Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SPTA1	6708	broad.mit.edu	37	1	158592861	158592861	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158592861G>A	uc001fst.1	-	43	6231	c.6032C>T	c.(6031-6033)GCC>GTC	p.A2011V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2011	Spectrin 19.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CAGCAGAGCGGCATAACGCTC	0.483													6	489	---	---	---	---	capture	Missense_Mutation	SNP	158592861	158592861	SPTA1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15008	93
C1orf112	55732	broad.mit.edu	37	1	169772375	169772375	+	Silent	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169772375C>T	uc001ggp.2	+	6	547	c.237C>T	c.(235-237)TCC>TCT	p.S79S	C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggo.2_Silent_p.S79S|C1orf112_uc001ggq.2_Silent_p.S79S|C1orf112_uc009wvt.2_5'UTR|C1orf112_uc010plu.1_Silent_p.S50S|C1orf112_uc009wvu.1_Silent_p.S50S|C1orf112_uc001ggr.2_5'UTR|C1orf112_uc010plv.1_Silent_p.S21S	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732	79											0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CACAGGAATCCATCATTTTGG	0.363													6	57	---	---	---	---	capture	Silent	SNP	169772375	169772375	C1orf112	1	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	1967	93
DLG5	9231	broad.mit.edu	37	10	79566617	79566617	+	Silent	SNP	C	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:79566617C>A	uc001jzk.2	-	26	4936	c.4866G>T	c.(4864-4866)GTG>GTT	p.V1622V	DLG5_uc001jzi.2_Silent_p.V377V|DLG5_uc001jzj.2_Silent_p.V1037V|DLG5_uc009xru.1_RNA	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	1622	SH3.				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			AGGTGTCATCCACGTAGAGGA	0.572													4	158	---	---	---	---	capture	Silent	SNP	79566617	79566617	DLG5	10	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	4516	93
OR8H2	390151	broad.mit.edu	37	11	55873242	55873242	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55873242G>A	uc010riy.1	+	1	724	c.724G>A	c.(724-726)GTC>ATC	p.V242I		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	242	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					CTCTACTTGCGTCTCTCATCT	0.383										HNSCC(53;0.14)			11	124	---	---	---	---	capture	Missense_Mutation	SNP	55873242	55873242	OR8H2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11142	93
GLYATL2	219970	broad.mit.edu	37	11	58602091	58602091	+	Silent	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58602091G>A	uc001nnd.3	-	6	827	c.696C>T	c.(694-696)TAC>TAT	p.Y232Y	GLYATL2_uc009ymq.2_Silent_p.Y232Y	NM_145016	NP_659453	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	232						mitochondrion	glycine N-acyltransferase activity			ovary(1)|skin(1)	2		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	CTTGGTGTCTGTATTTGGGGA	0.413													12	93	---	---	---	---	capture	Silent	SNP	58602091	58602091	GLYATL2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	6417	93
CTTN	2017	broad.mit.edu	37	11	70279266	70279266	+	Silent	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:70279266G>A	uc001opv.3	+	16	1532	c.1326G>A	c.(1324-1326)CCG>CCA	p.P442P	CTTN_uc001opu.2_Silent_p.P405P|CTTN_uc001opw.3_Silent_p.P405P|CTTN_uc010rqm.1_Silent_p.P126P|CTTN_uc001opx.2_Silent_p.P126P	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	442						cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GGACGGAGCCGGAGCCCGTGT	0.652													3	109	---	---	---	---	capture	Silent	SNP	70279266	70279266	CTTN	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4005	93
DYNC2H1	79659	broad.mit.edu	37	11	103014114	103014114	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:103014114C>T	uc001pho.2	+	18	2836	c.2692C>T	c.(2692-2694)CGA>TGA	p.R898*	DYNC2H1_uc001phn.1_Nonsense_Mutation_p.R898*|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	898	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AGAAGTAGAACGACTTCCAAG	0.363													6	39	---	---	---	---	capture	Nonsense_Mutation	SNP	103014114	103014114	DYNC2H1	11	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	4801	93
BCL2L14	79370	broad.mit.edu	37	12	12232401	12232401	+	Silent	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:12232401C>T	uc001rac.2	+	2	363	c.162C>T	c.(160-162)TCC>TCT	p.S54S	ETV6_uc001raa.1_Intron|BCL2L14_uc001raf.1_RNA|BCL2L14_uc001rad.2_Silent_p.S54S|BCL2L14_uc001rae.2_Silent_p.S54S	NM_138723	NP_620049	Q9BZR8	B2L14_HUMAN	BCL2-like 14 isoform 1	54					apoptosis|regulation of apoptosis	cytosol|endomembrane system|intracellular organelle|membrane	protein binding	p.S54S(1)		skin(1)	1		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		GAAGTTTGTCCCAGAGGGGCC	0.488													6	60	---	---	---	---	capture	Silent	SNP	12232401	12232401	BCL2L14	12	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	1361	93
LIMA1	51474	broad.mit.edu	37	12	50575756	50575756	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50575756C>T	uc001rwj.3	-	10	1379	c.1205G>A	c.(1204-1206)CGT>CAT	p.R402H	LIMA1_uc001rwg.3_Missense_Mutation_p.R100H|LIMA1_uc001rwh.3_Missense_Mutation_p.R241H|LIMA1_uc001rwi.3_Missense_Mutation_p.R243H|LIMA1_uc001rwk.3_Missense_Mutation_p.R403H|LIMA1_uc010smr.1_RNA|LIMA1_uc010sms.1_RNA	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b	402	LIM zinc-binding.				actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						GGCCAAGAGACGCTCCATTGG	0.473													5	78	---	---	---	---	capture	Missense_Mutation	SNP	50575756	50575756	LIMA1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8716	93
DGKA	1606	broad.mit.edu	37	12	56330335	56330335	+	Silent	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56330335G>A	uc001sij.2	+	2	312	c.48G>A	c.(46-48)CTG>CTA	p.L16L	DGKA_uc009zoc.1_Silent_p.L16L|DGKA_uc001sih.1_5'UTR|DGKA_uc001sii.1_5'UTR|DGKA_uc009zod.1_Silent_p.L16L|DGKA_uc009zoe.1_Silent_p.L16L|DGKA_uc001sik.2_Silent_p.L16L|DGKA_uc001sil.2_Silent_p.L16L|DGKA_uc001sim.2_Silent_p.L16L|DGKA_uc001sin.2_Silent_p.L16L|DGKA_uc009zof.2_5'UTR|DGKA_uc001sio.2_5'UTR	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	16					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	TTGCCCAGCTGCAAAAATACA	0.527													4	53	---	---	---	---	capture	Silent	SNP	56330335	56330335	DGKA	12	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	4423	93
FREM2	341640	broad.mit.edu	37	13	39266205	39266205	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:39266205T>G	uc001uwv.2	+	1	5033	c.4724T>G	c.(4723-4725)GTG>GGG	p.V1575G		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	1575	Extracellular (Potential).|CSPG 11.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ATCACCCAGGTGCCTATTCAT	0.418													10	122	---	---	---	---	capture	Missense_Mutation	SNP	39266205	39266205	FREM2	13	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	5988	93
CHD8	57680	broad.mit.edu	37	14	21871325	21871325	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21871325G>A	uc001was.1	-	18	2822	c.2728C>T	c.(2728-2730)CAG>TAG	p.Q910*	CHD8_uc001war.1_Nonsense_Mutation_p.Q806*|CHD8_uc001wav.1_Nonsense_Mutation_p.Q352*	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1189	Helicase C-terminal.				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ATGGCAGCCTGTCGAAGGTTG	0.478													4	53	---	---	---	---	capture	Nonsense_Mutation	SNP	21871325	21871325	CHD8	14	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	5	2	3297	93
LRFN5	145581	broad.mit.edu	37	14	42360496	42360496	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:42360496G>C	uc001wvm.2	+	4	2627	c.1429G>C	c.(1429-1431)GCT>CCT	p.A477P	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	477	Extracellular (Potential).|Fibronectin type-III.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CAATAATCTGGCTGCTGGAAC	0.403										HNSCC(30;0.082)			15	151	---	---	---	---	capture	Missense_Mutation	SNP	42360496	42360496	LRFN5	14	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	8857	93
ZNF263	10127	broad.mit.edu	37	16	3339555	3339555	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3339555A>G	uc002cuq.2	+	6	1381	c.1049A>G	c.(1048-1050)GAG>GGG	p.E350G	ZNF263_uc010uww.1_5'UTR|ZNF263_uc002cur.2_5'UTR	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	350					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						CCTCCCCCAGAGGGTGGAATG	0.617													12	76	---	---	---	---	capture	Missense_Mutation	SNP	3339555	3339555	ZNF263	16	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	17683	93
ADCY9	115	broad.mit.edu	37	16	4016471	4016471	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4016471C>T	uc002cvx.2	-	11	3906	c.3367G>A	c.(3367-3369)GCG>ACG	p.A1123T		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	1123	Guanylate cyclase 2.|Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						TGGGCCTGCGCGGTGTTCAGC	0.602													7	117	---	---	---	---	capture	Missense_Mutation	SNP	4016471	4016471	ADCY9	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	301	93
NF1	4763	broad.mit.edu	37	17	29533304	29533304	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29533304C>A	uc002hgg.2	+	12	1640	c.1307C>A	c.(1306-1308)TCG>TAG	p.S436*	NF1_uc002hge.1_Nonsense_Mutation_p.S436*|NF1_uc002hgf.1_Nonsense_Mutation_p.S436*|NF1_uc002hgh.2_Nonsense_Mutation_p.S436*|NF1_uc010csn.1_Nonsense_Mutation_p.S296*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	436					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TATTGTCACTCGGTTGAACTT	0.413			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			14	128	---	---	---	---	capture	Nonsense_Mutation	SNP	29533304	29533304	NF1	17	C	A	A	A	1	0	0	0	0	0	1	0	0	403	31	5	4	10263	93
CYP4F11	57834	broad.mit.edu	37	19	16034748	16034748	+	Silent	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16034748G>A	uc002nbu.2	-	7	828	c.792C>T	c.(790-792)CAC>CAT	p.H264H	CYP4F11_uc010eab.1_Silent_p.H264H|CYP4F11_uc002nbt.2_Silent_p.H264H	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	264					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						CTGTGAAGTCGTGCACCAGGT	0.527													10	146	---	---	---	---	capture	Silent	SNP	16034748	16034748	CYP4F11	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4146	93
USE1	55850	broad.mit.edu	37	19	17329200	17329200	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17329200C>T	uc002nfo.2	+	6	482	c.422C>T	c.(421-423)ACT>ATT	p.T141I	USE1_uc002nfn.2_3'UTR|USE1_uc010eal.1_Missense_Mutation_p.T141I	NM_018467	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog	141	Cytoplasmic (Potential).				lysosomal transport|protein catabolic process|protein transport|secretion by cell|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	protein binding				0						AGGAAGAGAACGTGAGTGTCT	0.582													4	45	---	---	---	---	capture	Missense_Mutation	SNP	17329200	17329200	USE1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16913	93
PSG1	5669	broad.mit.edu	37	19	43382389	43382389	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43382389C>T	uc002ovb.2	-	2	244	c.106G>A	c.(106-108)GTC>ATC	p.V36I	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Missense_Mutation_p.V36I|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Missense_Mutation_p.V36I|PSG1_uc010eio.1_Missense_Mutation_p.V36I|PSG1_uc002oux.1_5'UTR|PSG1_uc002ouy.1_Missense_Mutation_p.V36I|PSG1_uc002ouz.1_Missense_Mutation_p.V36I|PSG1_uc002ova.1_Missense_Mutation_p.V36I|PSG1_uc002ovc.2_Missense_Mutation_p.V36I|PSG1_uc002ovd.1_Missense_Mutation_p.V36I	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	36	Ig-like V-type.				female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				TCAATCGTGACTTGGGCAGTG	0.463													12	242	---	---	---	---	capture	Missense_Mutation	SNP	43382389	43382389	PSG1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	12548	93
CACNG6	59285	broad.mit.edu	37	19	54503003	54503003	+	Silent	SNP	A	G	G			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54503003A>G	uc002qct.2	+	3	1112	c.522A>G	c.(520-522)GGA>GGG	p.G174G	CACNG6_uc002qcu.2_Intron|CACNG6_uc002qcv.2_Intron	NM_145814	NP_665813	Q9BXT2	CCG6_HUMAN	voltage-dependent calcium channel gamma-6	174	Helical; (Potential).					voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(2)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		TCCGAGTTGGAGCCGTCTGCT	0.587													5	228	---	---	---	---	capture	Silent	SNP	54503003	54503003	CACNG6	19	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	2537	93
LY75	4065	broad.mit.edu	37	2	160755280	160755280	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160755280G>A	uc002ubc.3	-	2	454	c.385C>T	c.(385-387)CAT>TAT	p.H129Y	LY75_uc002ubb.3_Missense_Mutation_p.H129Y|LY75_uc010fos.2_Missense_Mutation_p.H129Y|LY75_uc010fot.1_Missense_Mutation_p.H129Y	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	129	Extracellular (Potential).|Ricin B-type lectin.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		GCTGTGCCATGTCCATCCTTC	0.522													7	86	---	---	---	---	capture	Missense_Mutation	SNP	160755280	160755280	LY75	2	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	9014	93
SYN3	8224	broad.mit.edu	37	22	32937634	32937634	+	Silent	SNP	G	A	A	rs148217218		TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32937634G>A	uc003amx.2	-	7	999	c.840C>T	c.(838-840)TAC>TAT	p.Y280Y	SYN3_uc003amy.2_Silent_p.Y280Y|SYN3_uc003amz.2_Silent_p.Y279Y	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	280	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						CGGTGGTGGCGTAGGTTTTGG	0.552													8	56	---	---	---	---	capture	Silent	SNP	32937634	32937634	SYN3	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15330	93
SI	6476	broad.mit.edu	37	3	164786544	164786544	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:164786544G>T	uc003fei.2	-	5	511	c.449C>A	c.(448-450)ACT>AAT	p.T150N		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	150	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	CTGATTTTGAGTTGTGAAGAG	0.323										HNSCC(35;0.089)			8	181	---	---	---	---	capture	Missense_Mutation	SNP	164786544	164786544	SI	3	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	14190	93
PYDC2	152138	broad.mit.edu	37	3	191179074	191179074	+	Silent	SNP	C	T	T	rs141891926	by1000genomes	TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:191179074C>T	uc011bso.1	+	1	123	c.123C>T	c.(121-123)ACC>ACT	p.T41T		NM_001083308	NP_001076777	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	41	DAPIN.					cytoplasm|nucleus					0						AGCTACAGACCGTCCCCCAGA	0.542													5	113	---	---	---	---	capture	Silent	SNP	191179074	191179074	PYDC2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12754	93
KLHL5	51088	broad.mit.edu	37	4	39116788	39116788	+	Silent	SNP	C	G	G			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39116788C>G	uc003gts.2	+	10	2124	c.2049C>G	c.(2047-2049)CCC>CCG	p.P683P	KLHL5_uc003gtp.2_Silent_p.P637P|KLHL5_uc003gtq.2_Silent_p.P496P|KLHL5_uc003gtr.1_Silent_p.P683P|KLHL5_uc003gtt.2_Silent_p.P622P	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN	kelch-like 5 isoform 1	683	Kelch 5.					cytoplasm|cytoskeleton	actin binding			ovary(1)	1						GATATGATCCCAAAACAGACA	0.383													3	65	---	---	---	---	capture	Silent	SNP	39116788	39116788	KLHL5	4	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	8312	93
GPRIN3	285513	broad.mit.edu	37	4	90170302	90170302	+	Silent	SNP	C	T	T	rs145721148	byFrequency	TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:90170302C>T	uc003hsm.1	-	2	1479	c.960G>A	c.(958-960)GCG>GCA	p.A320A		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	320										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CCTGCACCTCCGCATCTTGCC	0.537													6	137	---	---	---	---	capture	Silent	SNP	90170302	90170302	GPRIN3	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6664	93
HEATR7B2	133558	broad.mit.edu	37	5	41048449	41048449	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41048449G>A	uc003jmj.3	-	16	2151	c.1661C>T	c.(1660-1662)CCT>CTT	p.P554L	HEATR7B2_uc003jmi.3_Missense_Mutation_p.P109L	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	554	HEAT 6.						binding			ovary(6)|central_nervous_system(2)	8						CAGAAGCTCAGGTAAACGTGT	0.468													5	89	---	---	---	---	capture	Missense_Mutation	SNP	41048449	41048449	HEATR7B2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6961	93
KCTD16	57528	broad.mit.edu	37	5	143853547	143853547	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:143853547A>C	uc003lnm.1	+	4	1786	c.1157A>C	c.(1156-1158)AAA>ACA	p.K386T	KCTD16_uc003lnn.1_Missense_Mutation_p.K386T	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	386						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AAAGCTGTTAAAGAAAAGCTC	0.443													15	130	---	---	---	---	capture	Missense_Mutation	SNP	143853547	143853547	KCTD16	5	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	8025	93
UNC5A	90249	broad.mit.edu	37	5	176301527	176301527	+	Silent	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176301527C>T	uc003mey.2	+	8	1530	c.1338C>T	c.(1336-1338)ACC>ACT	p.T446T	UNC5A_uc010jkg.1_Silent_p.T406T	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor	446	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTATGGGACCTTCAACTTCC	0.627													4	155	---	---	---	---	capture	Silent	SNP	176301527	176301527	UNC5A	5	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	16873	93
GRM3	2913	broad.mit.edu	37	7	86469103	86469103	+	Missense_Mutation	SNP	C	T	T	rs141671463		TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86469103C>T	uc003uid.2	+	4	3372	c.2273C>T	c.(2272-2274)ACG>ATG	p.T758M	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.T630M|GRM3_uc010leh.2_Missense_Mutation_p.T350M	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	758	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane		p.T758M(1)		lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GCCTTCAAAACGCGGAAGTGC	0.428													9	92	---	---	---	---	capture	Missense_Mutation	SNP	86469103	86469103	GRM3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6731	93
CYP3A5	1577	broad.mit.edu	37	7	99262902	99262902	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99262902C>G	uc003urq.2	-	7	644	c.557G>C	c.(556-558)GGC>GCC	p.G186A	ZNF498_uc003urn.2_Intron|CYP3A5_uc003urp.2_Missense_Mutation_p.G6A|CYP3A5_uc003urr.2_Missense_Mutation_p.G73A|CYP3A5_uc011kiy.1_Missense_Mutation_p.G176A|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	NM_000777	NP_000768	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A,	186					alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)	AAATGATGTGCCAGTAATCAC	0.418													10	117	---	---	---	---	capture	Missense_Mutation	SNP	99262902	99262902	CYP3A5	7	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	4140	93
PIP	5304	broad.mit.edu	37	7	142836647	142836647	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142836647G>A	uc003wcf.1	+	4	389	c.353G>A	c.(352-354)CGG>CAG	p.R118Q		NM_002652	NP_002643	P12273	PIP_HUMAN	prolactin-induced protein precursor	118						extracellular region	actin binding			ovary(1)	1	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		GATGTTATTCGGGAATTAGGC	0.453													23	240	---	---	---	---	capture	Missense_Mutation	SNP	142836647	142836647	PIP	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11838	93
DMRT3	58524	broad.mit.edu	37	9	990484	990484	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:990484G>A	uc003zgw.1	+	2	936	c.898G>A	c.(898-900)GCA>ACA	p.A300T		NM_021240	NP_067063	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor	300					cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(2)|central_nervous_system(1)	3		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		GCGAACTTCCGCAGAACCTGA	0.582													4	88	---	---	---	---	capture	Missense_Mutation	SNP	990484	990484	DMRT3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4545	93
ZBED1	9189	broad.mit.edu	37	X	2407462	2407462	+	Silent	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2407462C>T	uc004cqg.2	-	2	1500	c.1299G>A	c.(1297-1299)ACG>ACA	p.T433T	DHRSX_uc004cqf.3_Intron|ZBED1_uc004cqh.1_Silent_p.T433T	NM_004729	NP_004720	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	433						nuclear chromosome	DNA binding|metal ion binding|protein dimerization activity|transposase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGATGTTGAGCGTGGTGTTCA	0.597													8	153	---	---	---	---	capture	Silent	SNP	2407462	2407462	ZBED1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17398	93
RAI2	10742	broad.mit.edu	37	X	17818684	17818684	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:17818684G>C	uc004cyf.2	-	3	2017	c.1447C>G	c.(1447-1449)CAA>GAA	p.Q483E	RAI2_uc004cyg.2_Missense_Mutation_p.Q483E|RAI2_uc010nfa.2_Missense_Mutation_p.Q483E|RAI2_uc004cyh.3_Missense_Mutation_p.Q483E|RAI2_uc011miy.1_Missense_Mutation_p.Q433E	NM_021785	NP_068557	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	483					embryo development					ovary(1)|breast(1)	2	Hepatocellular(33;0.183)					TCTTCCCCTTGGCTGTTGATG	0.468													61	662	---	---	---	---	capture	Missense_Mutation	SNP	17818684	17818684	RAI2	23	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	12904	93
EIF2S3	1968	broad.mit.edu	37	X	24073154	24073154	+	Silent	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24073154G>A	uc004dbc.2	+	1	90	c.69G>A	c.(67-69)TTG>TTA	p.L23L		NM_001415	NP_001406	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2,	23						cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			lung(1)	1						TCACCACCTTGGTGAGGTTTT	0.587											OREG0019714	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	103	---	---	---	---	capture	Silent	SNP	24073154	24073154	EIF2S3	23	G	A	A	A	1	0	0	0	0	0	0	0	1	607	47	2	2	4966	93
PORCN	64840	broad.mit.edu	37	X	48368320	48368320	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48368320G>A	uc010nie.1	+	2	270	c.112G>A	c.(112-114)GCC>ACC	p.A38T	PORCN_uc004djq.1_Missense_Mutation_p.A151T|PORCN_uc004djr.1_Missense_Mutation_p.A38T|PORCN_uc004djs.1_Missense_Mutation_p.A38T|PORCN_uc004djt.1_5'UTR|PORCN_uc011mlx.1_5'UTR|PORCN_uc004dju.1_5'UTR|PORCN_uc004djv.1_Missense_Mutation_p.A38T|PORCN_uc004djw.1_Missense_Mutation_p.A38T	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D	38	Helical; (Potential).|Leu-rich.				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						CATCTGCCTCGCCTGCCGCCT	0.413													5	60	---	---	---	---	capture	Missense_Mutation	SNP	48368320	48368320	PORCN	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12160	93
WNK3	65267	broad.mit.edu	37	X	54276526	54276526	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54276526G>A	uc004dtd.1	-	16	3053	c.2614C>T	c.(2614-2616)CGA>TGA	p.R872*	WNK3_uc004dtc.1_Nonsense_Mutation_p.R872*	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	872					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						ATACAGAATCGCCACCGACCA	0.423													3	23	---	---	---	---	capture	Nonsense_Mutation	SNP	54276526	54276526	WNK3	23	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	17260	93
IL1RAPL2	26280	broad.mit.edu	37	X	105011568	105011568	+	Silent	SNP	C	T	T			TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105011568C>T	uc004elz.1	+	11	2731	c.1975C>T	c.(1975-1977)CTG>TTG	p.L659L		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	659	Cytoplasmic (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						TAATAACACCCTGAAAGATAC	0.448													10	120	---	---	---	---	capture	Silent	SNP	105011568	105011568	IL1RAPL2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	7585	93
IL32	9235	broad.mit.edu	37	16	3119304	3119305	+	Frame_Shift_Ins	INS	-	G	G	rs2981599		TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3119304_3119305insG	uc002cto.2	+	6	864_865	c.653_654insG	c.(652-654)GACfs	p.D218fs	IL32_uc002ctk.2_Frame_Shift_Ins_p.D115fs|IL32_uc010uwp.1_Frame_Shift_Ins_p.D152fs|IL32_uc010btb.2_Frame_Shift_Ins_p.D162fs|IL32_uc002ctl.2_Frame_Shift_Ins_p.D172fs|IL32_uc002ctm.2_Frame_Shift_Ins_p.D172fs|IL32_uc002ctn.2_Frame_Shift_Ins_p.D172fs|IL32_uc002cts.3_Frame_Shift_Ins_p.D172fs|IL32_uc002ctp.2_Frame_Shift_Ins_p.D152fs|IL32_uc002ctq.2_Frame_Shift_Ins_p.D218fs|IL32_uc002ctr.2_Frame_Shift_Ins_p.D152fs|IL32_uc002ctt.2_Frame_Shift_Ins_p.D172fs|IL32_uc010uwr.1_Frame_Shift_Ins_p.D132fs|IL32_uc002ctu.2_Frame_Shift_Ins_p.D163fs	NM_004221	NP_004212	P24001	IL32_HUMAN	interleukin 32 isoform B	218					cell adhesion|defense response|immune response	extracellular space	cytokine activity			pancreas(1)	1						CCACGGGGGGACAAGGAGGAGC	0.574													14	280	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	3119304	3119305	IL32	16	-	G	G	G	1	0	1	1	0	0	0	0	0	130	10	5	5	7615	93
TERF2IP	54386	broad.mit.edu	37	16	75690204	75690206	+	In_Frame_Del	DEL	GAA	-	-	rs140846731		TCGA-06-5410-01	TCGA-06-5410-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75690204_75690206delGAA	uc002fet.1	+	3	992_994	c.895_897delGAA	c.(895-897)GAAdel	p.E304del		NM_018975	NP_061848	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting	304	Asp/Glu-rich (acidic).				negative regulation of DNA recombination at telomere|negative regulation of telomere maintenance|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|regulation of double-strand break repair via homologous recombination|telomere maintenance via telomerase|transcription, DNA-dependent	cytoplasm|nuclear telomere cap complex|nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1						TGATgaggaggaagaagaagaag	0.369													8	116	---	---	---	---	capture_indel	In_Frame_Del	DEL	75690204	75690206	TERF2IP	16	GAA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	15648	93
