Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA1751	85452	broad.mit.edu	37	1	1918455	1918455	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1918455G>A	uc001aim.1	-	5	472	c.316C>T	c.(316-318)CGG>TGG	p.R106W	KIAA1751_uc009vkz.1_Missense_Mutation_p.R106W|KIAA1751_uc001ain.1_Missense_Mutation_p.R106W	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	106										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CGCCTCTGCCGACAGGCGCGC	0.632													45	64	---	---	---	---	capture	Missense_Mutation	SNP	1918455	1918455	KIAA1751	1	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	8178	96
EIF4G3	8672	broad.mit.edu	37	1	21268743	21268743	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21268743G>C	uc001bec.2	-	9	992	c.736C>G	c.(736-738)CAA>GAA	p.Q246E	EIF4G3_uc010odi.1_5'UTR|EIF4G3_uc010odj.1_Missense_Mutation_p.Q245E|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Missense_Mutation_p.Q246E|EIF4G3_uc001bef.2_Missense_Mutation_p.Q245E|EIF4G3_uc001bee.2_Missense_Mutation_p.Q252E|EIF4G3_uc001beg.2_Missense_Mutation_p.Q245E|EIF4G3_uc010odk.1_Missense_Mutation_p.Q246E|EIF4G3_uc001beh.2_Missense_Mutation_p.Q257E	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	246					interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TGGCCTTCTTGTTCTTTCTTC	0.448													43	80	---	---	---	---	capture	Missense_Mutation	SNP	21268743	21268743	EIF4G3	1	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	4993	96
OVGP1	5016	broad.mit.edu	37	1	111957411	111957411	+	Missense_Mutation	SNP	C	T	T	rs150120731	byFrequency	TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111957411C>T	uc001eba.2	-	11	1768	c.1712G>A	c.(1711-1713)CGT>CAT	p.R571H	OVGP1_uc001eaz.2_Missense_Mutation_p.R533H|OVGP1_uc010owb.1_Missense_Mutation_p.R219H	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	571					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		CACCTTTTCACGGGCCACAGC	0.527													4	140	---	---	---	---	capture	Missense_Mutation	SNP	111957411	111957411	OVGP1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11229	96
SH2D1B	117157	broad.mit.edu	37	1	162368789	162368789	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:162368789T>C	uc001gbz.1	-	3	409	c.287A>G	c.(286-288)CAC>CGC	p.H96R	SH2D1B_uc001gca.1_Intron	NM_053282	NP_444512	O14796	SH21B_HUMAN	SH2 domain containing 1B	96	SH2.									pancreas(1)	1	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			CTTTAAAAGGTGAACCACCAT	0.423													32	48	---	---	---	---	capture	Missense_Mutation	SNP	162368789	162368789	SH2D1B	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	14124	96
RYR2	6262	broad.mit.edu	37	1	237947200	237947200	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237947200C>T	uc001hyl.1	+	90	12308	c.12188C>T	c.(12187-12189)ACG>ATG	p.T4063M	RYR2_uc010pya.1_Missense_Mutation_p.T478M	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4063					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGTCAGAAACGGAATTTCTT	0.483													5	13	---	---	---	---	capture	Missense_Mutation	SNP	237947200	237947200	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13661	96
OR2T3	343173	broad.mit.edu	37	1	248637275	248637275	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248637275C>A	uc001iel.1	+	1	624	c.624C>A	c.(622-624)TGC>TGA	p.C208*		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	208	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCTGTGCTGCATCCTCATGC	0.532													4	114	---	---	---	---	capture	Nonsense_Mutation	SNP	248637275	248637275	OR2T3	1	C	A	A	A	1	0	0	0	0	0	1	0	0	324	25	5	4	10927	96
CTNNA3	29119	broad.mit.edu	37	10	69407205	69407205	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:69407205C>T	uc009xpn.1	-	2	190	c.67G>A	c.(67-69)GTG>ATG	p.V23M	CTNNA3_uc001jmw.2_Missense_Mutation_p.V23M|CTNNA3_uc001jmx.3_Missense_Mutation_p.V23M|CTNNA3_uc009xpo.1_Translation_Start_Site|CTNNA3_uc001jna.2_Missense_Mutation_p.V35M	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	23					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						AGCTTCTCCACGGTGAATGTT	0.393													25	25	---	---	---	---	capture	Missense_Mutation	SNP	69407205	69407205	CTNNA3	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3977	96
TTC17	55761	broad.mit.edu	37	11	43411222	43411222	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:43411222A>C	uc001mxi.2	+	3	284	c.270A>C	c.(268-270)AAA>AAC	p.K90N	TTC17_uc001mxh.2_Missense_Mutation_p.K90N|TTC17_uc010rfj.1_Missense_Mutation_p.K33N	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	90							binding			ovary(5)	5						TTGCTCAAAAAATTCACATAG	0.393													33	55	---	---	---	---	capture	Missense_Mutation	SNP	43411222	43411222	TTC17	11	A	C	C	C	1	0	0	0	0	1	0	0	0	11	1	4	4	16566	96
OR4D9	390199	broad.mit.edu	37	11	59282555	59282555	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59282555C>T	uc010rkv.1	+	1	170	c.170C>T	c.(169-171)ACG>ATG	p.T57M		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	57	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CACCTTCATACGCCCATGTAC	0.433													65	137	---	---	---	---	capture	Missense_Mutation	SNP	59282555	59282555	OR4D9	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10963	96
GLB1L3	112937	broad.mit.edu	37	11	134182345	134182345	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:134182345G>A	uc009zdf.2	+	14	1750	c.1390G>A	c.(1390-1392)GGA>AGA	p.G464R	GLB1L3_uc001qho.3_RNA	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3	464					carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		CATCTGCTCCGGAGGCCGCCT	0.607													16	44	---	---	---	---	capture	Missense_Mutation	SNP	134182345	134182345	GLB1L3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6366	96
KLRD1	3824	broad.mit.edu	37	12	10466085	10466085	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10466085A>T	uc001qxw.3	+	6	589	c.392A>T	c.(391-393)GAG>GTG	p.E131V	KLRD1_uc001qxx.3_Missense_Mutation_p.E131V|KLRD1_uc001qxy.3_Missense_Mutation_p.E100V|KLRD1_uc009zhh.2_Missense_Mutation_p.E110V|KLRD1_uc009zhi.2_3'UTR|KLRD1_uc001qxz.3_Missense_Mutation_p.E132V	NM_001114396	NP_001107868	Q13241	KLRD1_HUMAN	killer cell lectin-like receptor subfamily D,	131	Extracellular (Potential).|C-type lectin.				cell surface receptor linked signaling pathway|regulation of immune response	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0						TGGTTGTGGGAGAATGGCTCT	0.418													49	77	---	---	---	---	capture	Missense_Mutation	SNP	10466085	10466085	KLRD1	12	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	8339	96
TEP1	7011	broad.mit.edu	37	14	20848171	20848171	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20848171A>G	uc001vxe.2	-	35	5085	c.5045T>C	c.(5044-5046)GTG>GCG	p.V1682A	TEP1_uc010ahk.2_Missense_Mutation_p.V1025A|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.V1574A|TEP1_uc010tlh.1_Missense_Mutation_p.V20A	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1682	WD 2.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GGAGAAGGCCACAGCAGTAGG	0.507													17	43	---	---	---	---	capture	Missense_Mutation	SNP	20848171	20848171	TEP1	14	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	15644	96
TMEM229B	161145	broad.mit.edu	37	14	67940502	67940502	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:67940502C>T	uc001xjk.2	-	3	549	c.139G>A	c.(139-141)GTG>ATG	p.V47M	TMEM229B_uc001xjj.1_RNA	NM_182526	NP_872332	Q8NBD8	T229B_HUMAN	transmembrane protein 229B	47	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1						AGGGCCCACACGCTCGTGACC	0.617													3	46	---	---	---	---	capture	Missense_Mutation	SNP	67940502	67940502	TMEM229B	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16031	96
PTX4	390667	broad.mit.edu	37	16	1537571	1537571	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1537571C>T	uc010uvf.1	-	2	527	c.527G>A	c.(526-528)GGC>GAC	p.G176D		NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN	neuronal pentraxin II-like	181						extracellular region	metal ion binding				0						GGCTGCAGTGCCAGGGTGGGC	0.726													16	20	---	---	---	---	capture	Missense_Mutation	SNP	1537571	1537571	PTX4	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12718	96
PRKCB	5579	broad.mit.edu	37	16	24104126	24104126	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24104126A>T	uc002dmd.2	+	6	741	c.544A>T	c.(544-546)AAC>TAC	p.N182Y	PRKCB_uc002dme.2_Missense_Mutation_p.N182Y	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	182	C2.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	AGATGCTAAAAACCTTGTACC	0.418													34	102	---	---	---	---	capture	Missense_Mutation	SNP	24104126	24104126	PRKCB	16	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	12404	96
SPNS1	83985	broad.mit.edu	37	16	28992797	28992797	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28992797C>A	uc010vdi.1	+	7	810	c.670C>A	c.(670-672)CCG>ACG	p.P224T	uc010vct.1_Intron|SPNS1_uc002drx.2_Missense_Mutation_p.P151T|SPNS1_uc002dsa.2_Missense_Mutation_p.P224T|SPNS1_uc002drz.2_Missense_Mutation_p.P224T|SPNS1_uc010byp.2_Missense_Mutation_p.P202T|SPNS1_uc010byq.1_Missense_Mutation_p.P156T	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	224	Helical; (Potential).				lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						CCAGGTGACACCGGGTCTAGG	0.622											OREG0023712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	49	---	---	---	---	capture	Missense_Mutation	SNP	28992797	28992797	SPNS1	16	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	14966	96
SETD1A	9739	broad.mit.edu	37	16	30970183	30970183	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30970183G>A	uc002ead.1	+	2	817	c.131G>A	c.(130-132)GGA>GAA	p.G44E	SETD1A_uc002eae.1_Missense_Mutation_p.G44E	NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	44					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CGCTATGATGGAGTCCACTTC	0.597													32	87	---	---	---	---	capture	Missense_Mutation	SNP	30970183	30970183	SETD1A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	14023	96
PLD2	5338	broad.mit.edu	37	17	4714202	4714202	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4714202G>A	uc002fzc.2	+	10	1067	c.966G>A	c.(964-966)CGG>CGA	p.R322R	PLD2_uc010vsj.1_Silent_p.R179R|PLD2_uc002fzd.2_Silent_p.R322R	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2	322					cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	AGCTGCACCGGCATGACAGCT	0.617													4	116	---	---	---	---	capture	Silent	SNP	4714202	4714202	PLD2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	11949	96
ZPBP2	124626	broad.mit.edu	37	17	38027064	38027064	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38027064C>T	uc002hte.2	+	3	389	c.236C>T	c.(235-237)ACG>ATG	p.T79M	ZPBP2_uc002htf.2_Missense_Mutation_p.T57M	NM_199321	NP_955353	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2 isoform 2	79					binding of sperm to zona pellucida	extracellular region				ovary(1)	1	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			AATGAAAAGACGTTAACAGGT	0.284													16	38	---	---	---	---	capture	Missense_Mutation	SNP	38027064	38027064	ZPBP2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18096	96
AKAP1	8165	broad.mit.edu	37	17	55189944	55189944	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:55189944T>A	uc002iux.2	+	5	2299	c.2068T>A	c.(2068-2070)TCA>ACA	p.S690T	AKAP1_uc010wnl.1_Missense_Mutation_p.S690T|AKAP1_uc002iuy.2_RNA|AKAP1_uc010dcm.2_Missense_Mutation_p.S690T	NM_003488	NP_003479	Q92667	AKAP1_HUMAN	A-kinase anchor protein 1 precursor	690					blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding			ovary(1)	1	Breast(9;5.46e-08)					CCCATTGCCTTCACTGGCACT	0.502													29	36	---	---	---	---	capture	Missense_Mutation	SNP	55189944	55189944	AKAP1	17	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	445	96
MPO	4353	broad.mit.edu	37	17	56352985	56352985	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56352985G>C	uc002ivu.1	-	8	1460	c.1283C>G	c.(1282-1284)ACA>AGA	p.T428R		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	428					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	CTTGAGCTCTGTGGCCAGCCG	0.617													18	36	---	---	---	---	capture	Missense_Mutation	SNP	56352985	56352985	MPO	17	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	9644	96
LRP3	4037	broad.mit.edu	37	19	33696170	33696170	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33696170C>G	uc010edh.2	+	5	587	c.494C>G	c.(493-495)TCC>TGC	p.S165C	LRP3_uc010xrp.1_Missense_Mutation_p.S39C|LRP3_uc002nuk.3_Missense_Mutation_p.S39C	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	165	Extracellular (Potential).|LDL-receptor class A 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					GGCCAGGCATCCTGCCAGGCA	0.662													8	13	---	---	---	---	capture	Missense_Mutation	SNP	33696170	33696170	LRP3	19	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	8874	96
ZNF540	163255	broad.mit.edu	37	19	38103381	38103381	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38103381G>A	uc002ogq.2	+	5	1532	c.1200G>A	c.(1198-1200)CGG>CGA	p.R400R	ZNF540_uc002ogu.2_Silent_p.R400R|ZNF540_uc010efq.2_Silent_p.R368R	NM_152606	NP_689819	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	400	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGCTTAATCGGCATAAAACAA	0.373													4	119	---	---	---	---	capture	Silent	SNP	38103381	38103381	ZNF540	19	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	17854	96
NCR1	9437	broad.mit.edu	37	19	55420766	55420766	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55420766C>T	uc002qib.2	+	4	556	c.518C>T	c.(517-519)GCG>GTG	p.A173V	NCR1_uc002qic.2_Missense_Mutation_p.A173V|NCR1_uc002qie.2_Missense_Mutation_p.A173V|NCR1_uc002qid.2_Missense_Mutation_p.A78V|NCR1_uc002qif.2_Missense_Mutation_p.A78V|NCR1_uc010esj.2_Missense_Mutation_p.A66V	NM_004829	NP_004820	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	173	Extracellular (Potential).|Ig-like 2.				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(193;0.0449)		AAGGTCCAGGCGGAGTTCCCC	0.572													40	80	---	---	---	---	capture	Missense_Mutation	SNP	55420766	55420766	NCR1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10144	96
APOB	338	broad.mit.edu	37	2	21228712	21228712	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21228712G>A	uc002red.2	-	26	11156	c.11028C>T	c.(11026-11028)ATC>ATT	p.I3676I		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3676					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AGACTGGTAGGATGATATTTT	0.453													15	33	---	---	---	---	capture	Silent	SNP	21228712	21228712	APOB	2	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	778	96
NLRC4	58484	broad.mit.edu	37	2	32460481	32460481	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32460481A>C	uc002roi.2	-	8	3017	c.2771T>G	c.(2770-2772)ATT>AGT	p.I924S	NLRC4_uc002roj.1_Missense_Mutation_p.I924S|NLRC4_uc010ezt.1_Missense_Mutation_p.I259S	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12	924	LRR 11.				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TAAAATTCTAATCTCTGTATC	0.428													6	220	---	---	---	---	capture	Missense_Mutation	SNP	32460481	32460481	NLRC4	2	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	10376	96
CEP68	23177	broad.mit.edu	37	2	65296848	65296848	+	Silent	SNP	C	A	A	rs112673076		TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:65296848C>A	uc002sdl.3	+	2	484	c.270C>A	c.(268-270)CCC>CCA	p.P90P	CEP68_uc002sdj.2_Silent_p.P90P|CEP68_uc010yqb.1_Silent_p.P90P|CEP68_uc002sdk.3_Silent_p.P90P|CEP68_uc010yqc.1_Silent_p.P90P|CEP68_uc010yqd.1_Silent_p.P90P	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	90					centrosome organization	centrosome				skin(1)	1						ACAGAGAGCCCGTAGCTGAGA	0.627													4	96	---	---	---	---	capture	Silent	SNP	65296848	65296848	CEP68	2	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	3226	96
FAM123C	205147	broad.mit.edu	37	2	131520873	131520873	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131520873G>A	uc002trw.2	+	2	1418	c.1228G>A	c.(1228-1230)GCC>ACC	p.A410T	FAM123C_uc010fmv.2_Missense_Mutation_p.A410T|FAM123C_uc010fms.1_Missense_Mutation_p.A410T|FAM123C_uc010fmt.1_Missense_Mutation_p.A410T|FAM123C_uc010fmu.1_Missense_Mutation_p.A410T	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	410										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CACTCCTGCCGCCACCTTCCC	0.617													28	56	---	---	---	---	capture	Missense_Mutation	SNP	131520873	131520873	FAM123C	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5378	96
SCN3A	6328	broad.mit.edu	37	2	165997260	165997260	+	Silent	SNP	T	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:165997260T>C	uc002ucx.2	-	13	2412	c.1920A>G	c.(1918-1920)GCA>GCG	p.A640A	SCN3A_uc002ucy.2_Intron|SCN3A_uc002ucz.2_Intron|SCN3A_uc002uda.1_Intron|SCN3A_uc002udb.1_Intron	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	640						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	TCTTCCCATTTGCTGGAAGCC	0.542													11	21	---	---	---	---	capture	Silent	SNP	165997260	165997260	SCN3A	2	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	13811	96
TTN	7273	broad.mit.edu	37	2	179647077	179647077	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179647077G>A	uc010zfg.1	-	20	3466	c.3242C>T	c.(3241-3243)GCG>GTG	p.A1081V	TTN_uc010zfh.1_Missense_Mutation_p.A1035V|TTN_uc010zfi.1_Missense_Mutation_p.A1035V|TTN_uc010zfj.1_Missense_Mutation_p.A1035V|TTN_uc002unb.2_Missense_Mutation_p.A1081V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1081							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAGTAAGGCGCGGCAGGTTC	0.502													21	28	---	---	---	---	capture	Missense_Mutation	SNP	179647077	179647077	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16617	96
MARS2	92935	broad.mit.edu	37	2	198570303	198570303	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198570303G>A	uc002uuq.2	+	1	217	c.174G>A	c.(172-174)CCG>CCA	p.P58P	uc002uup.2_Intron	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN	methionine-tRNA synthetase 2 precursor	58	HIGH region.				methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					L-Methionine(DB00134)	ACGCGGCGCCGCACATCGGGC	0.642													3	46	---	---	---	---	capture	Silent	SNP	198570303	198570303	MARS2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9230	96
HDLBP	3069	broad.mit.edu	37	2	242202197	242202197	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242202197T>C	uc002waz.2	-	5	607	c.379A>G	c.(379-381)ATC>GTC	p.I127V	HDLBP_uc002wba.2_Missense_Mutation_p.I127V|HDLBP_uc002wbb.2_Missense_Mutation_p.I148V|HDLBP_uc010fzn.1_Intron|uc010zoo.1_5'Flank	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	127					cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GACACCATGATGGAGAGGCCT	0.512													37	63	---	---	---	---	capture	Missense_Mutation	SNP	242202197	242202197	HDLBP	2	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	6952	96
HM13	81502	broad.mit.edu	37	20	30136902	30136902	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30136902G>T	uc002wwe.2	+	5	639	c.525G>T	c.(523-525)TGG>TGT	p.W175C	HM13_uc002wwc.2_Missense_Mutation_p.W175C|HM13_uc002wwd.2_Missense_Mutation_p.W175C|HM13_uc002wwf.2_Missense_Mutation_p.W51C|HM13_uc010gdu.2_Missense_Mutation_p.W51C	NM_030789	NP_110416	Q8TCT9	HM13_HUMAN	minor histocompatibility antigen 13 isoform 1	175	Cytoplasmic (Potential).				membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TTGGCGTCTGGTACCTGCTGA	0.577													110	271	---	---	---	---	capture	Missense_Mutation	SNP	30136902	30136902	HM13	20	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	7142	96
HUNK	30811	broad.mit.edu	37	21	33296873	33296873	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33296873C>T	uc002yph.2	+	2	715	c.355C>T	c.(355-357)CGC>TGC	p.R119C		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	119	Protein kinase.				multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						GCAGATGATCCGCCACCCCAA	0.488													20	51	---	---	---	---	capture	Missense_Mutation	SNP	33296873	33296873	HUNK	21	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7383	96
LZTR1	8216	broad.mit.edu	37	22	21344765	21344765	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21344765G>A	uc002zto.2	+	8	845	c.742G>A	c.(742-744)GGA>AGA	p.G248R	LZTR1_uc002ztn.2_Missense_Mutation_p.G207R|LZTR1_uc011ahy.1_Missense_Mutation_p.G229R|LZTR1_uc010gsr.1_Missense_Mutation_p.G119R	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	248	Kelch 4.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TGGGCAAAGCGGAGCCAAAAT	0.562													45	29	---	---	---	---	capture	Missense_Mutation	SNP	21344765	21344765	LZTR1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9052	96
SLC6A20	54716	broad.mit.edu	37	3	45800488	45800488	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45800488G>A	uc011bai.1	-	11	1885	c.1761C>T	c.(1759-1761)GAC>GAT	p.D587D	SLC6A20_uc003cow.2_Silent_p.D237D|SLC6A20_uc011baj.1_Silent_p.D550D	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1	587	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		CGGGGTCTGCGTCTCCCCTCT	0.577													21	50	---	---	---	---	capture	Silent	SNP	45800488	45800488	SLC6A20	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14576	96
NISCH	11188	broad.mit.edu	37	3	52525480	52525480	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52525480G>A	uc011beg.1	+	21	3927	c.3855G>A	c.(3853-3855)CCG>CCA	p.P1285P	NISCH_uc003ded.3_Silent_p.P1285P|NISCH_uc003dee.3_Silent_p.P774P|NISCH_uc003deg.1_RNA|NISCH_uc003deh.3_Silent_p.P34P	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	1285					apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		CGCCCTCGCCGGAGCCTGTTG	0.602													27	28	---	---	---	---	capture	Silent	SNP	52525480	52525480	NISCH	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10339	96
IL17RD	54756	broad.mit.edu	37	3	57132318	57132318	+	Silent	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:57132318C>T	uc003dil.2	-	12	1502	c.1413G>A	c.(1411-1413)GCG>GCA	p.A471A	IL17RD_uc003dik.2_Silent_p.A447A|IL17RD_uc010hna.2_Silent_p.A327A|IL17RD_uc011bex.1_Silent_p.A327A	NM_017563	NP_060033	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D precursor	471	SEFIR.|Cytoplasmic (Potential).					Golgi membrane|integral to membrane|plasma membrane	receptor activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		ACTTGCTGAGCGCCGCGGACG	0.572													18	36	---	---	---	---	capture	Silent	SNP	57132318	57132318	IL17RD	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7565	96
CD86	942	broad.mit.edu	37	3	121828238	121828238	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121828238G>A	uc003eet.2	+	5	946	c.830G>A	c.(829-831)CGC>CAC	p.R277H	CD86_uc011bjo.1_Missense_Mutation_p.R195H|CD86_uc011bjp.1_Missense_Mutation_p.R165H|CD86_uc003eeu.2_Missense_Mutation_p.R271H	NM_175862	NP_787058	P42081	CD86_HUMAN	CD86 antigen isoform 1	277	Cytoplasmic (Potential).				interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation		coreceptor activity|protein binding			pancreas(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)	AAGCGGCCTCGCAACTCTTAT	0.468													35	89	---	---	---	---	capture	Missense_Mutation	SNP	121828238	121828238	CD86	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3014	96
PIK3CA	5290	broad.mit.edu	37	3	178916728	178916728	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916728G>A	uc003fjk.2	+	2	272	c.115G>A	c.(115-117)GAG>AAG	p.E39K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	39	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E39K(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			ATGCCTCCGTGAGGCTACATT	0.388		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			37	57	---	---	---	---	capture	Missense_Mutation	SNP	178916728	178916728	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11816	96
SLC4A4	8671	broad.mit.edu	37	4	72399971	72399971	+	Missense_Mutation	SNP	G	A	A	rs150967020		TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:72399971G>A	uc003hfy.2	+	18	2425	c.2308G>A	c.(2308-2310)GTT>ATT	p.V770I	SLC4A4_uc010iic.2_Missense_Mutation_p.V770I|SLC4A4_uc010iib.2_Missense_Mutation_p.V770I|SLC4A4_uc003hfz.2_Missense_Mutation_p.V770I|SLC4A4_uc003hgc.3_Missense_Mutation_p.V726I|SLC4A4_uc010iid.2_5'UTR	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	770	Interaction with CA4.|Extracellular (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			AGGTTGGTTCGTTCCACCGTT	0.423													3	17	---	---	---	---	capture	Missense_Mutation	SNP	72399971	72399971	SLC4A4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14548	96
PPEF2	5470	broad.mit.edu	37	4	76797822	76797822	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76797822A>G	uc003hix.2	-	11	1295	c.938T>C	c.(937-939)GTT>GCT	p.V313A	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.V313A	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	313	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CATGGTGGAAACTATCTAAAC	0.388													34	57	---	---	---	---	capture	Missense_Mutation	SNP	76797822	76797822	PPEF2	4	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	12209	96
MAPK10	5602	broad.mit.edu	37	4	87028499	87028499	+	Silent	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:87028499C>T	uc003hpq.2	-	4	310	c.243G>A	c.(241-243)GCG>GCA	p.A81A	MAPK10_uc010ikg.2_Silent_p.A43A|MAPK10_uc003hpr.2_Silent_p.A43A|MAPK10_uc003hps.2_Silent_p.A81A|MAPK10_uc003hpt.2_Silent_p.A81A|MAPK10_uc003hpu.2_Silent_p.A81A|MAPK10_uc003hpv.2_5'UTR|MAPK10_uc010ikh.1_RNA|MAPK10_uc003hpo.2_5'UTR|MAPK10_uc011ccw.1_5'UTR|MAPK10_uc003hpp.2_5'UTR	NM_138982	NP_620448	P53779	MK10_HUMAN	mitogen-activated protein kinase 10 isoform 2	81	Protein kinase.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		CAGCATCATACGCGGCACTGT	0.443													4	20	---	---	---	---	capture	Silent	SNP	87028499	87028499	MAPK10	4	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	9185	96
BBS12	166379	broad.mit.edu	37	4	123665161	123665161	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123665161C>T	uc003ieu.2	+	2	2307	c.2114C>T	c.(2113-2115)ACG>ATG	p.T705M		NM_152618	NP_689831	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	705					cellular protein metabolic process	cilium	ATP binding			ovary(2)	2						CAGGAATTAACGGGCTTTCTA	0.348									Bardet-Biedl_syndrome				30	78	---	---	---	---	capture	Missense_Mutation	SNP	123665161	123665161	BBS12	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1326	96
PLK4	10733	broad.mit.edu	37	4	128807278	128807278	+	Silent	SNP	A	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:128807278A>T	uc003ifo.2	+	5	998	c.753A>T	c.(751-753)GCA>GCT	p.A251A	PLK4_uc011cgs.1_Silent_p.A219A|PLK4_uc011cgt.1_Silent_p.A210A	NM_014264	NP_055079	O00444	PLK4_HUMAN	polo-like kinase 4	251	Protein kinase.				G2/M transition of mitotic cell cycle|positive regulation of centriole replication|trophoblast giant cell differentiation	centriole|cleavage furrow|cytosol|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						GAAATCCAGCAGATCGTTTAA	0.353													54	115	---	---	---	---	capture	Silent	SNP	128807278	128807278	PLK4	4	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	12001	96
ADAMTS12	81792	broad.mit.edu	37	5	33549384	33549384	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33549384G>A	uc003jia.1	-	21	4393	c.4230C>T	c.(4228-4230)GGC>GGT	p.G1410G	ADAMTS12_uc010iuq.1_Silent_p.G1325G	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1410	TSP type-1 6.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						GGGGAGGAATGCCGGCCAGGA	0.612										HNSCC(64;0.19)			19	61	---	---	---	---	capture	Silent	SNP	33549384	33549384	ADAMTS12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	257	96
IL3	3562	broad.mit.edu	37	5	131396547	131396547	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131396547C>T	uc003kwe.1	+	1	201	c.148C>T	c.(148-150)CCT>TCT	p.P50S		NM_000588	NP_000579	P08700	IL3_HUMAN	interleukin 3 precursor	50					cell-cell signaling|immune response|nervous system development|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of survival gene product expression|positive regulation of tyrosine phosphorylation of Stat5 protein	extracellular space	cytokine activity|growth factor activity|interleukin-3 receptor binding			ovary(2)|central_nervous_system(1)	3		all_cancers(142;7.42e-12)|Lung NSC(810;4.25e-07)|all_lung(232;1.93e-06)|Prostate(281;0.00741)|Breast(839;0.0544)|Lung SC(612;0.122)|Ovarian(839;0.223)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.0161)|Lung(113;0.105)	Amlexanox(DB01025)	AAAGCAGCCACCTTTGCCTTT	0.522													44	74	---	---	---	---	capture	Missense_Mutation	SNP	131396547	131396547	IL3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	7612	96
FAT2	2196	broad.mit.edu	37	5	150947262	150947262	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150947262G>A	uc003lue.3	-	1	1244	c.1231C>T	c.(1231-1233)CGA>TGA	p.R411*	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Nonsense_Mutation_p.R411*	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	411	Extracellular (Potential).|Cadherin 3.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AACCCAGTTCGAGCATTAAGT	0.532													37	86	---	---	---	---	capture	Nonsense_Mutation	SNP	150947262	150947262	FAT2	5	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	5636	96
BRPF3	27154	broad.mit.edu	37	6	36185728	36185728	+	Silent	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36185728C>T	uc003olv.3	+	9	3248	c.3024C>T	c.(3022-3024)AGC>AGT	p.S1008S	BRPF3_uc010jwb.2_Silent_p.S738S|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Intron|BRPF3_uc010jwd.2_5'UTR	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	1008					histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						ACACCGAAAGCGGGTCTGACT	0.512													27	63	---	---	---	---	capture	Silent	SNP	36185728	36185728	BRPF3	6	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	1509	96
LGSN	51557	broad.mit.edu	37	6	63990385	63990385	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:63990385G>A	uc003peh.2	-	4	1105	c.1071C>T	c.(1069-1071)TGC>TGT	p.C357C	LGSN_uc003pei.2_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	357					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	GCGCCATCAGGCAGCTGAGCG	0.498													42	36	---	---	---	---	capture	Silent	SNP	63990385	63990385	LGSN	6	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	8679	96
PPIL6	285755	broad.mit.edu	37	6	109752404	109752404	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109752404C>T	uc003ptg.3	-	3	430	c.376G>A	c.(376-378)GCA>ACA	p.A126T	PPIL6_uc010kdo.2_Missense_Mutation_p.A94T|PPIL6_uc010kdp.2_Missense_Mutation_p.A126T	NM_173672	NP_775943	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase-like 6 isoform 1	126					protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		TCAGTGAGTGCGTCATAAAGT	0.393													4	86	---	---	---	---	capture	Missense_Mutation	SNP	109752404	109752404	PPIL6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12232	96
UNC93A	54346	broad.mit.edu	37	6	167704889	167704889	+	Translation_Start_Site	SNP	C	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167704889C>A	uc003qvq.2	+	1	87	c.-88C>A	c.(-90--86)TACTG>TAATG		UNC93A_uc003qvr.2_Translation_Start_Site	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1							integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CTTCTTGGTACTGATTGTTTT	0.398													9	6	---	---	---	---	capture	Translation_Start_Site	SNP	167704889	167704889	UNC93A	6	C	A	A	A	1	0	0	0	0	0	0	0	0	248	20	4	4	16878	96
DAGLB	221955	broad.mit.edu	37	7	6476110	6476110	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6476110C>A	uc003sqa.2	-	3	472	c.302G>T	c.(301-303)CGC>CTC	p.R101L	DAGLB_uc011jwt.1_5'Flank|DAGLB_uc011jwu.1_Missense_Mutation_p.R101L|DAGLB_uc003sqb.2_Intron|DAGLB_uc003sqc.2_Intron|DAGLB_uc011jwv.1_Intron|DAGLB_uc003sqd.3_Missense_Mutation_p.R60L|DAGLB_uc011jww.1_Intron	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1	101	Cytoplasmic (Potential).				lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		CAGCGCCAGGCGGATGTAAAG	0.522													60	174	---	---	---	---	capture	Missense_Mutation	SNP	6476110	6476110	DAGLB	7	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	4186	96
FAM188B	84182	broad.mit.edu	37	7	30915152	30915152	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30915152G>A	uc003tbt.2	+	15	1929	c.1852G>A	c.(1852-1854)GTT>ATT	p.V618I	FAM188B_uc010kwe.2_Missense_Mutation_p.V589I|AQP1_uc011kac.1_5'UTR|FAM188B_uc003tbu.2_Missense_Mutation_p.V138I	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	618											0						TGTGTCCAACGTTTTCAACGA	0.448													112	336	---	---	---	---	capture	Missense_Mutation	SNP	30915152	30915152	FAM188B	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5467	96
EGFR	1956	broad.mit.edu	37	7	55259469	55259469	+	Missense_Mutation	SNP	G	C	C	rs146795390		TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55259469G>C	uc003tqk.2	+	21	2773	c.2527G>C	c.(2527-2529)GTA>CTA	p.V843L	EGFR_uc010kzg.1_Missense_Mutation_p.V798L|EGFR_uc011kco.1_Missense_Mutation_p.V790L|uc003tqo.2_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	843	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V843I(6)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCCAGGAACGTACTGGTGAA	0.537		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			16	938	---	---	---	---	capture	Missense_Mutation	SNP	55259469	55259469	EGFR	7	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	4922	96
PSPH	5723	broad.mit.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56085002C>T	uc003trg.2	-	5	709	c.346G>A	c.(346-348)GTA>ATA	p.V116I	PSPH_uc003trh.2_Missense_Mutation_p.V116I|PSPH_uc003tri.2_Missense_Mutation_p.V116I|PSPH_uc003trj.2_Missense_Mutation_p.V145I	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	116					L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393													4	70	---	---	---	---	capture	Missense_Mutation	SNP	56085002	56085002	PSPH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12612	96
SERPINE1	5054	broad.mit.edu	37	7	100771685	100771685	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100771685C>G	uc003uxt.2	+	2	159	c.11C>G	c.(10-12)TCT>TGT	p.S4C	SERPINE1_uc011kkj.1_Missense_Mutation_p.S4C	NM_000602	NP_000593	P05121	PAI1_HUMAN	plasminogen activator inhibitor-1 isoform 1	4					angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)				Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)	ATGCAGATGTCTCCAGCCCTC	0.622													33	89	---	---	---	---	capture	Missense_Mutation	SNP	100771685	100771685	SERPINE1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	14004	96
OR2A1	346528	broad.mit.edu	37	7	144015519	144015519	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144015519T>G	uc011kud.1	+	1	284	c.284T>G	c.(283-285)TTT>TGT	p.F95C	OR2A9P_uc003wec.1_Intron	NM_001001802	NP_001001802	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A,	101	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Melanoma(164;0.14)					ACGCAGACCTTTCTCTGTTTG	0.572													40	435	---	---	---	---	capture	Missense_Mutation	SNP	144015519	144015519	OR2A1	7	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	10878	96
SSPO	23145	broad.mit.edu	37	7	149493793	149493793	+	Silent	SNP	G	A	A			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149493793G>A	uc010lpk.2	+	46	6789	c.6789G>A	c.(6787-6789)TCG>TCA	p.S2263S		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2263	LDL-receptor class A 8.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGATGGCTCGGATGAGGAGG	0.652													7	24	---	---	---	---	capture	Silent	SNP	149493793	149493793	SSPO	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15081	96
UBE3C	9690	broad.mit.edu	37	7	157046788	157046788	+	Silent	SNP	T	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:157046788T>C	uc010lqs.2	+	20	3147	c.2835T>C	c.(2833-2835)AAT>AAC	p.N945N	UBE3C_uc003wni.3_Silent_p.N308N	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	945	HECT.				protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GCCTTGCCAATGTCGTCAGCC	0.562													19	58	---	---	---	---	capture	Silent	SNP	157046788	157046788	UBE3C	7	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	16763	96
GCNT1	2650	broad.mit.edu	37	9	79118132	79118132	+	Nonsense_Mutation	SNP	G	T	T	rs656106		TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79118132G>T	uc010mpf.2	+	3	1176	c.835G>T	c.(835-837)GAA>TAA	p.E279*	GCNT1_uc010mpg.2_Nonsense_Mutation_p.E279*|GCNT1_uc010mph.2_Nonsense_Mutation_p.E279*|GCNT1_uc004akf.3_Nonsense_Mutation_p.E279*|GCNT1_uc010mpi.2_Nonsense_Mutation_p.E279*|GCNT1_uc004akh.3_Nonsense_Mutation_p.E279*	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	279	Lumenal (Potential).|Catalytic (By similarity).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						TCCTCCACTCGAAACACCTCT	0.463													24	40	---	---	---	---	capture	Nonsense_Mutation	SNP	79118132	79118132	GCNT1	9	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	6240	96
RPL5	6125	broad.mit.edu	37	1	93298955	93298955	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93298955delA	uc001doz.2	+	2	91	c.13delA	c.(13-15)AAAfs	p.K5fs	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_RNA|RPL5_uc001dpb.2_5'UTR|RPL5_uc001dpd.2_5'Flank	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5	5					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		GGGGTTTGTTAAAGTTGTTAA	0.299													36	66	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	93298955	93298955	RPL5	1	A	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	13489	96
CHD8	57680	broad.mit.edu	37	14	21860822	21860832	+	Frame_Shift_Del	DEL	AGGAGTCAATG	-	-			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21860822_21860832delAGGAGTCAATG	uc001was.1	-	34	5862_5872	c.5768_5778delCATTGACTCCT	c.(5767-5778)TCATTGACTCCTfs	p.S1923fs	CHD8_uc001war.1_Frame_Shift_Del_p.S1819fs|SNORD9_uc001wat.1_5'Flank	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2202_2205					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CATATTCTCCAGGAGTCAATGAGGGACTGTC	0.555													40	139	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	21860822	21860832	CHD8	14	AGGAGTCAATG	-	-	-	1	0	1	0	1	0	0	0	0	80	7	5	5	3297	96
DEPDC5	9681	broad.mit.edu	37	22	32198714	32198715	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32198714_32198715insC	uc003als.2	+	15	1113_1114	c.971_972insC	c.(970-972)CGCfs	p.R324fs	DEPDC5_uc011als.1_Frame_Shift_Ins_p.R324fs|DEPDC5_uc011alu.1_Frame_Shift_Ins_p.R324fs|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Frame_Shift_Ins_p.R324fs|DEPDC5_uc003alr.1_Frame_Shift_Ins_p.R324fs|DEPDC5_uc011alt.1_Frame_Shift_Ins_p.R296fs	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	324					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						TACATCAACCGCAACTTTGACC	0.446													63	62	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	32198714	32198715	DEPDC5	22	-	C	C	C	1	0	1	1	0	0	0	0	0	494	38	5	5	4400	96
SBF1	6305	broad.mit.edu	37	22	50895482	50895483	+	In_Frame_Ins	INS	-	GAGGCC	GAGGCC			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50895482_50895483insGAGGCC	uc003blh.2	-	29	4079_4080	c.3884_3885insGGCCTC	c.(3883-3885)TCC>TCGGCCTCC	p.1295_1295S>SAS	SBF1_uc003ble.2_5'Flank|SBF1_uc003blf.2_5'Flank|SBF1_uc011arx.1_Intron	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CGGTCCGTCTGGAGGCCGAGGC	0.678													5	6	---	---	---	---	capture_indel	In_Frame_Ins	INS	50895482	50895483	SBF1	22	-	GAGGCC	GAGGCC	GAGGCC	1	0	1	1	0	0	0	0	0	600	47	5	5	13750	96
NEK1	4750	broad.mit.edu	37	4	170398275	170398275	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-5413-01	TCGA-06-5413-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:170398275delT	uc003isb.1	-	24	2842	c.2350delA	c.(2350-2352)AGAfs	p.R784fs	NEK1_uc003isc.1_Frame_Shift_Del_p.R740fs|NEK1_uc003isd.1_Frame_Shift_Del_p.R812fs|NEK1_uc003ise.1_Frame_Shift_Del_p.R768fs|NEK1_uc003isf.1_Frame_Shift_Del_p.R715fs	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	784					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		CTATACATACTTTCAGTTGTA	0.343													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	170398275	170398275	NEK1	4	T	-	-	-	1	0	1	0	1	0	0	0	0	726	56	5	5	10228	96
