Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HSPG2	3339	broad.mit.edu	37	1	22154901	22154901	+	Missense_Mutation	SNP	G	A	A	rs146179360	byFrequency	TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22154901G>A	uc001bfj.2	-	89	12296	c.12256C>T	c.(12256-12258)CGG>TGG	p.R4086W	HSPG2_uc001bfi.2_Missense_Mutation_p.R103W|HSPG2_uc009vqd.2_Missense_Mutation_p.R4087W	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	4086	Laminin G-like 2.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	AGGTCCAGCCGTTTGCCATTC	0.597													32	36	---	---	---	---	capture	Missense_Mutation	SNP	22154901	22154901	HSPG2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	7355	99
GRHL3	57822	broad.mit.edu	37	1	24661135	24661135	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24661135G>T	uc001biy.2	+	3	266	c.220G>T	c.(220-222)GGT>TGT	p.G74C	GRHL3_uc001bix.2_Missense_Mutation_p.G69C|GRHL3_uc001biz.2_5'UTR	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	69	Transcription activation.				regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CTCTTCTCAGGGTCCCAAGGA	0.552													15	274	---	---	---	---	capture	Missense_Mutation	SNP	24661135	24661135	GRHL3	1	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	6698	99
FAM73A	374986	broad.mit.edu	37	1	78338781	78338781	+	Silent	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78338781G>C	uc001dhx.2	+	15	1688	c.1656G>C	c.(1654-1656)CTG>CTC	p.L552L	FAM73A_uc010ork.1_Silent_p.L553L|FAM73A_uc010orl.1_Silent_p.L515L	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986	552						integral to membrane				ovary(1)	1				Colorectal(170;0.226)		GAAATTCTCTGTATGATTTAT	0.358													99	159	---	---	---	---	capture	Silent	SNP	78338781	78338781	FAM73A	1	G	C	C	C	1	0	0	0	0	0	0	0	1	613	48	4	4	5565	99
TTLL7	79739	broad.mit.edu	37	1	84408356	84408356	+	Silent	SNP	A	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:84408356A>T	uc001djc.2	-	7	909	c.513T>A	c.(511-513)TCT>TCA	p.S171S	TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_Intron|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_RNA	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	171	TTL.				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TTCTTATCAAAGAAATCCTAT	0.269													29	42	---	---	---	---	capture	Silent	SNP	84408356	84408356	TTLL7	1	A	T	T	T	1	0	0	0	0	0	0	0	1	28	3	4	4	16614	99
KCNA10	3744	broad.mit.edu	37	1	111060530	111060530	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111060530G>A	uc001dzt.1	-	1	1268	c.880C>T	c.(880-882)CCC>TCC	p.P294S		NM_005549	NP_005540	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related	294						voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity			ovary(3)|large_intestine(1)	4		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)		GTCTTGCTGGGGCAGACCACG	0.512													104	87	---	---	---	---	capture	Missense_Mutation	SNP	111060530	111060530	KCNA10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	7924	99
NBPF10	100132406	broad.mit.edu	37	1	145360624	145360624	+	Silent	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145360624G>A	uc001end.3	+	76	9509	c.9474G>A	c.(9472-9474)TCG>TCA	p.S3158S	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oyq.1_Intron|NBPF10_uc010oyr.1_Silent_p.S456S	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3083											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATGTTATTCGACTCCTTCAG	0.478													5	7	---	---	---	---	capture	Silent	SNP	145360624	145360624	NBPF10	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	10100	99
FLG2	388698	broad.mit.edu	37	1	152326101	152326101	+	Silent	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152326101T>C	uc001ezw.3	-	3	4234	c.4161A>G	c.(4159-4161)AGA>AGG	p.R1387R	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1387							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGTTTCATGTCTCTCATGAA	0.507													138	297	---	---	---	---	capture	Silent	SNP	152326101	152326101	FLG2	1	T	C	C	C	1	0	0	0	0	0	0	0	1	751	58	3	3	5868	99
RNPEP	6051	broad.mit.edu	37	1	201966632	201966632	+	Missense_Mutation	SNP	A	T	T	rs114130028		TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201966632A>T	uc001gxd.2	+	5	1069	c.1040A>T	c.(1039-1041)AAT>ATT	p.N347I	RNPEP_uc001gxe.2_Missense_Mutation_p.N48I|RNPEP_uc001gxf.2_Missense_Mutation_p.N216I	NM_020216	NP_064601	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase	347					leukotriene biosynthetic process		epoxide hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		TTCTGGCTCAATGAAGGTTTC	0.542													59	90	---	---	---	---	capture	Missense_Mutation	SNP	201966632	201966632	RNPEP	1	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	13401	99
RPS6KC1	26750	broad.mit.edu	37	1	213414537	213414537	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:213414537T>C	uc010ptr.1	+	11	1877	c.1718T>C	c.(1717-1719)TTC>TCC	p.F573S	RPS6KC1_uc001hkd.2_Missense_Mutation_p.F561S|RPS6KC1_uc010pts.1_Missense_Mutation_p.F361S|RPS6KC1_uc010ptt.1_Missense_Mutation_p.F361S|RPS6KC1_uc010ptu.1_Missense_Mutation_p.F392S|RPS6KC1_uc010ptv.1_Missense_Mutation_p.F108S|RPS6KC1_uc001hke.2_Missense_Mutation_p.F392S	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	573					cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		CTGAAGTTCTTCCCCAACGAT	0.458													44	61	---	---	---	---	capture	Missense_Mutation	SNP	213414537	213414537	RPS6KC1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	13550	99
OR4S1	256148	broad.mit.edu	37	11	48328474	48328474	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48328474G>T	uc010rhu.1	+	1	700	c.700G>T	c.(700-702)GCT>TCT	p.A234S		NM_001004725	NP_001004725	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S,	234	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCGGCGTAAGGCTGTCTCCAC	0.468													124	132	---	---	---	---	capture	Missense_Mutation	SNP	48328474	48328474	OR4S1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	10986	99
CD5	921	broad.mit.edu	37	11	60890382	60890382	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60890382A>G	uc009ynk.2	+	7	1206	c.1103A>G	c.(1102-1104)CAG>CGG	p.Q368R		NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor	368	Extracellular (Potential).|SRCR 3.				cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		TCCCCAGGCCAGGATCCAAAC	0.657													4	202	---	---	---	---	capture	Missense_Mutation	SNP	60890382	60890382	CD5	11	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	2992	99
TUT1	64852	broad.mit.edu	37	11	62343579	62343579	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62343579G>A	uc001nto.2	-	9	1764	c.1726C>T	c.(1726-1728)CCC>TCC	p.P576S	EEF1G_uc001ntm.1_5'Flank|EEF1G_uc010rlw.1_5'Flank|TUT1_uc001ntp.1_Missense_Mutation_p.P72S	NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	538	PAP-associated.				mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						AGATTCAGGGGGCCAAGGCGC	0.637													23	41	---	---	---	---	capture	Missense_Mutation	SNP	62343579	62343579	TUT1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16662	99
C11orf92	399948	broad.mit.edu	37	11	111166838	111166838	+	Silent	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111166838A>G	uc001pld.2	-	2	2775	c.366T>C	c.(364-366)GCT>GCC	p.A122A	C11orf92_uc001ple.2_RNA	NM_207429	NP_997312			hypothetical protein LOC399948											lung(1)	1						ATTAATGTTGAGCTACAAACC	0.433													86	83	---	---	---	---	capture	Silent	SNP	111166838	111166838	C11orf92	11	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	1658	99
BUD13	84811	broad.mit.edu	37	11	116627935	116627935	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:116627935G>A	uc001ppn.2	-	9	1727	c.1693C>T	c.(1693-1695)CGC>TGC	p.R565C	BUD13_uc001ppo.2_Missense_Mutation_p.R431C	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1	565										large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		CCACTGTAGCGAGGTCTCACT	0.398													31	39	---	---	---	---	capture	Missense_Mutation	SNP	116627935	116627935	BUD13	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1561	99
PLEKHG6	55200	broad.mit.edu	37	12	6424277	6424277	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6424277G>A	uc001qnr.2	+	4	549	c.401G>A	c.(400-402)GGT>GAT	p.G134D	PLEKHG6_uc001qns.2_Missense_Mutation_p.G134D|PLEKHG6_uc010sew.1_Missense_Mutation_p.G134D|PLEKHG6_uc010sex.1_Missense_Mutation_p.G102D	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G	134					regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2						ATAGGAGAGGGTGGCGACAGT	0.632													47	14	---	---	---	---	capture	Missense_Mutation	SNP	6424277	6424277	PLEKHG6	12	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	11977	99
LRRIQ1	84125	broad.mit.edu	37	12	85450521	85450521	+	Silent	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85450521T>C	uc001tac.2	+	8	2061	c.1950T>C	c.(1948-1950)GCT>GCC	p.A650A	LRRIQ1_uc001tab.1_Silent_p.A650A|LRRIQ1_uc001taa.1_Silent_p.A625A	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	650										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		AAGACAATGCTTGGAATAGTG	0.313													24	57	---	---	---	---	capture	Silent	SNP	85450521	85450521	LRRIQ1	12	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	8944	99
NR2C1	7181	broad.mit.edu	37	12	95442924	95442924	+	Missense_Mutation	SNP	G	T	T	rs149986233		TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95442924G>T	uc001tdm.3	-	9	1307	c.1051C>A	c.(1051-1053)CAC>AAC	p.H351N	NR2C1_uc010suu.1_Missense_Mutation_p.H351N|NR2C1_uc001tdo.3_Missense_Mutation_p.H351N|NR2C1_uc001tdn.3_Missense_Mutation_p.H351N	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	351					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						GTGATTAGGTGTACACTTCCT	0.443													46	78	---	---	---	---	capture	Missense_Mutation	SNP	95442924	95442924	NR2C1	12	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	10529	99
ELK3	2004	broad.mit.edu	37	12	96640864	96640864	+	Silent	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96640864C>T	uc001teo.1	+	3	633	c.354C>T	c.(352-354)GGC>GGT	p.G118G		NM_005230	NP_005221	P41970	ELK3_HUMAN	ELK3 protein	118					negative regulation of transcription, DNA-dependent|signal transduction	mitochondrion	protein binding|purine-rich negative regulatory element binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	all_cancers(2;0.00173)					CTCCGGAGGGCCGCGAGGCCC	0.612													16	15	---	---	---	---	capture	Silent	SNP	96640864	96640864	ELK3	12	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	5015	99
TPTE2	93492	broad.mit.edu	37	13	20039439	20039439	+	Missense_Mutation	SNP	C	T	T	rs146223410		TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20039439C>T	uc001umd.2	-	10	843	c.632G>A	c.(631-633)CGA>CAA	p.R211Q	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.R100Q|TPTE2_uc001ume.2_Missense_Mutation_p.R134Q|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	211	Phosphatase tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CCTTGTGTATCGCCTTTTGTT	0.308													5	196	---	---	---	---	capture	Missense_Mutation	SNP	20039439	20039439	TPTE2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16314	99
GZMB	3002	broad.mit.edu	37	14	25102156	25102156	+	Silent	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25102156G>A	uc001wps.2	-	2	234	c.168C>T	c.(166-168)GAC>GAT	p.D56D	GZMB_uc010ama.2_Silent_p.D44D|GZMB_uc010amb.2_RNA	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor	56	Peptidase S1.				activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.028)		GCACGAAGTCGTCTCGTATCA	0.572													55	59	---	---	---	---	capture	Silent	SNP	25102156	25102156	GZMB	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6845	99
RYR3	6263	broad.mit.edu	37	15	34137199	34137199	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34137199G>T	uc001zhi.2	+	93	13503	c.13433G>T	c.(13432-13434)CGT>CTT	p.R4478L	RYR3_uc010bar.2_Missense_Mutation_p.R4473L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4478					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCAACCCTGCGTGCCCTGGCC	0.502													82	93	---	---	---	---	capture	Missense_Mutation	SNP	34137199	34137199	RYR3	15	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	13662	99
LACTB	114294	broad.mit.edu	37	15	63433763	63433763	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63433763A>G	uc002alw.2	+	6	1442	c.1403A>G	c.(1402-1404)GAA>GGA	p.E468G		NM_032857	NP_116246	P83111	LACTB_HUMAN	lactamase, beta isoform a	468						mitochondrion	hydrolase activity				0						GGTGTTGTGGAAAGGAAACAA	0.483													49	57	---	---	---	---	capture	Missense_Mutation	SNP	63433763	63433763	LACTB	15	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	8517	99
BAIAP3	8938	broad.mit.edu	37	16	1392020	1392020	+	Silent	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1392020G>A	uc002clk.1	+	10	915	c.915G>A	c.(913-915)GCG>GCA	p.A305A	BAIAP3_uc002clj.2_Silent_p.A287A|BAIAP3_uc010uuz.1_Silent_p.A270A|BAIAP3_uc010uva.1_Silent_p.A242A|BAIAP3_uc010uvb.1_Silent_p.A322A|BAIAP3_uc010uvc.1_Silent_p.A270A	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	305	C2 1.				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				TGGTAGAAGCGTGCAGGAAGC	0.617													31	23	---	---	---	---	capture	Silent	SNP	1392020	1392020	BAIAP3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1293	99
PPL	5493	broad.mit.edu	37	16	4952435	4952435	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4952435T>C	uc002cyd.1	-	4	500	c.410A>G	c.(409-411)AAC>AGC	p.N137S		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	137					keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						TGCCGCCCAGTTGACCTGTGG	0.637													51	22	---	---	---	---	capture	Missense_Mutation	SNP	4952435	4952435	PPL	16	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	12235	99
TP53	7157	broad.mit.edu	37	17	7577517	7577517	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577517A>C	uc002gim.2	-	7	958	c.764T>G	c.(763-765)ATC>AGC	p.I255S	TP53_uc002gig.1_Missense_Mutation_p.I255S|TP53_uc002gih.2_Missense_Mutation_p.I255S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I123S|TP53_uc010cng.1_Missense_Mutation_p.I123S|TP53_uc002gii.1_Missense_Mutation_p.I123S|TP53_uc010cnh.1_Missense_Mutation_p.I255S|TP53_uc010cni.1_Missense_Mutation_p.I255S|TP53_uc002gij.2_Missense_Mutation_p.I255S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.I162S|TP53_uc002gio.2_Missense_Mutation_p.I123S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	255	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> T (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> F (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.I255F(16)|p.0?(7)|p.I255T(7)|p.I255del(7)|p.I255S(7)|p.I255N(7)|p.I255fs*90(4)|p.I255fs*9(3)|p.I255V(3)|p.T253_I255del(2)|p.I255I(2)|p.I255fs*8(1)|p.?(1)|p.I254fs*7(1)|p.I255M(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCCAGTGTGATGATGGTGAG	0.582		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			38	30	---	---	---	---	capture	Missense_Mutation	SNP	7577517	7577517	TP53	17	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	16264	99
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578263G>A	uc002gim.2	-	6	780	c.586C>T	c.(586-588)CGA>TGA	p.R196*	TP53_uc002gig.1_Nonsense_Mutation_p.R196*|TP53_uc002gih.2_Nonsense_Mutation_p.R196*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R64*|TP53_uc010cng.1_Nonsense_Mutation_p.R64*|TP53_uc002gii.1_Nonsense_Mutation_p.R64*|TP53_uc010cnh.1_Nonsense_Mutation_p.R196*|TP53_uc010cni.1_Nonsense_Mutation_p.R196*|TP53_uc002gij.2_Nonsense_Mutation_p.R196*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R103*|TP53_uc002gio.2_Nonsense_Mutation_p.R64*|TP53_uc010vug.1_Nonsense_Mutation_p.R157*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	196	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R196*(125)|p.R196P(12)|p.0?(7)|p.R196R(5)|p.R196fs*51(4)|p.A189_V197delAPPQHLIRV(4)|p.R196Q(3)|p.K164_P219del(1)|p.R196L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.R64*(1)|p.I195fs*12(1)|p.R103*(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCTTCCACTCGGATAAGATGC	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			44	36	---	---	---	---	capture	Nonsense_Mutation	SNP	7578263	7578263	TP53	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	16264	99
POLDIP2	26073	broad.mit.edu	37	17	26675209	26675209	+	Silent	SNP	C	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26675209C>A	uc002haz.2	-	14	1173	c.1041G>T	c.(1039-1041)CGG>CGT	p.R347R	POLDIP2_uc010wag.1_RNA	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2	347	ApaG.					mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		AGGGAGGAATCCGAACATCAA	0.547													25	38	---	---	---	---	capture	Silent	SNP	26675209	26675209	POLDIP2	17	C	A	A	A	1	0	0	0	0	0	0	0	1	379	30	4	4	12097	99
ZNF544	27300	broad.mit.edu	37	19	58772645	58772645	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58772645A>C	uc010euo.2	+	7	1147	c.673A>C	c.(673-675)AGT>CGT	p.S225R	ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Missense_Mutation_p.S197R|ZNF544_uc010yhy.1_Missense_Mutation_p.S197R|ZNF544_uc002qrt.3_Missense_Mutation_p.S83R|ZNF544_uc002qru.3_Missense_Mutation_p.S83R|uc002qrx.1_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TTTCTGTCAGAGTATTTACTT	0.378													100	9	---	---	---	---	capture	Missense_Mutation	SNP	58772645	58772645	ZNF544	19	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	17856	99
SPTBN1	6711	broad.mit.edu	37	2	54856159	54856159	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:54856159C>T	uc002rxu.2	+	14	2137	c.1888C>T	c.(1888-1890)CGC>TGC	p.R630C	SPTBN1_uc002rxv.1_Missense_Mutation_p.R630C|SPTBN1_uc002rxx.2_Missense_Mutation_p.R617C	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	630	Spectrin 4.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			GGCGGCTGAGCGCAGGGCCCG	0.582													80	101	---	---	---	---	capture	Missense_Mutation	SNP	54856159	54856159	SPTBN1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15011	99
GALNT13	114805	broad.mit.edu	37	2	155099286	155099286	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:155099286G>A	uc002tyr.3	+	6	1121	c.554G>A	c.(553-555)CGC>CAC	p.R185H	GALNT13_uc002tyt.3_Missense_Mutation_p.R185H|GALNT13_uc010foc.1_Missense_Mutation_p.R4H	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	185	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						ATGGAAGAACGCTCTGGGTTA	0.388													4	98	---	---	---	---	capture	Missense_Mutation	SNP	155099286	155099286	GALNT13	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6151	99
MDH1B	130752	broad.mit.edu	37	2	207615789	207615789	+	Silent	SNP	G	A	A	rs146327472	byFrequency	TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207615789G>A	uc002vbs.2	-	6	976	c.921C>T	c.(919-921)GAC>GAT	p.D307D	MDH1B_uc010ziw.1_Intron|MDH1B_uc010fui.2_Silent_p.D307D|MDH1B_uc010fuj.2_Silent_p.D209D|MDH1B_uc002vbt.2_Intron	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	307					carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity			ovary(3)|kidney(1)	4				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		AAATGATCACGTCTTTAATGT	0.308													66	106	---	---	---	---	capture	Silent	SNP	207615789	207615789	MDH1B	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9322	99
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma 								43	62	---	---	---	---	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	99
PANX2	56666	broad.mit.edu	37	22	50615879	50615879	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50615879C>A	uc003bjn.3	+	2	738	c.738C>A	c.(736-738)TGC>TGA	p.C246*	PANX2_uc003bjp.3_Nonsense_Mutation_p.C112*|PANX2_uc003bjo.3_Nonsense_Mutation_p.C246*	NM_052839	NP_443071	Q96RD6	PANX2_HUMAN	pannexin 2 isoform 1	246	Helical; (Potential).				protein hexamerization|synaptic transmission	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity			breast(1)	1		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CCTACCTGTGCACCTACTACG	0.706													3	6	---	---	---	---	capture	Nonsense_Mutation	SNP	50615879	50615879	PANX2	22	C	A	A	A	1	0	0	0	0	0	1	0	0	324	25	5	4	11325	99
POLQ	10721	broad.mit.edu	37	3	121230744	121230744	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121230744G>C	uc003eee.3	-	10	1730	c.1601C>G	c.(1600-1602)GCT>GGT	p.A534G		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	534	Helicase C-terminal.				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		CTCCAGAATAGCTCGTATCAT	0.358								DNA_polymerases_(catalytic_subunits)					18	191	---	---	---	---	capture	Missense_Mutation	SNP	121230744	121230744	POLQ	3	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	12111	99
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			41	41	---	---	---	---	capture	Missense_Mutation	SNP	178936091	178936091	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11816	99
EIF4G1	1981	broad.mit.edu	37	3	184052651	184052651	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184052651C>G	uc003fnp.2	+	33	4953	c.4755C>G	c.(4753-4755)TTC>TTG	p.F1585L	EIF4G1_uc003fnt.2_Missense_Mutation_p.F1296L|EIF4G1_uc003fnq.2_Missense_Mutation_p.F1498L|EIF4G1_uc003fnr.2_Missense_Mutation_p.F1421L|EIF4G1_uc010hxx.2_Missense_Mutation_p.F1592L|EIF4G1_uc003fns.2_Missense_Mutation_p.F1545L|EIF4G1_uc010hxy.2_Missense_Mutation_p.F1592L|EIF4G1_uc003fnv.3_Missense_Mutation_p.F1586L|EIF4G1_uc003fnu.3_Missense_Mutation_p.F1585L|EIF4G1_uc003fnw.2_Missense_Mutation_p.F1592L|EIF4G1_uc003fny.3_Missense_Mutation_p.F1389L|EIF4G1_uc003foa.2_Missense_Mutation_p.F257L|FAM131A_uc003fob.1_5'Flank|FAM131A_uc003foc.2_5'Flank|FAM131A_uc003fod.1_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1585	W2.|Necessary but not sufficient for MKNK1- binding.|EIF4A-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCACAGCCTTCTTCAAGTGGC	0.607													45	58	---	---	---	---	capture	Missense_Mutation	SNP	184052651	184052651	EIF4G1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	4991	99
SEL1L3	23231	broad.mit.edu	37	4	25819779	25819779	+	Silent	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25819779C>T	uc003gru.3	-	9	1697	c.1545G>A	c.(1543-1545)CTG>CTA	p.L515L		NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3	515						integral to membrane	binding				0						GATCCATCTCCAGCAATGCCT	0.537													11	20	---	---	---	---	capture	Silent	SNP	25819779	25819779	SEL1L3	4	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	13905	99
WDR19	57728	broad.mit.edu	37	4	39218764	39218764	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39218764A>T	uc003gtv.2	+	13	1414	c.1260A>T	c.(1258-1260)AAA>AAT	p.K420N	WDR19_uc003gtu.1_Missense_Mutation_p.K420N|WDR19_uc011byi.1_Missense_Mutation_p.K260N|WDR19_uc003gtw.1_Missense_Mutation_p.K17N	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	420					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						CTGTGAAAAAATTGAAAGATA	0.343													9	11	---	---	---	---	capture	Missense_Mutation	SNP	39218764	39218764	WDR19	4	A	T	T	T	1	0	0	0	0	1	0	0	0	50	4	4	4	17160	99
ZAR1	326340	broad.mit.edu	37	4	48494815	48494815	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48494815C>G	uc003gyd.2	+	2	996	c.996C>G	c.(994-996)TGC>TGG	p.C332W		NM_175619	NP_783318	Q86SH2	ZAR1_HUMAN	zygote arrest 1	332					multicellular organismal development	cytoplasm|membrane	bile acid:sodium symporter activity				0						ATTACCACTGCAAGGACTGCA	0.418													21	333	---	---	---	---	capture	Missense_Mutation	SNP	48494815	48494815	ZAR1	4	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	17396	99
POLR2B	5431	broad.mit.edu	37	4	57890238	57890238	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57890238G>A	uc003hcl.1	+	21	2967	c.2924G>A	c.(2923-2925)CGT>CAT	p.R975H	POLR2B_uc011cae.1_Missense_Mutation_p.R968H|POLR2B_uc011caf.1_Missense_Mutation_p.R900H|POLR2B_uc003hcm.1_Missense_Mutation_p.R468H	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	975					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					ATCCCCTCTCGTATGACTATT	0.378													168	105	---	---	---	---	capture	Missense_Mutation	SNP	57890238	57890238	POLR2B	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12118	99
MARCH6	10299	broad.mit.edu	37	5	10387160	10387160	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:10387160C>G	uc003jet.1	+	5	572	c.389C>G	c.(388-390)CCA>CGA	p.P130R	MARCH6_uc011cmu.1_Missense_Mutation_p.P82R|MARCH6_uc003jeu.1_5'UTR|MARCH6_uc011cmv.1_Missense_Mutation_p.P25R	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	130	Extracellular (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CTGACGCTGCCATTAGATATG	0.423													3	98	---	---	---	---	capture	Missense_Mutation	SNP	10387160	10387160	MARCH6	5	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	9218	99
ACOT12	134526	broad.mit.edu	37	5	80643615	80643615	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:80643615T>C	uc003khl.3	-	6	686	c.631A>G	c.(631-633)ACA>GCA	p.T211A	RNU5E_uc011cto.1_Intron	NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	211	Acyl coenzyme A hydrolase 2.				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		GTAGCCACTGTCTCCATCCAC	0.498													213	220	---	---	---	---	capture	Missense_Mutation	SNP	80643615	80643615	ACOT12	5	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	150	99
STARD4	134429	broad.mit.edu	37	5	110842033	110842033	+	Silent	SNP	T	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:110842033T>G	uc003kph.1	-	3	234	c.150A>C	c.(148-150)GGA>GGC	p.G50G	STARD4_uc010jbw.1_5'UTR|STARD4_uc010jbx.1_5'UTR|STARD4_uc003kpi.1_RNA|STARD4_uc003kpj.2_Silent_p.G50G	NM_139164	NP_631903	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain	50	START.				lipid transport		lipid binding			ovary(1)	1		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)		CTTACAGATATCCATTAAATT	0.303													23	35	---	---	---	---	capture	Silent	SNP	110842033	110842033	STARD4	5	T	G	G	G	1	0	0	0	0	0	0	0	1	639	50	4	4	15149	99
SOX4	6659	broad.mit.edu	37	6	21595085	21595085	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:21595085C>T	uc003ndi.2	+	1	1114	c.320C>T	c.(319-321)CCT>CTT	p.P107L		NM_003107	NP_003098	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	107	HMG box.				canonical Wnt receptor signaling pathway|cardiac ventricle formation|cellular response to glucose stimulus|DNA damage response, detection of DNA damage|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|glial cell development|glial cell proliferation|limb bud formation|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein export from nucleus|negative regulation of protein ubiquitination|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|positive regulation of insulin secretion|positive regulation of N-terminal peptidyl-lysine acetylation|positive regulation of translation|pro-B cell differentiation|protein stabilization|skeletal system development|spinal cord motor neuron differentiation|sympathetic nervous system development|T cell differentiation	mitochondrion|nucleus	core promoter sequence-specific DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity				0	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			GACAAGATCCCTTTCATTCGA	0.602													11	7	---	---	---	---	capture	Missense_Mutation	SNP	21595085	21595085	SOX4	6	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	14845	99
VARS2	57176	broad.mit.edu	37	6	30893483	30893483	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30893483A>G	uc003nsc.1	+	27	3580	c.2948A>G	c.(2947-2949)TAC>TGC	p.Y983C	VARS2_uc011dmx.1_Missense_Mutation_p.Y983C|VARS2_uc011dmy.1_Missense_Mutation_p.Y843C|VARS2_uc011dmz.1_Missense_Mutation_p.Y1013C|VARS2_uc011dna.1_Missense_Mutation_p.Y981C|VARS2_uc011dnb.1_RNA|VARS2_uc011dnc.1_RNA|VARS2_uc011dnd.1_Missense_Mutation_p.Y421C|VARS2_uc010jsg.1_Missense_Mutation_p.Y355C|VARS2_uc010jsh.1_Missense_Mutation_p.Y127C	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	983					valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4						GCTCAAGTCTACATGGAGCTG	0.647													18	20	---	---	---	---	capture	Missense_Mutation	SNP	30893483	30893483	VARS2	6	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	17006	99
PHF1	5252	broad.mit.edu	37	6	33382595	33382595	+	Silent	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33382595A>G	uc003oeh.2	+	11	1274	c.1038A>G	c.(1036-1038)GGA>GGG	p.G346G	PHF1_uc011drh.1_RNA|PHF1_uc003oei.2_Silent_p.G346G|PHF1_uc010jux.2_Silent_p.G146G	NM_024165	NP_077084	O43189	PHF1_HUMAN	PHD finger protein 1 isoform b	346					chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(999;0.0443)				CTGGAGATGGAGCACTCACCA	0.552											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	120	---	---	---	---	capture	Silent	SNP	33382595	33382595	PHF1	6	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	11723	99
LMBRD1	55788	broad.mit.edu	37	6	70411840	70411840	+	Silent	SNP	G	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70411840G>C	uc003pfa.2	-	10	1036	c.921C>G	c.(919-921)GTC>GTG	p.V307V	LMBRD1_uc003pey.2_Silent_p.V103V|LMBRD1_uc003pez.2_Silent_p.V234V|LMBRD1_uc010kal.2_Silent_p.V234V|LMBRD1_uc003pfb.2_RNA	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein	307	Helical; Name=6; (Potential).				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						ATATTCCCCAGACGATCTAAA	0.269													45	54	---	---	---	---	capture	Silent	SNP	70411840	70411840	LMBRD1	6	G	C	C	C	1	0	0	0	0	0	0	0	1	418	33	4	4	8762	99
SYNE1	23345	broad.mit.edu	37	6	152737569	152737569	+	Silent	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152737569A>G	uc010kiw.2	-	41	6605	c.6003T>C	c.(6001-6003)ACT>ACC	p.T2001T	SYNE1_uc003qot.3_Silent_p.T2008T|SYNE1_uc003qou.3_Silent_p.T2001T|SYNE1_uc010kjb.1_Silent_p.T1984T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2001	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCTCTTTGTCAGTCCTTTCTT	0.448										HNSCC(10;0.0054)			228	290	---	---	---	---	capture	Silent	SNP	152737569	152737569	SYNE1	6	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	15333	99
CTTNBP2	83992	broad.mit.edu	37	7	117431218	117431218	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117431218G>A	uc003vjf.2	-	4	2124	c.2032C>T	c.(2032-2034)CCA>TCA	p.P678S		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	678										ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GAGGCACCTGGTCTACAGGAT	0.468													212	153	---	---	---	---	capture	Missense_Mutation	SNP	117431218	117431218	CTTNBP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	4006	99
XKR9	389668	broad.mit.edu	37	8	71593354	71593354	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:71593354G>T	uc003xyq.2	+	3	595	c.61G>T	c.(61-63)GAT>TAT	p.D21Y	XKR9_uc010lze.2_Missense_Mutation_p.D21Y|XKR9_uc010lzd.2_5'UTR	NM_001011720	NP_001011720	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related	21	Helical; (Potential).					integral to membrane				ovary(1)|skin(1)	2	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			CTACGTAACTGATTTAATTGT	0.318													164	211	---	---	---	---	capture	Missense_Mutation	SNP	71593354	71593354	XKR9	8	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	17319	99
EFR3A	23167	broad.mit.edu	37	8	132966108	132966108	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:132966108A>G	uc003yte.2	+	6	733	c.532A>G	c.(532-534)AAA>GAA	p.K178E		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	178						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TGTGGTTCGCAAAACAGTCAA	0.353													5	13	---	---	---	---	capture	Missense_Mutation	SNP	132966108	132966108	EFR3A	8	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	4913	99
FBXO10	26267	broad.mit.edu	37	9	37522884	37522884	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:37522884T>C	uc004aab.2	-	7	1917	c.1868A>G	c.(1867-1869)TAT>TGT	p.Y623C	FBXO10_uc004aac.2_Missense_Mutation_p.Y639C|FBXO10_uc004aad.2_Missense_Mutation_p.Y173C	NM_012166	NP_036298	Q9UK96	FBX10_HUMAN	F-box protein 10	623	PbH1 10.					ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)		ACCATCTGAATAGCCAAAGCA	0.468													6	6	---	---	---	---	capture	Missense_Mutation	SNP	37522884	37522884	FBXO10	9	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	5672	99
OR13C8	138802	broad.mit.edu	37	9	107332296	107332296	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107332296T>C	uc011lvo.1	+	1	848	c.848T>C	c.(847-849)TTC>TCC	p.F283S		NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						ATCTCCCTTTTCTATGGAGTG	0.408													17	182	---	---	---	---	capture	Missense_Mutation	SNP	107332296	107332296	OR13C8	9	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10842	99
GEMIN8	54960	broad.mit.edu	37	X	14027172	14027172	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:14027172G>A	uc004cwb.2	-	5	932	c.589C>T	c.(589-591)CGC>TGC	p.R197C	GEMIN8_uc004cwc.2_Missense_Mutation_p.R197C|GEMIN8_uc004cwd.2_Missense_Mutation_p.R197C	NM_017856	NP_060326	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8	197					spliceosomal snRNP assembly	Cajal body|cytoplasm|SMN complex|spliceosomal complex	protein binding				0						TCGGCCTGGCGCCGCTCACCA	0.612													35	86	---	---	---	---	capture	Missense_Mutation	SNP	14027172	14027172	GEMIN8	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6274	99
ZNF645	158506	broad.mit.edu	37	X	22292090	22292090	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:22292090A>T	uc004dai.1	+	1	1031	c.982A>T	c.(982-984)ATT>TTT	p.I328F		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	328	Pro-rich.					intracellular	zinc ion binding			lung(1)|pancreas(1)	2						TGGATATATTATTGTAAAGGT	0.438													4	108	---	---	---	---	capture	Missense_Mutation	SNP	22292090	22292090	ZNF645	23	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	17939	99
CXorf22	170063	broad.mit.edu	37	X	35985840	35985840	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35985840C>T	uc004ddj.2	+	10	1764	c.1705C>T	c.(1705-1707)CGC>TGC	p.R569C	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	569										large_intestine(1)|lung(1)|ovary(1)	3						AGCCATGACACGCACTCACAA	0.453													17	49	---	---	---	---	capture	Missense_Mutation	SNP	35985840	35985840	CXorf22	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4062	99
EFHC2	80258	broad.mit.edu	37	X	44037748	44037748	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:44037748C>A	uc004dgb.3	-	13	1904	c.1814G>T	c.(1813-1815)CGT>CTT	p.R605L		NM_025184	NP_079460	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	605							calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6						ACGGTAGTGACGTGCAATGGT	0.373													6	24	---	---	---	---	capture	Missense_Mutation	SNP	44037748	44037748	EFHC2	23	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	4902	99
ZNF674	641339	broad.mit.edu	37	X	46388335	46388335	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46388335T>C	uc004dgr.2	-	4	252	c.25A>G	c.(25-27)ACC>GCC	p.T9A	ZNF674_uc011mlg.1_Missense_Mutation_p.T9A|ZNF674_uc010nhm.2_Missense_Mutation_p.T9A	NM_001039891	NP_001034980	Q2M3X9	ZN674_HUMAN	zinc finger family member 674 isoform 1	9	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)	2						TCCTTGAAGGTCAATGATTCC	0.498													32	56	---	---	---	---	capture	Missense_Mutation	SNP	46388335	46388335	ZNF674	23	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	17959	99
CCDC120	90060	broad.mit.edu	37	X	48920041	48920041	+	Missense_Mutation	SNP	G	A	A	rs147084360		TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48920041G>A	uc010nik.2	+	4	599	c.92G>A	c.(91-93)CGT>CAT	p.R31H	CCDC120_uc011mmq.1_Missense_Mutation_p.R19H|CCDC120_uc004dmf.2_Missense_Mutation_p.R31H|CCDC120_uc010nil.2_Missense_Mutation_p.R31H|CCDC120_uc011mmr.1_Missense_Mutation_p.R31H|CCDC120_uc011mms.1_Missense_Mutation_p.R19H|CCDC120_uc004dmg.1_Silent_p.A109A	NM_033626	NP_296375	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120 isoform 3	31							protein binding			pancreas(1)	1						AAGTCAGAGCGTCTGCGGGGG	0.647													13	29	---	---	---	---	capture	Missense_Mutation	SNP	48920041	48920041	CCDC120	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2730	99
LAS1L	81887	broad.mit.edu	37	X	64737941	64737941	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64737941G>T	uc004dwa.1	-	12	1925	c.1853C>A	c.(1852-1854)CCC>CAC	p.P618H	LAS1L_uc004dwc.1_Missense_Mutation_p.P601H|LAS1L_uc004dwd.1_Missense_Mutation_p.P559H|LAS1L_uc004dvy.1_Missense_Mutation_p.P131H|LAS1L_uc004dvz.1_Missense_Mutation_p.P131H	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	618						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						CTCGGCAGTGGGGGACTCTTG	0.393													19	50	---	---	---	---	capture	Missense_Mutation	SNP	64737941	64737941	LAS1L	23	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	8556	99
STARD8	9754	broad.mit.edu	37	X	67943638	67943638	+	Silent	SNP	C	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:67943638C>G	uc004dxa.2	+	12	3102	c.2730C>G	c.(2728-2730)GTC>GTG	p.V910V	STARD8_uc004dxb.2_Silent_p.V990V|STARD8_uc004dxc.3_Silent_p.V910V	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	910	START.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						ACCACTATGTCACCGACAGCA	0.652													2	6	---	---	---	---	capture	Silent	SNP	67943638	67943638	STARD8	23	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	15153	99
ZMYM3	9203	broad.mit.edu	37	X	70469372	70469372	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70469372A>G	uc004dzh.1	-	7	1496	c.1409T>C	c.(1408-1410)CTC>CCC	p.L470P	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.L470P|ZMYM3_uc004dzj.1_Missense_Mutation_p.L470P|ZMYM3_uc011mpu.1_Missense_Mutation_p.L201P|ZMYM3_uc004dzk.3_Missense_Mutation_p.L470P|ZMYM3_uc004dzl.3_Missense_Mutation_p.L470P|ZMYM3_uc004dzm.3_Missense_Mutation_p.L470P	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	470					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					CTCGTGGAAGAGGAGCTCAGG	0.562													12	9	---	---	---	---	capture	Missense_Mutation	SNP	70469372	70469372	ZMYM3	23	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	17581	99
ATRX	546	broad.mit.edu	37	X	76778818	76778818	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76778818T>C	uc004ecp.3	-	31	6993	c.6761A>G	c.(6760-6762)CAT>CGT	p.H2254R	ATRX_uc004ecq.3_Missense_Mutation_p.H2216R|ATRX_uc004eco.3_Missense_Mutation_p.H2039R	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	2254					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	AAGAGAATCATGTTCATGGTA	0.388			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						188	167	---	---	---	---	capture	Missense_Mutation	SNP	76778818	76778818	ATRX	23	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	1199	99
COL4A5	1287	broad.mit.edu	37	X	107840792	107840792	+	Silent	SNP	A	G	G			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107840792A>G	uc004enz.1	+	24	1975	c.1773A>G	c.(1771-1773)GGA>GGG	p.G591G	COL4A5_uc011mso.1_Silent_p.G591G|COL4A5_uc004eob.1_Silent_p.G199G	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	591	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						GCCCGAAAGGAGAGCCTGTGA	0.463									Alport_syndrome_with_Diffuse_Leiomyomatosis				34	29	---	---	---	---	capture	Silent	SNP	107840792	107840792	COL4A5	23	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	3659	99
GUCY2F	2986	broad.mit.edu	37	X	108708484	108708484	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:108708484C>T	uc004eod.3	-	3	1195	c.919G>A	c.(919-921)GCC>ACC	p.A307T	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	307	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						GCATCATAGGCTTCCCGGAGC	0.488													141	99	---	---	---	---	capture	Missense_Mutation	SNP	108708484	108708484	GUCY2F	23	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	6827	99
LRP1	4035	broad.mit.edu	37	12	57563089	57563089	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57563089delG	uc001snd.2	+	20	3628	c.3162delG	c.(3160-3162)CAGfs	p.Q1054fs	LRP1_uc009zpi.1_RNA	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1054	Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GCACCAACCAGGGTGGGCACC	0.557													20	39	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	57563089	57563089	LRP1	12	G	-	-	-	1	0	1	0	1	0	0	0	0	451	35	5	5	8867	99
CDK12	51755	broad.mit.edu	37	17	37618715	37618716	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37618715_37618716insA	uc010cvv.2	+	1	977_978	c.391_392insA	c.(391-393)GAAfs	p.E131fs	CDK12_uc010wef.1_Frame_Shift_Ins_p.E131fs|CDK12_uc002hrw.3_Frame_Shift_Ins_p.E131fs	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	131					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						GACCGAAAAAGAAAAAAGCCAA	0.520										TCGA Ovarian(9;0.13)			48	57	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	37618715	37618716	CDK12	17	-	A	A	A	1	0	1	1	0	0	0	0	0	429	33	5	5	3098	99
EPAS1	2034	broad.mit.edu	37	2	46603736	46603736	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:46603736delC	uc002ruv.2	+	9	1581	c.1093delC	c.(1093-1095)CCCfs	p.P365fs		NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	365					angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			CCTGTTCAAGCCCCACCTGAT	0.493													157	376	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	46603736	46603736	EPAS1	2	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	5105	99
ROBO1	6091	broad.mit.edu	37	3	78656067	78656070	+	Frame_Shift_Del	DEL	TCTG	-	-			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:78656067_78656070delTCTG	uc003dqe.2	-	29	4765_4768	c.4557_4560delCAGA	c.(4555-4560)GACAGAfs	p.D1519fs	ROBO1_uc003dqb.2_Frame_Shift_Del_p.D1480fs|ROBO1_uc003dqc.2_Frame_Shift_Del_p.D1419fs|ROBO1_uc003dqd.2_Frame_Shift_Del_p.D1474fs|ROBO1_uc010hoh.2_Frame_Shift_Del_p.D711fs|ROBO1_uc011bgl.1_Frame_Shift_Del_p.D1091fs	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1519_1520	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGTCTGATGATCTGTCTGTTCTTG	0.485													215	353	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	78656067	78656070	ROBO1	3	TCTG	-	-	-	1	0	1	0	1	0	0	0	0	647	50	5	5	13405	99
WWC2	80014	broad.mit.edu	37	4	184210574	184210574	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:184210574delC	uc010irx.2	+	21	3352	c.3170delC	c.(3169-3171)ACAfs	p.T1057fs	WWC2_uc003ivk.3_Frame_Shift_Del_p.T852fs|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_Frame_Shift_Del_p.T739fs|WWC2_uc003ivn.3_Frame_Shift_Del_p.T572fs|WWC2_uc010irz.2_Frame_Shift_Del_p.T398fs|WWC2_uc003ivo.3_Frame_Shift_Del_p.T185fs	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	1057										ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		CTTAGAAGAACAACACAGGAA	0.498													11	19	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	184210574	184210574	WWC2	4	C	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	17293	99
HDX	139324	broad.mit.edu	37	X	83724095	83724095	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5417-01	TCGA-06-5417-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:83724095delC	uc004eek.1	-	3	745	c.636delG	c.(634-636)AAGfs	p.K212fs	HDX_uc011mqv.1_Frame_Shift_Del_p.K212fs|HDX_uc004eel.1_Frame_Shift_Del_p.K154fs	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	212						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						ACACAGAAGGCTTTTGAGGTA	0.418													112	213	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	83724095	83724095	HDX	23	C	-	-	-	1	0	1	0	1	0	0	0	0	363	28	5	5	6953	99
