF2_uc011mxc.1_Missense_Mutation_p.S131L	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	490					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGCGAATCGGAGAGCAGC	0.557													81	126	---	---	---	---	capture	Missense_Mutation	SNP	148035181	148035181	AFF2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	357	86
RPL10L	140801	broad.mit.edu	37	14	47120841	47120841	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:47120841delG	uc001wwg.2	-	1	188	c.99delC	c.(97-99)ATCfs	p.I33fs		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	33					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						CCAGGTCAAAGATGCGGATCT	0.537													65	92	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	47120841	47120841	RPL10L	14	G	-	-	-	1	0	1	0	1	0	0	0	0	421	33	5	5	13448	86
ZNF280C	55609	broad.mit.edu	37	X	129370597	129370598	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-06-2563-01	TCGA-06-2563-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129370597_129370598delTG	uc004evm.2	-	7	663_664	c.509_510delCA	c.(508-510)TCAfs	p.S170fs	ZNF280C_uc010nrf.1_Frame_Shift_Del_p.S170fs	NM_017666	NP_060136	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	170	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)	3						TCAACACATATGAAGTATTTTT	0.312													46	49	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	129370597	129370598	ZNF280C	23	TG	-	-	-	1	0	1	0	1	0	0	0	0	652	51	5	5	17696	86
