Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TRIM62	55223	broad.mit.edu	37	1	33625475	33625475	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33625475C>T	uc001bxb.2	-	3	1213	c.575G>A	c.(574-576)CGC>CAC	p.R192H		NM_018207	NP_060677	Q9BVG3	TRI62_HUMAN	tripartite motif-containing 62	192	Potential.					intracellular	zinc ion binding				0		Myeloproliferative disorder(586;0.0393)				GGCCTTCTGGCGTTCACGCAG	0.652													42	71	---	---	---	---	capture	Missense_Mutation	SNP	33625475	33625475	TRIM62	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16420	92
TIE1	7075	broad.mit.edu	37	1	43779028	43779028	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43779028G>A	uc001ciu.2	+	13	2229	c.2150G>A	c.(2149-2151)CGC>CAC	p.R717H	TIE1_uc010okd.1_Missense_Mutation_p.R717H|TIE1_uc010oke.1_Missense_Mutation_p.R672H|TIE1_uc009vwq.2_Missense_Mutation_p.R673H|TIE1_uc010okf.1_Missense_Mutation_p.R362H|TIE1_uc010okg.1_Missense_Mutation_p.R362H	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	717	Fibronectin type-III 3.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TACCTCTTCCGCATGCGGGCC	0.657													6	179	---	---	---	---	capture	Missense_Mutation	SNP	43779028	43779028	TIE1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15778	92
FLG2	388698	broad.mit.edu	37	1	152325024	152325024	+	Silent	SNP	T	C	C			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152325024T>C	uc001ezw.3	-	3	5311	c.5238A>G	c.(5236-5238)GGA>GGG	p.G1746G	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1746							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGAGTGTGTCCTGAATGTG	0.502													18	343	---	---	---	---	capture	Silent	SNP	152325024	152325024	FLG2	1	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	5868	92
F5	2153	broad.mit.edu	37	1	169484809	169484809	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169484809G>A	uc001ggg.1	-	24	6546	c.6401C>T	c.(6400-6402)ACG>ATG	p.T2134M		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	2134	F5/8 type C 2.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TATAATTGCCGTTATCTTCTT	0.388													4	106	---	---	---	---	capture	Missense_Mutation	SNP	169484809	169484809	F5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5302	92
SELE	6401	broad.mit.edu	37	1	169698774	169698774	+	Silent	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169698774G>A	uc001ggm.3	-	6	913	c.756C>T	c.(754-756)TTC>TTT	p.F252F	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	252	Sushi 2.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					AACATTCCACGAACCCATTGG	0.428													53	67	---	---	---	---	capture	Silent	SNP	169698774	169698774	SELE	1	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	13906	92
TTC18	118491	broad.mit.edu	37	10	75051125	75051125	+	Missense_Mutation	SNP	G	A	A	rs141991496		TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75051125G>A	uc009xrc.2	-	20	2429	c.2308C>T	c.(2308-2310)CGG>TGG	p.R770W	TTC18_uc001jty.2_Missense_Mutation_p.R770W|TTC18_uc001jtv.3_Translation_Start_Site|TTC18_uc001jtw.3_Translation_Start_Site|TTC18_uc001jtx.2_Missense_Mutation_p.R151W	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18	770							binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					TGAAGCATCCGTGCCTGAAGC	0.423													39	16	---	---	---	---	capture	Missense_Mutation	SNP	75051125	75051125	TTC18	10	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	16567	92
MMP21	118856	broad.mit.edu	37	10	127462500	127462500	+	Silent	SNP	C	T	T	rs138636566		TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:127462500C>T	uc001liu.2	-	2	597	c.597G>A	c.(595-597)GCG>GCA	p.A199A		NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein	199					proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGAAGGCCAGCGCCACAATGC	0.701													25	3	---	---	---	---	capture	Silent	SNP	127462500	127462500	MMP21	10	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9572	92
CNGA4	1262	broad.mit.edu	37	11	6261559	6261559	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6261559G>A	uc001mco.2	+	4	642	c.535G>A	c.(535-537)GTC>ATC	p.V179I	CNGA4_uc010raa.1_Intron|CNGA4_uc001mcn.2_Missense_Mutation_p.V139I	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	179	Helical; Name=H4; (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATTTTTGTCGTCATCCATTG	0.597													57	99	---	---	---	---	capture	Missense_Mutation	SNP	6261559	6261559	CNGA4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3564	92
RAG2	5897	broad.mit.edu	37	11	36614338	36614338	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36614338G>T	uc001mwv.3	-	2	1569	c.1381C>A	c.(1381-1383)CTG>ATG	p.L461M	RAG1_uc001mwt.2_Intron|C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2	461	PHD-type; atypical.				chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			skin(3)|ovary(1)|pancreas(1)	5	all_lung(20;0.226)	all_hematologic(20;0.00756)				CGTTCTGCCAGATCCATGCAC	0.498									Familial_Hemophagocytic_Lymphohistiocytosis				45	77	---	---	---	---	capture	Missense_Mutation	SNP	36614338	36614338	RAG2	11	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	12900	92
ACCS	84680	broad.mit.edu	37	11	44105037	44105037	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:44105037G>A	uc009yks.1	+	14	1462	c.1318G>A	c.(1318-1320)GTG>ATG	p.V440M	EXT2_uc010rfo.1_Intron|ACCS_uc001mxx.2_Missense_Mutation_p.V440M	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase	440							1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4						GGACAACAAGGTGCTGCTGTC	0.572													25	31	---	---	---	---	capture	Missense_Mutation	SNP	44105037	44105037	ACCS	11	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	133	92
OR5L2	26338	broad.mit.edu	37	11	55594870	55594870	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55594870T>A	uc001nhy.1	+	1	176	c.176T>A	c.(175-177)GTG>GAG	p.V59E		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				CACACCCCCGTGTACTTTTTC	0.468										HNSCC(27;0.073)			106	126	---	---	---	---	capture	Missense_Mutation	SNP	55594870	55594870	OR5L2	11	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	11075	92
SLC22A9	114571	broad.mit.edu	37	11	63174115	63174115	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63174115G>A	uc001nww.2	+	7	1488	c.1220G>A	c.(1219-1221)CGA>CAA	p.R407Q	SLC22A9_uc001nwx.2_RNA	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	407	Cytoplasmic (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						ATGAACCGTCGAGCAAGCCAG	0.483													30	38	---	---	---	---	capture	Missense_Mutation	SNP	63174115	63174115	SLC22A9	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14353	92
STYK1	55359	broad.mit.edu	37	12	10772903	10772903	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10772903C>T	uc001qys.2	-	11	1630	c.1109G>A	c.(1108-1110)CGC>CAC	p.R370H		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	370	Protein kinase.					integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						AGGTGAGGGGCGGTCAGCCTC	0.527										HNSCC(73;0.22)			103	192	---	---	---	---	capture	Missense_Mutation	SNP	10772903	10772903	STYK1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15249	92
TMEM5	10329	broad.mit.edu	37	12	64202634	64202634	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:64202634C>T	uc001srq.1	+	6	1198	c.1094C>T	c.(1093-1095)ACA>ATA	p.T365I	TMEM5_uc001srr.1_Missense_Mutation_p.T262I|TMEM5_uc001srs.1_Missense_Mutation_p.T105I	NM_014254	NP_055069	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	365	Extracellular (Potential).					integral to plasma membrane					0		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		TGTGGGAATACATCTGTGCAC	0.478													55	77	---	---	---	---	capture	Missense_Mutation	SNP	64202634	64202634	TMEM5	12	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16057	92
OAS2	4939	broad.mit.edu	37	12	113447011	113447011	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113447011G>T	uc001tuj.2	+	10	2155	c.2015G>T	c.(2014-2016)GGG>GTG	p.G672V	OAS2_uc001tui.1_Missense_Mutation_p.G672V	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	672	OAS domain 2.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						TTCAAGGATGGGACTGGAAAC	0.502													27	350	---	---	---	---	capture	Missense_Mutation	SNP	113447011	113447011	OAS2	12	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	10705	92
FREM2	341640	broad.mit.edu	37	13	39422735	39422735	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:39422735C>T	uc001uwv.2	+	8	6616	c.6307C>T	c.(6307-6309)CGC>TGC	p.R2103C	FREM2_uc001uww.2_Missense_Mutation_p.R189C	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2103	Extracellular (Potential).|Calx-beta 3.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACTGGTGCTTCGCATGCCTAT	0.463													29	31	---	---	---	---	capture	Missense_Mutation	SNP	39422735	39422735	FREM2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5988	92
MED4	29079	broad.mit.edu	37	13	48669208	48669208	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48669208C>T	uc001vby.1	-	1	33	c.7G>A	c.(7-9)GCG>ACG	p.A3T	MED4_uc010tge.1_Missense_Mutation_p.A3T|MED4_uc010tgf.1_5'UTR	NM_014166	NP_054885	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4	3					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		CTCGAAGACGCAGCCATTTTC	0.662											OREG0022406	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	43	---	---	---	---	capture	Missense_Mutation	SNP	48669208	48669208	MED4	13	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	9363	92
ABCC4	10257	broad.mit.edu	37	13	95715015	95715015	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:95715015G>C	uc001vmd.3	-	26	3428	c.3309C>G	c.(3307-3309)ATC>ATG	p.I1103M	ABCC4_uc010afj.2_Translation_Start_Site|ABCC4_uc010afk.2_Missense_Mutation_p.I1056M	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	1103	ABC transporter 2.				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	CAGTTGTCAAGATCTTATCAA	0.423													5	133	---	---	---	---	capture	Missense_Mutation	SNP	95715015	95715015	ABCC4	13	G	C	C	C	1	0	0	0	0	1	0	0	0	421	33	4	4	55	92
RTN1	6252	broad.mit.edu	37	14	60212584	60212584	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60212584G>A	uc001xen.1	-	2	1066	c.857C>T	c.(856-858)ACG>ATG	p.T286M		NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	286					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TTCTATTTCCGTCAGTGTGAT	0.458													12	64	---	---	---	---	capture	Missense_Mutation	SNP	60212584	60212584	RTN1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13617	92
C14orf68	283600	broad.mit.edu	37	14	100795869	100795869	+	Missense_Mutation	SNP	C	T	T	rs145556108	byFrequency	TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100795869C>T	uc001yhc.2	+	6	887	c.814C>T	c.(814-816)CGG>TGG	p.R272W	C14orf68_uc001yhd.2_Missense_Mutation_p.R126W	NM_207117	NP_997000	Q6Q0C1	S2547_HUMAN	chromosome 14 open reading frame 68	272	Solcar 3.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0		Melanoma(154;0.152)				GGAGGGACCCCGGGTCCTTTT	0.637													16	162	---	---	---	---	capture	Missense_Mutation	SNP	100795869	100795869	C14orf68	14	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	1764	92
AHNAK2	113146	broad.mit.edu	37	14	105417146	105417146	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105417146C>T	uc010axc.1	-	7	4762	c.4642G>A	c.(4642-4644)GCT>ACT	p.A1548T	AHNAK2_uc001ypx.2_Missense_Mutation_p.A1448T	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1548						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCAGGTCAGCAGAAGGGGGC	0.642													15	170	---	---	---	---	capture	Missense_Mutation	SNP	105417146	105417146	AHNAK2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	415	92
CYP11A1	1583	broad.mit.edu	37	15	74635350	74635350	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74635350C>T	uc002axt.2	-	5	1113	c.958G>A	c.(958-960)GTC>ATC	p.V320I	CYP11A1_uc002axs.2_Missense_Mutation_p.V162I|CYP11A1_uc010bjm.1_Missense_Mutation_p.V162I|CYP11A1_uc010bjn.1_RNA|CYP11A1_uc010bjo.1_Missense_Mutation_p.V320I|CYP11A1_uc010bjp.1_Intron|CYP11A1_uc010ulj.1_Missense_Mutation_p.V100I	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,	320					C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	ATCTCTGTGACGTTGGCCTTG	0.602													56	65	---	---	---	---	capture	Missense_Mutation	SNP	74635350	74635350	CYP11A1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4104	92
WDR90	197335	broad.mit.edu	37	16	703407	703407	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:703407G>A	uc002cii.1	+	11	1243	c.1189G>A	c.(1189-1191)GTG>ATG	p.V397M	WDR90_uc002cig.1_Missense_Mutation_p.V397M|WDR90_uc002cih.1_Missense_Mutation_p.V398M|WDR90_uc002cij.1_RNA|WDR90_uc002cik.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	397										ovary(1)	1		Hepatocellular(780;0.0218)				CGTCCTGCTCGTGGACACGGG	0.701													24	31	---	---	---	---	capture	Missense_Mutation	SNP	703407	703407	WDR90	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17218	92
TMEM186	25880	broad.mit.edu	37	16	8890029	8890029	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:8890029C>T	uc002cze.2	-	2	456	c.422G>A	c.(421-423)CGG>CAG	p.R141Q	PMM2_uc002czf.3_5'Flank|PMM2_uc010uyf.1_5'Flank|PMM2_uc010uyg.1_5'Flank|PMM2_uc010uyh.1_5'Flank|PMM2_uc010buj.2_5'Flank|PMM2_uc010uyi.1_5'Flank|PMM2_uc010uye.1_5'Flank	NM_015421	NP_056236	Q96B77	TM186_HUMAN	transmembrane protein 186	141						integral to membrane|mitochondrion				ovary(1)	1						ATGGGCCACCCGCAGCATGGT	0.557													40	53	---	---	---	---	capture	Missense_Mutation	SNP	8890029	8890029	TMEM186	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15991	92
MMP2	4313	broad.mit.edu	37	16	55525753	55525753	+	Silent	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:55525753C>T	uc002ehz.3	+	8	1532	c.1221C>T	c.(1219-1221)CAC>CAT	p.H407H	MMP2_uc010vhd.1_Silent_p.H331H|MMP2_uc010ccc.2_Silent_p.H357H|MMP2_uc002eia.3_5'Flank	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a	407	Collagenase-like 2.	Zinc 2; catalytic (By similarity).			angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	AGTTTGGCCACGCCATGGGGC	0.577													14	88	---	---	---	---	capture	Silent	SNP	55525753	55525753	MMP2	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9570	92
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	T	T	rs28934576	by1000genomes	TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577120C>T	uc002gim.2	-	8	1012	c.818G>A	c.(817-819)CGT>CAT	p.R273H	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141H|TP53_uc010cng.1_Missense_Mutation_p.R141H|TP53_uc002gii.1_Missense_Mutation_p.R141H|TP53_uc010cnh.1_Missense_Mutation_p.R273H|TP53_uc010cni.1_Missense_Mutation_p.R273H|TP53_uc002gij.2_Missense_Mutation_p.R273H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACAAACACGCACCTCAAA	0.542	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			5	25	---	---	---	---	capture	Missense_Mutation	SNP	7577120	7577120	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16264	92
GAS7	8522	broad.mit.edu	37	17	9822945	9822945	+	Silent	SNP	A	G	G			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9822945A>G	uc002gmg.1	-	12	1377	c.1216T>C	c.(1216-1218)TTG>CTG	p.L406L	GAS7_uc010vvc.1_Silent_p.L220L|GAS7_uc002gmh.1_Silent_p.L266L|GAS7_uc010vvd.1_Silent_p.L358L|GAS7_uc002gmi.2_Silent_p.L342L|GAS7_uc002gmj.1_Silent_p.L346L|GAS7_uc010coh.1_Silent_p.L346L	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	406	Potential.				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						CCGCTTACCAATGTGGTGGTC	0.567			T	MLL	AML*								30	56	---	---	---	---	capture	Silent	SNP	9822945	9822945	GAS7	17	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	6190	92
NF1	4763	broad.mit.edu	37	17	29587504	29587504	+	Silent	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29587504G>A	uc002hgg.2	+	34	4881	c.4548G>A	c.(4546-4548)GAG>GAA	p.E1516E	NF1_uc002hgh.2_Silent_p.E1495E|NF1_uc002hgi.1_Silent_p.E528E	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1516					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(3)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACAATCAGGAGAAAATTGGGC	0.388			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			16	165	---	---	---	---	capture	Silent	SNP	29587504	29587504	NF1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	10263	92
KRT9	3857	broad.mit.edu	37	17	39724810	39724810	+	Missense_Mutation	SNP	G	A	A	rs116216460	byFrequency;by1000genomes	TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39724810G>A	uc002hxe.3	-	5	1186	c.1120C>T	c.(1120-1122)CGG>TGG	p.R374W	JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9	374	Rod.|Coil 2.				intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				ACACCGTGCCGGAGCTGGGTC	0.547													201	267	---	---	---	---	capture	Missense_Mutation	SNP	39724810	39724810	KRT9	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	8421	92
MUC16	94025	broad.mit.edu	37	19	9088857	9088857	+	Silent	SNP	T	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9088857T>A	uc002mkp.2	-	1	3162	c.2958A>T	c.(2956-2958)TCA>TCT	p.S986S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	986	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGGCAGAGGTTGAAACAGTGG	0.463													16	345	---	---	---	---	capture	Silent	SNP	9088857	9088857	MUC16	19	T	A	A	A	1	0	0	0	0	0	0	0	1	808	63	4	4	9883	92
CYP4F12	66002	broad.mit.edu	37	19	15791225	15791225	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15791225G>A	uc002nbl.2	+	5	482	c.421G>A	c.(421-423)GGT>AGT	p.G141S	CYP4F12_uc010xoo.1_Missense_Mutation_p.G141S|CYP4F12_uc010xop.1_Missense_Mutation_p.R172Q	NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					GCTGAGTGGCGGTGACAAGTG	0.552													18	32	---	---	---	---	capture	Missense_Mutation	SNP	15791225	15791225	CYP4F12	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4147	92
CAD	790	broad.mit.edu	37	2	27459352	27459352	+	Silent	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27459352C>T	uc002rji.2	+	26	4437	c.4275C>T	c.(4273-4275)CCC>CCT	p.P1425P	CAD_uc010eyw.2_Silent_p.P1362P	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1425	CPSase B.|CPSase (Carbamoyl-phosphate synthase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TCTCCGTGCCCCTAATCATCG	0.557													41	53	---	---	---	---	capture	Silent	SNP	27459352	27459352	CAD	2	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	2541	92
STRN	6801	broad.mit.edu	37	2	37078198	37078198	+	Silent	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37078198C>T	uc002rpn.2	-	16	2040	c.2031G>A	c.(2029-2031)CCG>CCA	p.P677P	STRN_uc010ezx.2_Silent_p.P640P	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	677	WD 4.			P -> S (in Ref. 1; CAA11560).	dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				TGATGCTGATCGGAAGAGTAG	0.303													8	132	---	---	---	---	capture	Silent	SNP	37078198	37078198	STRN	2	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	15219	92
XIRP2	129446	broad.mit.edu	37	2	167760222	167760222	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167760222A>G	uc002udx.2	+	1	248	c.230A>G	c.(229-231)GAG>GGG	p.E77G	XIRP2_uc010fpn.2_Missense_Mutation_p.E77G|XIRP2_uc010fpo.2_Missense_Mutation_p.E77G|XIRP2_uc010fpp.2_Missense_Mutation_p.E77G	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AAGCCGGAAGAGAAGGATTCT	0.522													16	27	---	---	---	---	capture	Missense_Mutation	SNP	167760222	167760222	XIRP2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	17311	92
TRAK2	66008	broad.mit.edu	37	2	202252532	202252532	+	Silent	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202252532G>A	uc002uyb.3	-	13	2036	c.1590C>T	c.(1588-1590)AGC>AGT	p.S530S		NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	530				Missing (in Ref. 2).		early endosome|plasma membrane	GABA receptor binding				0						GAGAGGCAAGGCTCTCTGTCG	0.512													6	139	---	---	---	---	capture	Silent	SNP	202252532	202252532	TRAK2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	16333	92
CXCR2	3579	broad.mit.edu	37	2	218999840	218999840	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:218999840G>A	uc002vgz.1	+	4	541	c.316G>A	c.(316-318)GCC>ACC	p.A106T	CXCR2_uc002vha.1_Missense_Mutation_p.A106T|CXCR2_uc002vhb.1_Missense_Mutation_p.A106T	NM_001557	NP_001548	P25025	CXCR2_HUMAN	interleukin 8 receptor beta	106	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation	cell surface|integral to plasma membrane|mast cell granule	interleukin-8 receptor activity			lung(1)|breast(1)	2						CATCTGGGCCGCCTCCAAGGT	0.552													52	84	---	---	---	---	capture	Missense_Mutation	SNP	218999840	218999840	CXCR2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4051	92
SLC5A4	6527	broad.mit.edu	37	22	32634986	32634986	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32634986A>G	uc003ami.2	-	6	571	c.569T>C	c.(568-570)GTT>GCT	p.V190A		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	190	Helical; (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						GGTGGTGTAAACAGCAGTCAT	0.448													4	26	---	---	---	---	capture	Missense_Mutation	SNP	32634986	32634986	SLC5A4	22	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	14559	92
DNAJB7	150353	broad.mit.edu	37	22	41257669	41257669	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41257669G>T	uc003azj.2	-	1	462	c.330C>A	c.(328-330)CAC>CAA	p.H110Q	XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azh.2_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_5'Flank|XPNPEP3_uc003azg.1_RNA|XPNPEP3_uc003azf.1_RNA|XPNPEP3_uc010gyh.1_5'Flank	NM_145174	NP_660157	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	110					protein folding		heat shock protein binding|unfolded protein binding	p.H110Q(1)		ovary(1)	1						CTTCAAAGAAGTGAAAAGAAA	0.388													74	16	---	---	---	---	capture	Missense_Mutation	SNP	41257669	41257669	DNAJB7	22	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	4581	92
SCN10A	6336	broad.mit.edu	37	3	38770174	38770174	+	Silent	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38770174G>A	uc003ciq.2	-	15	2499	c.2499C>T	c.(2497-2499)CAC>CAT	p.H833H		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	833	II.				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GGAAGAAGTCGTGCATGTGCC	0.512													30	33	---	---	---	---	capture	Silent	SNP	38770174	38770174	SCN10A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13805	92
CCR1	1230	broad.mit.edu	37	3	46245393	46245393	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46245393C>T	uc003cph.1	-	2	483	c.412G>A	c.(412-414)GCC>ACC	p.A138T	CCR3_uc003cpg.1_Intron	NM_001295	NP_001286	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	138	Cytoplasmic (Potential).				cell adhesion|cell-cell signaling|cytokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	integral to plasma membrane	C-C chemokine receptor activity			skin(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GCAAACACGGCGTGGACGATG	0.512													24	52	---	---	---	---	capture	Missense_Mutation	SNP	46245393	46245393	CCR1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2910	92
PRR23B	389151	broad.mit.edu	37	3	138739096	138739096	+	Silent	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138739096G>A	uc003esy.1	-	1	673	c.408C>T	c.(406-408)GTC>GTT	p.V136V		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	136										breast(1)	1						CCAGCTCGACGACGACGTCCT	0.652													51	51	---	---	---	---	capture	Silent	SNP	138739096	138739096	PRR23B	3	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	12490	92
MFSD7	84179	broad.mit.edu	37	4	680063	680063	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:680063G>A	uc003gay.2	-	3	380	c.323C>T	c.(322-324)GCC>GTC	p.A108V	MFSD7_uc003gaw.2_5'Flank|MFSD7_uc003gax.2_Missense_Mutation_p.A108V|MFSD7_uc003gaz.2_Intron|MFSD7_uc003gba.2_Intron|MFSD7_uc003gbb.1_Missense_Mutation_p.A44V	NM_032219	NP_115595	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing	108	Helical; (Potential).				transmembrane transport	integral to membrane					0						CACACTCCCGGCAAAGTTCAG	0.657													31	48	---	---	---	---	capture	Missense_Mutation	SNP	680063	680063	MFSD7	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9449	92
LPHN3	23284	broad.mit.edu	37	4	62598628	62598628	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:62598628A>G	uc010ihh.2	+	5	724	c.551A>G	c.(550-552)GAG>GGG	p.E184G	LPHN3_uc003hcq.3_Missense_Mutation_p.E184G|LPHN3_uc010ihg.1_Missense_Mutation_p.E252G|LPHN3_uc003hcs.1_Missense_Mutation_p.E13G	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	184	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						ACCCTGACTGAGTATTCATCC	0.493													17	25	---	---	---	---	capture	Missense_Mutation	SNP	62598628	62598628	LPHN3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	8833	92
NHEDC2	133308	broad.mit.edu	37	4	103947532	103947532	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:103947532C>G	uc003hwx.3	-	12	2481	c.1609G>C	c.(1609-1611)GTT>CTT	p.V537L	NHEDC2_uc010iln.1_Intron|NHEDC2_uc003hwy.2_Missense_Mutation_p.V537L|NHEDC2_uc011cew.1_Missense_Mutation_p.V480L|NHEDC2_uc011cex.1_3'UTR	NM_178833	NP_849155	Q86UD5	NHDC2_HUMAN	Na+/H+ exchanger domain containing 2	537					sodium ion transport	integral to membrane|mitochondrial membrane	solute:hydrogen antiporter activity				0				OV - Ovarian serous cystadenocarcinoma(123;2.3e-08)		CACCTCTAAACTTGCACAGAA	0.353													4	91	---	---	---	---	capture	Missense_Mutation	SNP	103947532	103947532	NHEDC2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	10308	92
CARD6	84674	broad.mit.edu	37	5	40852866	40852866	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40852866G>A	uc003jmg.2	+	3	1507	c.1432G>A	c.(1432-1434)GCC>ACC	p.A478T		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	478					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						TCTCAGCCCTGCCCAGTTGAA	0.433													10	84	---	---	---	---	capture	Missense_Mutation	SNP	40852866	40852866	CARD6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	2626	92
ATOX1	475	broad.mit.edu	37	5	151125916	151125916	+	Silent	SNP	T	C	C			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151125916T>C	uc003luk.2	-	3	275	c.177A>G	c.(175-177)GGA>GGG	p.G59G		NM_004045	NP_004036	O00244	ATOX1_HUMAN	antioxidant protein 1	59	HMA.				cellular copper ion homeostasis|copper ion transport|response to oxidative stress	cytosol	copper chaperone activity|copper-dependent protein binding				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			AAACAGTCTTTCCTGTTTTCT	0.542													8	73	---	---	---	---	capture	Silent	SNP	151125916	151125916	ATOX1	5	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	1106	92
MBOAT1	154141	broad.mit.edu	37	6	20118736	20118736	+	Missense_Mutation	SNP	T	C	C	rs150163538		TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:20118736T>C	uc003ncx.1	-	9	1148	c.943A>G	c.(943-945)AGC>GGC	p.S315G	MBOAT1_uc011dji.1_Missense_Mutation_p.S166G	NM_001080480	NP_001073949	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain	315	Helical; (Potential).				phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			TCCACTCCGCTGAACCCAAAG	0.393													48	39	---	---	---	---	capture	Missense_Mutation	SNP	20118736	20118736	MBOAT1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	9269	92
GRM4	2914	broad.mit.edu	37	6	34008523	34008523	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34008523G>A	uc003oir.3	-	6	1341	c.1171C>T	c.(1171-1173)CGT>TGT	p.R391C	GRM4_uc011dsn.1_Missense_Mutation_p.R344C|GRM4_uc010jvh.2_Missense_Mutation_p.R391C|GRM4_uc010jvi.2_Missense_Mutation_p.R83C|GRM4_uc003oio.2_Missense_Mutation_p.R83C|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.R251C|GRM4_uc003oiq.2_Missense_Mutation_p.R258C|GRM4_uc011dsm.1_Missense_Mutation_p.R222C	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	391	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	ATTCGCTCACGGTCTGCAATG	0.597													4	57	---	---	---	---	capture	Missense_Mutation	SNP	34008523	34008523	GRM4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6732	92
VEGFA	7422	broad.mit.edu	37	6	43752359	43752359	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43752359A>T	uc003owi.2	+	7	1601	c.1110A>T	c.(1108-1110)AAA>AAT	p.K370N	VEGFA_uc003owd.2_3'UTR|VEGFA_uc003owf.2_3'UTR|VEGFA_uc003owe.2_3'UTR|VEGFA_uc003owg.2_3'UTR|VEGFA_uc003owh.2_3'UTR|VEGFA_uc003owj.2_3'UTR|VEGFA_uc010jyx.2_3'UTR|VEGFA_uc003owk.2_RNA	NM_001033756	NP_001028928	P15692	VEGFA_HUMAN	vascular endothelial growth factor A isoform g	Error:Variant_position_missing_in_P15692_after_alignment					basophil chemotaxis|cellular response to hypoxia|induction of positive chemotaxis|induction of positive chemotaxis|platelet activation|platelet degranulation|platelet-derived growth factor receptor signaling pathway|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cell adhesion|positive regulation of cell division|positive regulation of endothelial cell proliferation|positive regulation of leukocyte migration|positive regulation of mast cell chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|positive regulation of vascular permeability|regulation of cell shape|vascular endothelial growth factor receptor signaling pathway|vasculogenesis	cell surface|extracellular space|membrane|platelet alpha granule lumen	cell surface binding|chemoattractant activity|cytokine activity|fibronectin binding|growth factor activity|heparin binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity|vascular endothelial growth factor receptor 1 binding|vascular endothelial growth factor receptor 2 binding|vascular endothelial growth factor receptor binding			ovary(1)|breast(1)	2	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Atorvastatin(DB01076)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Simvastatin(DB00641)	TCACCAGGAAAGACTGATACA	0.527													30	48	---	---	---	---	capture	Missense_Mutation	SNP	43752359	43752359	VEGFA	6	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	17032	92
ZNF92	168374	broad.mit.edu	37	7	64864755	64864755	+	Silent	SNP	C	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:64864755C>A	uc003ttz.2	+	4	1871	c.1728C>A	c.(1726-1728)TCC>TCA	p.S576S	ZNF92_uc003tua.2_Silent_p.S507S|ZNF92_uc010kzu.2_Silent_p.S544S|ZNF92_uc003tub.2_Silent_p.S500S	NM_152626	NP_689839	Q03936	ZNF92_HUMAN	zinc finger protein 92 isoform 2	576	C2H2-type 16; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(55;0.159)				TTAACAAATCCTCAAATTATA	0.348													34	32	---	---	---	---	capture	Silent	SNP	64864755	64864755	ZNF92	7	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	18077	92
MTERF	7978	broad.mit.edu	37	7	91503564	91503564	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91503564A>G	uc003ulb.1	-	2	588	c.544T>C	c.(544-546)TTC>CTC	p.F182L	MTERF_uc010let.1_Intron|MTERF_uc003ulc.1_Missense_Mutation_p.F182L|MTERF_uc011khm.1_Missense_Mutation_p.F162L|MTERF_uc010leu.1_Missense_Mutation_p.F162L	NM_006980	NP_008911	Q99551	MTERF_HUMAN	mitochondrial transcription termination factor	182					DNA geometric change|regulation of transcription, DNA-dependent|termination of mitochondrial transcription	mitochondrial nucleoid	double-stranded DNA binding				0	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			GAGTAGAGGAACTTTATATTA	0.378													85	105	---	---	---	---	capture	Missense_Mutation	SNP	91503564	91503564	MTERF	7	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	9828	92
CCDC132	55610	broad.mit.edu	37	7	92883220	92883220	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92883220C>G	uc003umo.2	+	4	401	c.273C>G	c.(271-273)GAC>GAG	p.D91E	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.D61E|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Intron|CCDC132_uc003umn.2_Missense_Mutation_p.D91E	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	91	Potential.										0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CGTATAGAGACAAATTGAAAC	0.323													15	53	---	---	---	---	capture	Missense_Mutation	SNP	92883220	92883220	CCDC132	7	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	2741	92
WNT2	7472	broad.mit.edu	37	7	116960744	116960744	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116960744G>A	uc003viz.2	-	2	487	c.187C>T	c.(187-189)CGT>TGT	p.R63C	WNT2_uc003vja.2_5'UTR	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	63					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CTAATGGCACGCATCACATCT	0.607													12	35	---	---	---	---	capture	Missense_Mutation	SNP	116960744	116960744	WNT2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17267	92
UBN2	254048	broad.mit.edu	37	7	138978177	138978177	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138978177C>T	uc011kqr.1	+	16	3869	c.3869C>T	c.(3868-3870)ACC>ATC	p.T1290I		NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2	1290										ovary(1)|skin(1)	2						TCGGGATCTACCTCAGCCGCT	0.502													36	74	---	---	---	---	capture	Missense_Mutation	SNP	138978177	138978177	UBN2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	16775	92
KEL	3792	broad.mit.edu	37	7	142651272	142651272	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142651272T>C	uc003wcb.2	-	8	1133	c.923A>G	c.(922-924)AAG>AGG	p.K308R		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	308	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					TCCAGGCACCTTGAGCTGGTC	0.547													23	37	---	---	---	---	capture	Missense_Mutation	SNP	142651272	142651272	KEL	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	8064	92
XKR4	114786	broad.mit.edu	37	8	56436491	56436491	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:56436491G>A	uc003xsf.2	+	3	1690	c.1658G>A	c.(1657-1659)CGC>CAC	p.R553H		NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related	553						integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			TCCAACAACCGCAGTGTTGTC	0.592													4	68	---	---	---	---	capture	Missense_Mutation	SNP	56436491	56436491	XKR4	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17314	92
JPH1	56704	broad.mit.edu	37	8	75171693	75171693	+	Silent	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:75171693C>T	uc003yae.2	-	3	1225	c.1185G>A	c.(1183-1185)GCG>GCA	p.A395A	JPH1_uc003yaf.2_Silent_p.A395A|JPH1_uc003yag.1_Silent_p.A259A	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	395	Ala-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GAGCGGCCAGCGCGGCCTGGT	0.592													17	18	---	---	---	---	capture	Silent	SNP	75171693	75171693	JPH1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7883	92
GEM	2669	broad.mit.edu	37	8	95262754	95262754	+	Silent	SNP	C	T	T			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95262754C>T	uc003ygj.2	-	5	924	c.675G>A	c.(673-675)CAG>CAA	p.Q225Q	GEM_uc003ygi.2_Silent_p.Q225Q	NM_005261	NP_005252	P55040	GEM_HUMAN	GTP-binding mitogen-induced T-cell protein	225					cell surface receptor linked signaling pathway|immune response|small GTPase mediated signal transduction	internal side of plasma membrane	calmodulin binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding			lung(1)	1	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			TCACGTTGTGCTGGACAGCTG	0.562													4	33	---	---	---	---	capture	Silent	SNP	95262754	95262754	GEM	8	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	6269	92
CNTNAP3	79937	broad.mit.edu	37	9	39103796	39103796	+	Silent	SNP	G	A	A	rs145100345	byFrequency;by1000genomes	TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:39103796G>A	uc004abi.2	-	16	2720	c.2481C>T	c.(2479-2481)TCC>TCT	p.S827S	CNTNAP3_uc004abj.2_Silent_p.S826S|CNTNAP3_uc011lqr.1_RNA|CNTNAP3_uc004abk.1_Silent_p.S827S	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	827	Extracellular (Potential).|Laminin G-like 3.				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TAAACACCCCGGAGGAAACTG	0.483													10	25	---	---	---	---	capture	Silent	SNP	39103796	39103796	CNTNAP3	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3613	92
MST4	51765	broad.mit.edu	37	X	131205232	131205232	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131205232G>A	uc004ewk.1	+	8	1220	c.919G>A	c.(919-921)GAG>AAG	p.E307K	MST4_uc004ewl.1_Missense_Mutation_p.E230K|MST4_uc011mux.1_Missense_Mutation_p.E329K|MST4_uc010nrj.1_Missense_Mutation_p.E307K|MST4_uc004ewm.1_Missense_Mutation_p.E245K	NM_016542	NP_057626	Q9P289	MST4_HUMAN	serine/threonine protein kinase MST4 isoform 1	307					cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(192;0.000127)					ATCTGATTCCGAGGGCTCTGA	0.348													95	90	---	---	---	---	capture	Missense_Mutation	SNP	131205232	131205232	MST4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9802	92
ZNHIT6	54680	broad.mit.edu	37	1	86173500	86173504	+	Frame_Shift_Del	DEL	CTTCT	-	-			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86173500_86173504delCTTCT	uc001dlh.2	-	1	598_602	c.464_468delAGAAG	c.(463-468)GAGAAGfs	p.E155fs	ZNHIT6_uc010osc.1_Frame_Shift_Del_p.E116fs	NM_017953	NP_060423	Q9NWK9	BCD1_HUMAN	zinc finger, HIT type 6	155_156	Glu-rich.				box C/D snoRNP assembly|ribosome biogenesis	pre-snoRNP complex	identical protein binding|metal ion binding			large_intestine(1)	1						CCAAGTTATCCTTCTCTTCCTTCAC	0.410													7	319	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	86173500	86173504	ZNHIT6	1	CTTCT	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	18085	92
ATP10A	57194	broad.mit.edu	37	15	25966826	25966827	+	Frame_Shift_Ins	INS	-	AC	AC			TCGA-06-5408-01	TCGA-06-5408-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:25966826_25966827insAC	uc010ayu.2	-	7	1446_1447	c.1340_1341insGT	c.(1339-1341)GTAfs	p.V447fs		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	447	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GAGAATATTCTACACCAGACAC	0.446													83	108	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	25966826	25966827	ATP10A	15	-	AC	AC	AC	1	0	1	1	0	0	0	0	0	678	53	5	5	1107	92
