Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MASP2	10747	broad.mit.edu	37	1	11087589	11087589	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11087589G>A	uc001aru.2	-	11	1435	c.1414C>T	c.(1414-1416)CTT>TTT	p.L472F		NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform	472	Peptidase S1.				complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		TCATATAAAAGTGCACCTGCT	0.493													60	82	---	---	---	---	capture	Missense_Mutation	SNP	11087589	11087589	MASP2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	9236	94
RNF2	6045	broad.mit.edu	37	1	185069006	185069006	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185069006G>A	uc001grc.1	+	6	1054	c.821G>A	c.(820-822)AGC>AAC	p.S274N	RNF2_uc001grd.1_Missense_Mutation_p.S202N|RNF2_uc001gre.1_RNA	NM_007212	NP_009143	Q99496	RING2_HUMAN	ring finger protein 2	274					histone H2A monoubiquitination|transcription, DNA-dependent	MLL1 complex|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			breast(1)	1		Breast(1374;0.000496)		Colorectal(1306;6.9e-08)|KIRC - Kidney renal clear cell carcinoma(1967;8.12e-06)		GAACTTCGAAGCAAAGGTGAA	0.393													4	129	---	---	---	---	capture	Missense_Mutation	SNP	185069006	185069006	RNF2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	13364	94
OR2C3	81472	broad.mit.edu	37	1	247695277	247695277	+	Silent	SNP	A	G	G			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247695277A>G	uc009xgy.2	-	2	899	c.537T>C	c.(535-537)TTT>TTC	p.F179F	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C,	179	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			GCATCTCGCAAAAGAAGTGGT	0.557													12	19	---	---	---	---	capture	Silent	SNP	247695277	247695277	OR2C3	1	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	10897	94
PTEN	5728	broad.mit.edu	37	10	89692904	89692904	+	Nonsense_Mutation	SNP	C	T	T	rs121909224		TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692904C>T	uc001kfb.2	+	6	1419	c.388C>T	c.(388-390)CGA>TGA	p.R130*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(65)|p.R130*(61)|p.R130Q(43)|p.R130fs*4(12)|p.R130L(7)|p.R130P(4)|p.R55fs*1(4)|p.K128_R130del(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.R130R(1)|p.F56fs*2(1)|p.G129fs*50(1)|p.G129fs*51(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGGAAAGGGACGAACTGGTGT	0.403	R130G(OV56_OVARY)|R130G(KMBC2_URINARY_TRACT)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			21	49	---	---	---	---	capture	Nonsense_Mutation	SNP	89692904	89692904	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	94
ANO9	338440	broad.mit.edu	37	11	420528	420528	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:420528C>T	uc001lpi.2	-	19	1806	c.1721G>A	c.(1720-1722)CGC>CAC	p.R574H	ANO9_uc001lph.2_Missense_Mutation_p.R267H|ANO9_uc010qvv.1_Missense_Mutation_p.R430H	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	574	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						GGCGTCCAGGCGGATCTCCAC	0.682													11	30	---	---	---	---	capture	Missense_Mutation	SNP	420528	420528	ANO9	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	698	94
OR4D11	219986	broad.mit.edu	37	11	59271634	59271634	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59271634G>T	uc001noa.1	+	1	586	c.586G>T	c.(586-588)GAG>TAG	p.E196*		NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D,	196	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TTTTGCTCTTGAGTTCTTGAT	0.493													30	111	---	---	---	---	capture	Nonsense_Mutation	SNP	59271634	59271634	OR4D11	11	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	10959	94
CTTN	2017	broad.mit.edu	37	11	70255986	70255986	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:70255986G>A	uc001opv.3	+	5	417	c.211G>A	c.(211-213)GAG>AAG	p.E71K	CTTN_uc001opu.2_Missense_Mutation_p.E71K|CTTN_uc001opw.3_Missense_Mutation_p.E71K	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	71						cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GACCCTTAAGGAGAAGGAACT	0.468													10	321	---	---	---	---	capture	Missense_Mutation	SNP	70255986	70255986	CTTN	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4005	94
PRB3	5544	broad.mit.edu	37	12	11420518	11420518	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11420518G>A	uc001qzs.2	-	3	703	c.665C>T	c.(664-666)CCA>CTA	p.P222L	PRB4_uc001qzf.1_Intron	NM_006249	NP_006240	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	222	9.|10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.					extracellular region	Gram-negative bacterial cell surface binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TGGCTTTCCCGGACGAGGTGG	0.617													50	206	---	---	---	---	capture	Missense_Mutation	SNP	11420518	11420518	PRB3	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12340	94
PRB3	5544	broad.mit.edu	37	12	11420581	11420581	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11420581G>A	uc001qzs.2	-	3	640	c.602C>T	c.(601-603)CCG>CTG	p.P201L	PRB4_uc001qzf.1_Intron	NM_006249	NP_006240	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	201	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|8.|Pro-rich.		Missing (in allele S).			extracellular region	Gram-negative bacterial cell surface binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TGGCTTTCCCGGACGAGGTGG	0.632													49	499	---	---	---	---	capture	Missense_Mutation	SNP	11420581	11420581	PRB3	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12340	94
MYF6	4618	broad.mit.edu	37	12	81101720	81101720	+	Silent	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:81101720C>T	uc001szf.1	+	1	275	c.222C>T	c.(220-222)CCC>CCT	p.P74P		NM_002469	NP_002460	P23409	MYF6_HUMAN	myogenic factor 6	74					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						CACACTGCCCCGGCCAGTGTC	0.652													23	57	---	---	---	---	capture	Silent	SNP	81101720	81101720	MYF6	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9938	94
UBC	7316	broad.mit.edu	37	12	125397269	125397269	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125397269G>A	uc001ugs.3	-	2	1497	c.1049C>T	c.(1048-1050)GCC>GTC	p.A350V	UBC_uc001ugr.2_Intron|UBC_uc001ugu.1_Missense_Mutation_p.A350V|UBC_uc001ugt.2_Missense_Mutation_p.A350V|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_Missense_Mutation_p.A198V	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	350	Ubiquitin-like 5.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CTGTTTTCCGGCAAAGATCAA	0.522													5	263	---	---	---	---	capture	Missense_Mutation	SNP	125397269	125397269	UBC	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16724	94
CCNA1	8900	broad.mit.edu	37	13	37011790	37011790	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:37011790T>A	uc001uvr.3	+	3	672	c.322T>A	c.(322-324)TCT>ACT	p.S108T	CCNA1_uc010teo.1_Missense_Mutation_p.S64T|CCNA1_uc010abq.2_Missense_Mutation_p.S64T|CCNA1_uc010abp.2_Missense_Mutation_p.S64T|CCNA1_uc001uvs.3_Missense_Mutation_p.S107T|CCNA1_uc010abr.2_RNA	NM_003914	NP_003905	P78396	CCNA1_HUMAN	cyclin A1 isoform a	108					cell division|G2/M transition of mitotic cell cycle|male meiosis I|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|spermatogenesis	cytosol|microtubule cytoskeleton|nucleoplasm	protein kinase binding			lung(2)|skin(2)|ovary(1)	5		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		CAGGTGTTATTCTGGATCAGA	0.468													4	152	---	---	---	---	capture	Missense_Mutation	SNP	37011790	37011790	CCNA1	13	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	2880	94
C15orf2	23742	broad.mit.edu	37	15	24921520	24921520	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24921520T>C	uc001ywo.2	+	1	980	c.506T>C	c.(505-507)ATC>ACC	p.I169T		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	169					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CCGGTGCAGATCGAAGGGGAG	0.612													24	37	---	---	---	---	capture	Missense_Mutation	SNP	24921520	24921520	C15orf2	15	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	1770	94
DSG4	147409	broad.mit.edu	37	18	28992962	28992962	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28992962C>T	uc002kwq.2	+	16	2662	c.2527C>T	c.(2527-2529)CTT>TTT	p.L843F	DSG4_uc002kwr.2_Missense_Mutation_p.L862F	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	843	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ATTTAGGACTCTTGCTGAGAT	0.438													47	105	---	---	---	---	capture	Missense_Mutation	SNP	28992962	28992962	DSG4	18	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4734	94
LMAN1	3998	broad.mit.edu	37	18	57014768	57014768	+	Silent	SNP	A	G	G			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:57014768A>G	uc002lhz.2	-	7	831	c.799T>C	c.(799-801)TTG>CTG	p.L267L		NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor	267	Lumenal (Potential).|L-type lectin-like.				blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	GGTTCAGTCAACTGGAAAGTC	0.279													6	15	---	---	---	---	capture	Silent	SNP	57014768	57014768	LMAN1	18	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	8756	94
CEACAM20	125931	broad.mit.edu	37	19	45016954	45016954	+	Silent	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45016954C>T	uc010ejn.1	-	9	1501	c.1485G>A	c.(1483-1485)AAG>AAA	p.K495K	CEACAM20_uc010ejo.1_Silent_p.K495K|CEACAM20_uc010ejp.1_Silent_p.K402K|CEACAM20_uc010ejq.1_Silent_p.K402K	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	495	Cytoplasmic (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				GGTGCTCCTCCTTCGGGATGG	0.388											OREG0025538	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	34	---	---	---	---	capture	Silent	SNP	45016954	45016954	CEACAM20	19	C	T	T	T	1	0	0	0	0	0	0	0	1	312	24	2	2	3160	94
A1BG	1	broad.mit.edu	37	19	58858802	58858802	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58858802C>T	uc002qsd.3	-	7	1459	c.1397G>A	c.(1396-1398)GGC>GAC	p.G466D	NCRNA00181_uc002qse.2_5'Flank	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor	466	Ig-like V-type 5.					extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CCTGTAGTTGCCGGCGTGCTG	0.692													19	24	---	---	---	---	capture	Missense_Mutation	SNP	58858802	58858802	A1BG	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1	94
PIGF	5281	broad.mit.edu	37	2	46808672	46808672	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:46808672A>G	uc002rvd.2	-	6	769	c.605T>C	c.(604-606)ATT>ACT	p.I202T	RHOQ_uc002rva.2_3'UTR|uc002rvb.2_5'Flank|PIGF_uc002rvc.2_3'UTR	NM_002643	NP_002634	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	202	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	ethanolaminephosphotransferase activity				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			GAGTGGTGAAATAACAAGGCC	0.418													10	18	---	---	---	---	capture	Missense_Mutation	SNP	46808672	46808672	PIGF	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11790	94
LBX2	85474	broad.mit.edu	37	2	74729804	74729804	+	Silent	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74729804G>A	uc002slw.2	-	1	640	c.183C>T	c.(181-183)TGC>TGT	p.C61C	LOC151534_uc002slx.2_RNA	NM_001009812	NP_001009812	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TTTGGGGGCGGCAGGCCTGTG	0.602													4	139	---	---	---	---	capture	Silent	SNP	74729804	74729804	LBX2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	8574	94
FAM176A	84141	broad.mit.edu	37	2	75720689	75720689	+	Silent	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:75720689G>A	uc002sni.2	-	4	610	c.132C>T	c.(130-132)ATC>ATT	p.I44I	FAM176A_uc002snj.1_Silent_p.I31I|FAM176A_uc002snk.1_Silent_p.I44I	NM_001135032	NP_001128504	Q9H8M9	F176A_HUMAN	family with sequence similarity 176, member A	44	Necessary for the localization and biological activity.|Helical; (Potential).				apoptosis|autophagy	endoplasmic reticulum membrane|integral to membrane|lysosomal membrane|plasma membrane					0						GCACCAGCCCGATGCACACGC	0.537													11	31	---	---	---	---	capture	Silent	SNP	75720689	75720689	FAM176A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	5452	94
DNAH7	56171	broad.mit.edu	37	2	196689149	196689149	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:196689149C>T	uc002utj.3	-	49	9222	c.9121G>A	c.(9121-9123)GAA>AAA	p.E3041K		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3041	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCTAGTTCTTCGCCAACATTT	0.338													10	68	---	---	---	---	capture	Missense_Mutation	SNP	196689149	196689149	DNAH7	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4562	94
ABI2	10152	broad.mit.edu	37	2	204260428	204260428	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:204260428C>T	uc002vaa.2	+	7	1010	c.775C>T	c.(775-777)CGA>TGA	p.R259*	ABI2_uc010zig.1_RNA|ABI2_uc002uzz.2_Nonsense_Mutation_p.R253*|ABI2_uc010zih.1_Intron|ABI2_uc010zii.1_Nonsense_Mutation_p.R253*|ABI2_uc010zij.1_Nonsense_Mutation_p.R197*|ABI2_uc002vab.2_Nonsense_Mutation_p.R208*|ABI2_uc010zik.1_Nonsense_Mutation_p.R45*|ABI2_uc010zil.1_Nonsense_Mutation_p.R94*|ABI2_uc010zim.1_Nonsense_Mutation_p.R45*|ABI2_uc002vac.2_Nonsense_Mutation_p.R45*|ABI2_uc010zin.1_Intron	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2	259	Pro-rich.				actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0						GAGCAGCAGTCGAGAGAACAG	0.478													38	83	---	---	---	---	capture	Nonsense_Mutation	SNP	204260428	204260428	ABI2	2	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	89	94
KIF16B	55614	broad.mit.edu	37	20	16337022	16337022	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:16337022C>T	uc002wpg.1	-	23	3732	c.3574G>A	c.(3574-3576)GTC>ATC	p.V1192I	KIF16B_uc002wpe.1_Missense_Mutation_p.V574I|KIF16B_uc002wpf.1_Intron|KIF16B_uc010gch.1_Missense_Mutation_p.V1141I	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	1192	PX.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CCGCAGAGGACGTAGCGTGGG	0.498													6	40	---	---	---	---	capture	Missense_Mutation	SNP	16337022	16337022	KIF16B	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8200	94
PCK1	5105	broad.mit.edu	37	20	56137841	56137841	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56137841G>A	uc002xyn.3	+	4	659	c.496G>A	c.(496-498)GTG>ATG	p.V166M	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	166					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TTCACCCTACGTGGTGGCCAG	0.617													30	66	---	---	---	---	capture	Missense_Mutation	SNP	56137841	56137841	PCK1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11484	94
NRIP1	8204	broad.mit.edu	37	21	16340303	16340303	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:16340303G>A	uc002yjx.2	-	4	809	c.211C>T	c.(211-213)CAT>TAT	p.H71Y		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	71					androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TGATATGTATGTGTATTGAGA	0.458													5	13	---	---	---	---	capture	Missense_Mutation	SNP	16340303	16340303	NRIP1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10559	94
TIAM1	7074	broad.mit.edu	37	21	32639088	32639088	+	Silent	SNP	G	C	C			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:32639088G>C	uc002yow.1	-	5	673	c.201C>G	c.(199-201)TCC>TCG	p.S67S	TIAM1_uc011adk.1_Silent_p.S67S|TIAM1_uc011adl.1_Silent_p.S67S|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	67					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						TTTCAGCCAGGGACTGGGGGA	0.617													4	94	---	---	---	---	capture	Silent	SNP	32639088	32639088	TIAM1	21	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	15775	94
CBR1	873	broad.mit.edu	37	21	37445093	37445093	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:37445093G>T	uc002yvb.1	+	3	876	c.747G>T	c.(745-747)GAG>GAT	p.E249D	uc011aea.1_Intron|SETD4_uc002yva.2_Intron|CBR1_uc010gmy.1_3'UTR	NM_001757	NP_001748	P16152	CBR1_HUMAN	carbonyl reductase 1	249					drug metabolic process|vitamin K metabolic process	cytoplasm	15-hydroxyprostaglandin dehydrogenase (NADP+) activity|carbonyl reductase (NADPH) activity|prostaglandin-E2 9-reductase activity|protein binding				0					Acetohexamide(DB00414)|Lubiprostone(DB01046)	AAGGTGCAGAGACCCCTGTGT	0.572													21	61	---	---	---	---	capture	Missense_Mutation	SNP	37445093	37445093	CBR1	21	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	2684	94
C21orf29	54084	broad.mit.edu	37	21	45953585	45953585	+	Silent	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45953585G>A	uc002zfe.1	-	3	591	c.525C>T	c.(523-525)TGC>TGT	p.C175C	C21orf29_uc010gpv.1_Silent_p.C107C	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	175	TSP N-terminal.				cell adhesion	extracellular region	structural molecule activity				0						CCGGGAGGCCGCAGTCCGTGG	0.682													3	49	---	---	---	---	capture	Silent	SNP	45953585	45953585	C21orf29	21	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	2105	94
RAF1	5894	broad.mit.edu	37	3	12632402	12632402	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12632402T>C	uc003bxf.3	-	12	1680	c.1265A>G	c.(1264-1266)CAG>CGG	p.Q422R	RAF1_uc011aut.1_Missense_Mutation_p.Q207R|RAF1_uc011auu.1_Missense_Mutation_p.Q340R	NM_002880	NP_002871	P04049	RAF1_HUMAN	v-raf-1 murine leukemia viral oncogene homolog	422	Protein kinase.				activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)	CTCGCACCACTGGGTCACAAT	0.448			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				4	134	---	---	---	---	capture	Missense_Mutation	SNP	12632402	12632402	RAF1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	12897	94
SCN5A	6331	broad.mit.edu	37	3	38591931	38591931	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38591931C>G	uc003cio.2	-	28	6126	c.5932G>C	c.(5932-5934)GAC>CAC	p.D1978H	SCN5A_uc003cin.2_Missense_Mutation_p.D1977H|SCN5A_uc003cil.3_Missense_Mutation_p.D1978H|SCN5A_uc010hhi.2_Missense_Mutation_p.D1960H|SCN5A_uc010hhk.2_Missense_Mutation_p.D1945H|SCN5A_uc011ayr.1_Missense_Mutation_p.D1924H	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1978				D->A: No effect on interaction with NEDD4, NEDD4L or WWP2.	blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GTGACACTGTCATAGGAGGGT	0.602													4	72	---	---	---	---	capture	Missense_Mutation	SNP	38591931	38591931	SCN5A	3	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	13815	94
SLC9A9	285195	broad.mit.edu	37	3	143212496	143212496	+	Silent	SNP	T	C	C			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:143212496T>C	uc003evn.2	-	11	1496	c.1314A>G	c.(1312-1314)TCA>TCG	p.S438S		NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	438	Helical; (Potential).				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						TTCACATACCTGAAAACATCA	0.403													3	77	---	---	---	---	capture	Silent	SNP	143212496	143212496	SLC9A9	3	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	14613	94
KIT	3815	broad.mit.edu	37	4	55597497	55597497	+	Silent	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55597497C>T	uc010igr.2	+	15	2232	c.2145C>T	c.(2143-2145)AGC>AGT	p.S715S	KIT_uc010igs.2_Silent_p.S711S|KIT_uc010igt.1_Silent_p.C163C	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	715	Protein kinase.|Cytoplasmic (Potential).				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	p.S715del(7)		soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCCCAGCAGCGATAGTACTA	0.458		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				4	17	---	---	---	---	capture	Silent	SNP	55597497	55597497	KIT	4	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	8250	94
ARL9	132946	broad.mit.edu	37	4	57389924	57389924	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57389924G>A	uc003hby.1	+	4	702	c.254G>A	c.(253-255)GGA>GAA	p.G85E		NM_206919	NP_996802	Q6T311	ARL9_HUMAN	ADP-ribosylation factor-like 9	149							GTP binding				0	Glioma(25;0.08)|all_neural(26;0.101)					TCTGAAGTGGGAAATGACAGG	0.433													14	39	---	---	---	---	capture	Missense_Mutation	SNP	57389924	57389924	ARL9	4	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	941	94
UGT2B10	7365	broad.mit.edu	37	4	69885591	69885591	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69885591C>G	uc011cao.1	-	4	534	c.398G>C	c.(397-399)AGT>ACT	p.S133T	UGT2B10_uc011can.1_Intron			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	170					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GAAGCTGTGACTGTACACAAA	0.408													10	26	---	---	---	---	capture	Missense_Mutation	SNP	69885591	69885591	UGT2B10	4	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	16838	94
MUC7	4589	broad.mit.edu	37	4	71346617	71346617	+	Silent	SNP	A	G	G			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71346617A>G	uc011cat.1	+	4	444	c.156A>G	c.(154-156)CTA>CTG	p.L52L	MUC7_uc011cau.1_Silent_p.L52L|MUC7_uc003hfj.2_Silent_p.L52L|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	52						extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			CTGGACTGCTAGCTCACCAGA	0.453													36	106	---	---	---	---	capture	Silent	SNP	71346617	71346617	MUC7	4	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	9891	94
CARD6	84674	broad.mit.edu	37	5	40853218	40853218	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40853218T>A	uc003jmg.2	+	3	1859	c.1784T>A	c.(1783-1785)ATT>AAT	p.I595N		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	595					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						GAGGCTCAAATTTTTCAGAGG	0.483													53	131	---	---	---	---	capture	Missense_Mutation	SNP	40853218	40853218	CARD6	5	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	2626	94
RGNEF	64283	broad.mit.edu	37	5	73045681	73045681	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73045681C>T	uc011csq.1	+	2	64	c.53C>T	c.(52-54)GCG>GTG	p.A18V	RGNEF_uc003kcx.2_Missense_Mutation_p.A18V|RGNEF_uc003kcy.1_Missense_Mutation_p.A18V|RGNEF_uc010izf.2_Missense_Mutation_p.A18V	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	18					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		ATGATCTATGCGAAGTTTGAC	0.443													18	58	---	---	---	---	capture	Missense_Mutation	SNP	73045681	73045681	RGNEF	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13178	94
GABRA6	2559	broad.mit.edu	37	5	161119124	161119124	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161119124C>T	uc003lyu.2	+	8	1342	c.1004C>T	c.(1003-1005)GCC>GTC	p.A335V	GABRA6_uc003lyv.2_Missense_Mutation_p.A106V	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	335	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ACACAGAAGGCCAAAAGGAAG	0.438										TCGA Ovarian(5;0.080)			23	67	---	---	---	---	capture	Missense_Mutation	SNP	161119124	161119124	GABRA6	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6107	94
TLX3	30012	broad.mit.edu	37	5	170736674	170736674	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:170736674C>T	uc003mbf.2	+	1	387	c.305C>T	c.(304-306)CCG>CTG	p.P102L	uc003mbe.1_5'Flank	NM_021025	NP_066305	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	102						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCCGTGCCACCGCCTCTGCCA	0.701			T	BCL11B	T-ALL								7	17	---	---	---	---	capture	Missense_Mutation	SNP	170736674	170736674	TLX3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15847	94
DNAH11	8701	broad.mit.edu	37	7	21784532	21784532	+	Silent	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21784532C>T	uc003svc.2	+	52	8413	c.8382C>T	c.(8380-8382)TGC>TGT	p.C2794C		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2794					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TCATTTATTGCCACTTTGCTG	0.448									Kartagener_syndrome				3	13	---	---	---	---	capture	Silent	SNP	21784532	21784532	DNAH11	7	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	4557	94
OR6V1	346517	broad.mit.edu	37	7	142749846	142749846	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142749846G>T	uc011ksv.1	+	1	409	c.409G>T	c.(409-411)GCT>TCT	p.A137S		NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.059)					GATGAGCCGGGCTATGTGTGT	0.597													36	111	---	---	---	---	capture	Missense_Mutation	SNP	142749846	142749846	OR6V1	7	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	11115	94
TEX15	56154	broad.mit.edu	37	8	30695499	30695499	+	Silent	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30695499C>T	uc003xil.2	-	3	7152	c.7152G>A	c.(7150-7152)ACG>ACA	p.T2384T		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2384										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CCTTTTTTGGCGTTAAATGAT	0.388													27	89	---	---	---	---	capture	Silent	SNP	30695499	30695499	TEX15	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15664	94
GPR124	25960	broad.mit.edu	37	8	37697018	37697018	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:37697018T>C	uc003xkj.2	+	16	2752	c.2389T>C	c.(2389-2391)TCC>CCC	p.S797P	GPR124_uc010lvy.2_Missense_Mutation_p.S580P	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor	797	Cytoplasmic (Potential).				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TCCGGGCAGCTCCATCCGTGT	0.592													23	49	---	---	---	---	capture	Missense_Mutation	SNP	37697018	37697018	GPR124	8	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	6572	94
TBC1D2	55357	broad.mit.edu	37	9	101014108	101014108	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101014108G>A	uc011lvb.1	-	2	650	c.470C>T	c.(469-471)GCC>GTC	p.A157V	TBC1D2_uc004ayq.2_Missense_Mutation_p.A157V|TBC1D2_uc004ayr.2_Intron|TBC1D2_uc004ayo.3_Missense_Mutation_p.A157V	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	157	Interaction with CADH1.					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		AGCCAGGGCGGCATCAGGGGT	0.637													4	156	---	---	---	---	capture	Missense_Mutation	SNP	101014108	101014108	TBC1D2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15496	94
TTLL11	158135	broad.mit.edu	37	9	124751932	124751932	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:124751932C>T	uc004blt.1	-	4	1269	c.1081G>A	c.(1081-1083)GCA>ACA	p.A361T	TTLL11_uc011lyl.1_Missense_Mutation_p.A361T|TTLL11_uc004blr.2_RNA|TTLL11_uc011lym.1_Missense_Mutation_p.A38T|TTLL11_uc004blu.1_3'UTR	NM_194252	NP_919228	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	361	TTL.				protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						AGGGTCCCTGCCAGGCGGATG	0.517													52	132	---	---	---	---	capture	Missense_Mutation	SNP	124751932	124751932	TTLL11	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16606	94
TTLL11	158135	broad.mit.edu	37	9	124794081	124794081	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:124794081T>A	uc004blt.1	-	3	1072	c.884A>T	c.(883-885)CAG>CTG	p.Q295L	TTLL11_uc011lyl.1_Missense_Mutation_p.Q295L|TTLL11_uc004blr.2_Intron|TTLL11_uc011lym.1_Intron|TTLL11_uc004blu.1_Intron	NM_194252	NP_919228	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	295	TTL.				protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						AAAGAGATTCTGCATGGTTCT	0.507													31	69	---	---	---	---	capture	Missense_Mutation	SNP	124794081	124794081	TTLL11	9	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	16606	94
SOX13	9580	broad.mit.edu	37	1	204085764	204085766	+	In_Frame_Del	DEL	AGC	-	-			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204085764_204085766delAGC	uc001ham.2	+	5	1143_1145	c.548_550delAGC	c.(547-552)AAGCAG>AAG	p.Q187del	SOX13_uc001hal.2_In_Frame_Del_p.Q187del|SOX13_uc010pqp.1_In_Frame_Del_p.Q187del|SOX13_uc010pqq.1_In_Frame_Del_p.Q54del	NM_005686	NP_005677	Q9UN79	SOX13_HUMAN	SRY-box 13	187	Gln-rich.				anatomical structure morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CTGTTTGAGAAGCAGCAGCAGCA	0.576													8	1913	---	---	---	---	capture_indel	In_Frame_Del	DEL	204085764	204085766	SOX13	1	AGC	-	-	-	1	0	1	0	1	0	0	0	0	39	3	5	5	14836	94
REN	5972	broad.mit.edu	37	1	204135375	204135377	+	In_Frame_Del	DEL	AGC	-	-	rs121917743;rs142739309		TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204135375_204135377delAGC	uc001haq.2	-	1	89_91	c.45_47delGCT	c.(43-48)CTGCTC>CTC	p.15_16LL>L		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	15_16			L -> R (in HNFJ2; affects ER translocation and processing of nascent preprorenin, resulting in abolished prorenin and renin biosynthesis and secretion).		angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GGAGCCCCAGAGCAGCAGCAGCA	0.581													8	1918	---	---	---	---	capture_indel	In_Frame_Del	DEL	204135375	204135377	REN	1	AGC	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	13119	94
MYO15A	51168	broad.mit.edu	37	17	18024801	18024801	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-5411-01	TCGA-06-5411-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18024801delG	uc010vxh.1	+	2	3025	c.2687delG	c.(2686-2688)AGGfs	p.R896fs		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	896	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					CGACCGCCCAGGGCCGGGGCC	0.741													5	1	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	18024801	18024801	MYO15A	17	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	9973	94
