Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GPR153	387509	broad.mit.edu	37	1	6311445	6311445	+	Missense_Mutation	SNP	C	T	T	rs139457263		TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6311445C>T	uc001amp.1	-	4	1192	c.932G>A	c.(931-933)CGG>CAG	p.R311Q	GPR153_uc001amo.1_5'Flank	NM_207370	NP_997253	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	311	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		GCACTTCTCCCGGACAGCTTT	0.637													53	93	---	---	---	---	capture	Missense_Mutation	SNP	6311445	6311445	GPR153	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6593	100
DMBX1	127343	broad.mit.edu	37	1	46976764	46976764	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46976764G>A	uc001cpx.2	+	3	521	c.506G>A	c.(505-507)CGT>CAT	p.R169H	DMBX1_uc001cpw.2_Missense_Mutation_p.R164H	NM_147192	NP_671725	Q8NFW5	DMBX1_HUMAN	diencephalon/mesencephalon homeobox 1 isoform b	169					brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CAGCCCCCACGTCTGCCTGGC	0.652													72	104	---	---	---	---	capture	Missense_Mutation	SNP	46976764	46976764	DMBX1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4536	100
TCHH	7062	broad.mit.edu	37	1	152081245	152081245	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152081245C>T	uc001ezp.2	-	2	4448	c.4448G>A	c.(4447-4449)CGT>CAT	p.R1483H	TCHH_uc009wne.1_Missense_Mutation_p.R1483H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1483	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTTCTGTCACGCTCTTGGCG	0.557													58	120	---	---	---	---	capture	Missense_Mutation	SNP	152081245	152081245	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15585	100
F5	2153	broad.mit.edu	37	1	169509611	169509611	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169509611G>A	uc001ggg.1	-	13	4862	c.4717C>T	c.(4717-4719)CGC>TGC	p.R1573C		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	1573	B.	Cleavage; by thrombin.			cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TTGTTGCTGCGGAGGTACCAT	0.398													46	82	---	---	---	---	capture	Missense_Mutation	SNP	169509611	169509611	F5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5302	100
IPO9	55705	broad.mit.edu	37	1	201823997	201823997	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201823997C>T	uc001gwz.2	+	8	907	c.857C>T	c.(856-858)TCC>TTC	p.S286F		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	286					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						ATGGTGTCCTCCATGCAGCAG	0.403													64	78	---	---	---	---	capture	Missense_Mutation	SNP	201823997	201823997	IPO9	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	7722	100
ADARB2	105	broad.mit.edu	37	10	1284215	1284215	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:1284215G>A	uc009xhq.2	-	5	1714	c.1340C>T	c.(1339-1341)ACG>ATG	p.T447M		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	447	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CTCCAGCTGCGTGTAGAGGAA	0.701													6	3	---	---	---	---	capture	Missense_Mutation	SNP	1284215	1284215	ADARB2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	283	100
PFKFB3	5209	broad.mit.edu	37	10	6265943	6265943	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:6265943C>T	uc001ije.2	+	12	1620	c.1236C>T	c.(1234-1236)TGC>TGT	p.C412C	PFKFB3_uc001ijd.2_Silent_p.C392C|PFKFB3_uc009xii.2_RNA|PFKFB3_uc010qaw.1_Silent_p.C426C|PFKFB3_uc001ijf.2_Silent_p.C412C|PFKFB3_uc001ijg.2_5'Flank|PFKFB3_uc009xij.2_5'Flank|PFKFB3_uc009xik.2_5'Flank|PFKFB3_uc009xil.2_5'Flank	NM_004566	NP_004557	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,	412	Fructose-2,6-bisphosphatase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						ACCTGAAATGCCCTCTTCACA	0.423													6	178	---	---	---	---	capture	Silent	SNP	6265943	6265943	PFKFB3	10	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	11665	100
PTEN	5728	broad.mit.edu	37	10	89711993	89711993	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711993C>T	uc001kfb.2	+	7	1642	c.611C>T	c.(610-612)CCA>CTA	p.P204L		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	204	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(3)|p.G165fs*9(3)|p.P204T(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G165_K342del(1)|p.G165_*404del(1)|p.P204S(1)|p.P204fs*17(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAAACTATTCCAATGTTCAGT	0.358		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			108	92	---	---	---	---	capture	Missense_Mutation	SNP	89711993	89711993	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	12633	100
DCLRE1A	9937	broad.mit.edu	37	10	115610208	115610208	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:115610208T>C	uc001law.2	-	2	1574	c.656A>G	c.(655-657)CAA>CGA	p.Q219R		NM_014881	NP_055696	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	219					cell division|mitosis	nucleus	hydrolase activity			skin(2)	2				Epithelial(162;0.0157)|all cancers(201;0.0171)		GTTATCAGTTTGGTTCTGATA	0.433								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					3	47	---	---	---	---	capture	Missense_Mutation	SNP	115610208	115610208	DCLRE1A	10	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	4253	100
METTL12	751071	broad.mit.edu	37	11	62434124	62434124	+	Silent	SNP	T	C	C			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62434124T>C	uc001nug.1	+	3	583	c.324T>C	c.(322-324)TTT>TTC	p.F108F	C11orf48_uc001nue.2_Intron|C11orf48_uc001nuf.2_Intron|METTL12_uc001nuh.2_Missense_Mutation_p.F150S|METTL12_uc010rmc.1_RNA	NM_001043229	NP_001036694	A8MUP2	MTL12_HUMAN	methyltransferase like 12 precursor	108						mitochondrion	methyltransferase activity				0						GGGTGGACTTTTCTCCTGTGG	0.592													44	84	---	---	---	---	capture	Silent	SNP	62434124	62434124	METTL12	11	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	9408	100
AICDA	57379	broad.mit.edu	37	12	8758006	8758006	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8758006C>T	uc001qur.2	-	3	311	c.232G>A	c.(232-234)GTC>ATC	p.V78I	AICDA_uc001qup.1_Missense_Mutation_p.V73I|AICDA_uc001quq.1_Missense_Mutation_p.V73I|AICDA_uc009zgd.1_Intron	NM_020661	NP_065712	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	78					B cell differentiation|DNA demethylation|mRNA processing|negative regulation of methylation-dependent chromatin silencing	cytoplasm	cytidine deaminase activity|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung SC(5;0.184)					AACCAGGTGACGCGGTAGCAG	0.617									Immune_Deficiency_with_Hyper-IgM				26	58	---	---	---	---	capture	Missense_Mutation	SNP	8758006	8758006	AICDA	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	422	100
AGAP2	116986	broad.mit.edu	37	12	58120988	58120988	+	Silent	SNP	G	A	A	rs145154021		TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58120988G>A	uc001spq.2	-	18	3105	c.3105C>T	c.(3103-3105)CGC>CGT	p.R1035R	AGAP2_uc001spo.1_5'Flank|AGAP2_uc001spp.2_Silent_p.R1034R|AGAP2_uc001spr.2_Silent_p.R679R|LOC100130776_uc001sps.3_Silent_p.A71A	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	1035	Arf-GAP.				axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						CGTACTTGGCGCGAATCCACG	0.677											OREG0021951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	13	---	---	---	---	capture	Silent	SNP	58120988	58120988	AGAP2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	368	100
ZFHX3	463	broad.mit.edu	37	16	72832031	72832031	+	Missense_Mutation	SNP	G	A	A	rs144091993	byFrequency	TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72832031G>A	uc002fck.2	-	9	5223	c.4550C>T	c.(4549-4551)TCG>TTG	p.S1517L	ZFHX3_uc002fcl.2_Missense_Mutation_p.S603L	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1517					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				CTCTGAGCCCGAGTCTTCTTG	0.483													97	64	---	---	---	---	capture	Missense_Mutation	SNP	72832031	72832031	ZFHX3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17514	100
GEMIN4	50628	broad.mit.edu	37	17	649261	649261	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:649261G>T	uc002frs.1	-	2	2141	c.2022C>A	c.(2020-2022)TTC>TTA	p.F674L		NM_015721	NP_056536	P57678	GEMI4_HUMAN	gemin 4	674					rRNA processing|spliceosomal snRNP assembly	Cajal body|cytosol|nucleolus|small nuclear ribonucleoprotein complex|spliceosomal complex	protein binding			ovary(2)|kidney(1)|skin(1)	4		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GAGTCTGGATGAAGATCCTCA	0.537													20	44	---	---	---	---	capture	Missense_Mutation	SNP	649261	649261	GEMIN4	17	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	6270	100
DNAH2	146754	broad.mit.edu	37	17	7702526	7702526	+	Missense_Mutation	SNP	G	A	A	rs147918283		TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7702526G>A	uc002giu.1	+	55	8679	c.8665G>A	c.(8665-8667)GTG>ATG	p.V2889M		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2889	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTGCACATCGTGCTCTGCCT	0.597													28	52	---	---	---	---	capture	Missense_Mutation	SNP	7702526	7702526	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4559	100
WNK4	65266	broad.mit.edu	37	17	40945618	40945618	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40945618C>T	uc002ibj.2	+	12	2187	c.2166C>T	c.(2164-2166)AAC>AAT	p.N722N	WNK4_uc010wgx.1_Silent_p.N386N|WNK4_uc002ibk.1_Silent_p.N494N|WNK4_uc010wgy.1_Silent_p.N66N	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	722					intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		AGGTATATAACGAGTTCATTC	0.488													20	61	---	---	---	---	capture	Silent	SNP	40945618	40945618	WNK4	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17261	100
TUBB4	10382	broad.mit.edu	37	19	6495886	6495886	+	Silent	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6495886G>A	uc002mfg.1	-	4	731	c.624C>T	c.(622-624)TAC>TAT	p.Y208Y	TUBB4_uc002mff.1_Silent_p.Y136Y|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	208					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		AACAGATGTCGTAGAGTGCCT	0.612													68	133	---	---	---	---	capture	Silent	SNP	6495886	6495886	TUBB4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16640	100
ZNF814	730051	broad.mit.edu	37	19	58385762	58385762	+	Silent	SNP	C	G	G			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385762C>G	uc002qqo.2	-	3	1268	c.996G>C	c.(994-996)TCG>TCC	p.S332S	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332	C2H2-type 5.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ATTTGCTAAACGATTTCCCAC	0.358													3	8	---	---	---	---	capture	Silent	SNP	58385762	58385762	ZNF814	19	C	G	G	G	1	0	0	0	0	0	0	0	1	236	19	4	4	18052	100
ABCG5	64240	broad.mit.edu	37	2	44065792	44065792	+	Silent	SNP	G	A	A	rs72542428		TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44065792G>A	uc002rtn.2	-	1	167	c.27C>T	c.(25-27)CCC>CCT	p.P9P	ABCG5_uc002rto.2_5'UTR|ABCG5_uc002rtp.2_5'UTR|ABCG8_uc002rtq.2_5'Flank|ABCG8_uc010yoa.1_5'Flank	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	9	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGGACCCTCCGGGGGTCAAAG	0.637													18	38	---	---	---	---	capture	Silent	SNP	44065792	44065792	ABCG5	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	71	100
SPTBN1	6711	broad.mit.edu	37	2	54856719	54856719	+	Silent	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:54856719G>A	uc002rxu.2	+	14	2697	c.2448G>A	c.(2446-2448)GAG>GAA	p.E816E	SPTBN1_uc002rxv.1_Silent_p.E816E|SPTBN1_uc002rxx.2_Silent_p.E803E	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	816	Spectrin 5.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			AGCATGCCGAGTCTCCAGACG	0.627													51	69	---	---	---	---	capture	Silent	SNP	54856719	54856719	SPTBN1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	15011	100
GTDC1	79712	broad.mit.edu	37	2	144899603	144899603	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:144899603C>T	uc002tvp.2	-	6	646	c.367G>A	c.(367-369)GTA>ATA	p.V123I	GTDC1_uc002tvo.2_Missense_Mutation_p.V123I|GTDC1_uc002tvq.2_Missense_Mutation_p.V123I|GTDC1_uc002tvr.2_Missense_Mutation_p.V123I|GTDC1_uc010fnn.2_Missense_Mutation_p.V123I|GTDC1_uc002tvs.2_Missense_Mutation_p.V91I|GTDC1_uc010fno.2_5'UTR|GTDC1_uc002tvt.1_Missense_Mutation_p.V123I	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	123					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		GAGTTGAATACAACCACATCA	0.383													19	46	---	---	---	---	capture	Missense_Mutation	SNP	144899603	144899603	GTDC1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6781	100
GALNT3	2591	broad.mit.edu	37	2	166627133	166627133	+	Silent	SNP	T	C	C			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166627133T>C	uc010fph.1	-	2	465	c.78A>G	c.(76-78)GTA>GTG	p.V26V	GALNT3_uc010fpi.1_Silent_p.V26V|GALNT3_uc002udi.2_Silent_p.V26V	NM_004482	NP_004473	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	26	Helical; Signal-anchor for type II membrane protein; (Potential).				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(2)|ovary(1)	3						AGAAAAAAATTACTGCACCAA	0.313													3	137	---	---	---	---	capture	Silent	SNP	166627133	166627133	GALNT3	2	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	6154	100
KIF16B	55614	broad.mit.edu	37	20	16337074	16337074	+	Silent	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:16337074G>A	uc002wpg.1	-	23	3680	c.3522C>T	c.(3520-3522)GGC>GGT	p.G1174G	KIF16B_uc002wpe.1_Silent_p.G556G|KIF16B_uc002wpf.1_Intron|KIF16B_uc010gch.1_Silent_p.G1123G	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	1174					cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CTGGATTTGCGCCCAAAGAGC	0.493													35	53	---	---	---	---	capture	Silent	SNP	16337074	16337074	KIF16B	20	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8200	100
PARD6B	84612	broad.mit.edu	37	20	49366651	49366651	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49366651G>A	uc002xvo.2	+	3	988	c.745G>A	c.(745-747)GCA>ACA	p.A249T		NM_032521	NP_115910	Q9BYG5	PAR6B_HUMAN	PAR-6 beta	249	PDZ.|Interaction with PARD3 and CDC42 (By similarity).				axonogenesis|cell cycle|cell division|establishment or maintenance of cell polarity|protein complex assembly|regulation of cell migration|tight junction assembly	cytosol|tight junction	protein binding			kidney(1)	1						AGTGAGACCGGCAAACCAGAG	0.448													5	201	---	---	---	---	capture	Missense_Mutation	SNP	49366651	49366651	PARD6B	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11350	100
ITGB2	3689	broad.mit.edu	37	21	46311847	46311847	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46311847G>A	uc002zgd.2	-	10	1333	c.1289C>T	c.(1288-1290)GCG>GTG	p.A430V	ITGB2_uc002zge.2_Missense_Mutation_p.A430V|ITGB2_uc002zgf.3_Missense_Mutation_p.A430V|ITGB2_uc011afl.1_Missense_Mutation_p.A352V|ITGB2_uc010gpw.2_Missense_Mutation_p.A373V|ITGB2_uc002zgg.2_Missense_Mutation_p.A430V	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	430	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	GAAGCCCAGCGCCCGGATGAC	0.642													29	33	---	---	---	---	capture	Missense_Mutation	SNP	46311847	46311847	ITGB2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7817	100
PCBP3	54039	broad.mit.edu	37	21	47355174	47355174	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47355174C>T	uc002zhq.1	+	12	989	c.864C>T	c.(862-864)GAC>GAT	p.D288D	PCBP3_uc010gqb.2_Silent_p.D288D|PCBP3_uc002zhp.1_Silent_p.D268D|PCBP3_uc002zhs.1_Silent_p.D262D|PCBP3_uc002zhr.1_Silent_p.D287D|PCBP3_uc002zht.1_Silent_p.D278D	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	288					mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CAGGTCTGGACGCCAGCCCAC	0.577													10	35	---	---	---	---	capture	Silent	SNP	47355174	47355174	PCBP3	21	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11405	100
CAMK1	8536	broad.mit.edu	37	3	9799491	9799491	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9799491T>A	uc003bst.2	-	11	1130	c.952A>T	c.(952-954)AAA>TAA	p.K318*	OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bsu.2_RNA|CAMK1_uc003bss.2_Nonsense_Mutation_p.K92*|uc003bsv.1_5'Flank	NM_003656	NP_003647	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	318	Nuclear export signal (By similarity).				cell differentiation|nervous system development|positive regulation of muscle cell differentiation|signal transduction	cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|skin(1)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		AGCTGCAGTTTCCTCATGTGC	0.612													28	73	---	---	---	---	capture	Nonsense_Mutation	SNP	9799491	9799491	CAMK1	3	T	A	A	A	1	0	0	0	0	0	1	0	0	806	62	5	4	2572	100
VHL	7428	broad.mit.edu	37	3	10183867	10183867	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10183867C>T	uc003bvc.2	+	1	549	c.336C>T	c.(334-336)TAC>TAT	p.Y112Y	VHL_uc003bvd.2_Silent_p.Y112Y	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	112	Involved in binding to CCT complex.		Y -> H (in VHLD; type IIA).|Y -> N (in VHLD).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.?(1)|p.Y112*(1)|p.Y112D(1)|p.I109_R113del(1)|p.S111fs*45(1)|p.R113fs*46(1)|p.Y112fs*1(1)|p.S111_Y112del(1)|p.Y112fs*47(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TCCACAGCTACCGAGGTACGG	0.637		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				3	7	---	---	---	---	capture	Silent	SNP	10183867	10183867	VHL	3	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	17044	100
OR5K1	26339	broad.mit.edu	37	3	98188932	98188932	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98188932C>T	uc003dsm.2	+	1	512	c.512C>T	c.(511-513)TCG>TTG	p.S171L		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	171	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						TTCTGTGGATCGAATCACATC	0.398													138	300	---	---	---	---	capture	Missense_Mutation	SNP	98188932	98188932	OR5K1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11070	100
FSTL1	11167	broad.mit.edu	37	3	120123732	120123732	+	Silent	SNP	C	T	T	rs138829728	by1000genomes	TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:120123732C>T	uc003eds.2	-	7	724	c.549G>A	c.(547-549)ACG>ACA	p.T183T	FSTL1_uc011bjh.1_Silent_p.T148T	NM_007085	NP_009016	Q12841	FSTL1_HUMAN	follistatin-like 1 precursor	183					BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)		GGTCTGGATACGTTGTAATAT	0.448													75	127	---	---	---	---	capture	Silent	SNP	120123732	120123732	FSTL1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6019	100
IGSF10	285313	broad.mit.edu	37	3	151166049	151166049	+	Missense_Mutation	SNP	C	T	T	rs116716539	byFrequency;by1000genomes	TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:151166049C>T	uc011bod.1	-	4	1720	c.1720G>A	c.(1720-1722)GAA>AAA	p.E574K		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	574	Ig-like C2-type 2.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGATAGGCTTCGACCAAAGGT	0.413													70	142	---	---	---	---	capture	Missense_Mutation	SNP	151166049	151166049	IGSF10	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7521	100
TMEM156	80008	broad.mit.edu	37	4	39000377	39000377	+	Missense_Mutation	SNP	G	A	A	rs13118782		TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39000377G>A	uc003gto.2	-	2	349	c.241C>T	c.(241-243)CGT>TGT	p.R81C	TMEM156_uc010ifj.2_Missense_Mutation_p.R81C	NM_024943	NP_079219	Q8N614	TM156_HUMAN	transmembrane protein 156	81	Extracellular (Potential).					integral to membrane				skin(1)	1						GTGAAGTTACGAAAATTGGAG	0.368													29	55	---	---	---	---	capture	Missense_Mutation	SNP	39000377	39000377	TMEM156	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15957	100
UGT2B7	7364	broad.mit.edu	37	4	69973993	69973993	+	Silent	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69973993G>A	uc003heg.3	+	5	1309	c.1263G>A	c.(1261-1263)TCG>TCA	p.S421S	UGT2B7_uc010ihq.2_Intron	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	421					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						ACACAATGTCGAGTACAGACT	0.423													78	155	---	---	---	---	capture	Silent	SNP	69973993	69973993	UGT2B7	4	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	16844	100
TRPC3	7222	broad.mit.edu	37	4	122833104	122833104	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:122833104G>C	uc003ieg.2	-	5	1560	c.1486C>G	c.(1486-1488)CCC>GCC	p.P496A	TRPC3_uc010inr.2_Missense_Mutation_p.P368A|TRPC3_uc003ief.2_Missense_Mutation_p.P423A|TRPC3_uc011cgl.1_Missense_Mutation_p.P160A	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN	transient receptor potential cation channel,	411	Cytoplasmic (Potential).				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						ATCTGTTTGGGATAGTCAGTA	0.423													59	106	---	---	---	---	capture	Missense_Mutation	SNP	122833104	122833104	TRPC3	4	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	16462	100
TBC1D9	23158	broad.mit.edu	37	4	141600954	141600954	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:141600954T>A	uc010ioj.2	-	4	676	c.404A>T	c.(403-405)GAT>GTT	p.D135V		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	135						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CGTGTCATCATCTTCCTTTAC	0.368													28	30	---	---	---	---	capture	Missense_Mutation	SNP	141600954	141600954	TBC1D9	4	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	15514	100
TERT	7015	broad.mit.edu	37	5	1260707	1260707	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1260707C>T	uc003jcb.1	-	12	2910	c.2852G>A	c.(2851-2853)CGG>CAG	p.R951Q	TERT_uc003jbz.1_Missense_Mutation_p.R147Q|TERT_uc003jca.1_Missense_Mutation_p.R939Q|TERT_uc003jcc.1_Missense_Mutation_p.R888Q|TERT_uc003jcd.1_RNA|TERT_uc003jce.1_RNA	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	951	CTE.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GATGGAGGTCCGGGCATAGCT	0.602									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				22	57	---	---	---	---	capture	Missense_Mutation	SNP	1260707	1260707	TERT	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15649	100
ZNF366	167465	broad.mit.edu	37	5	71752388	71752388	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71752388C>T	uc003kce.1	-	3	1553	c.1367G>A	c.(1366-1368)CGG>CAG	p.R456Q		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	456	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GGTGAACTCCCGCCCACAAAT	0.527													92	198	---	---	---	---	capture	Missense_Mutation	SNP	71752388	71752388	ZNF366	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17750	100
GABRB2	2561	broad.mit.edu	37	5	160753407	160753407	+	Missense_Mutation	SNP	G	A	A	rs140795978		TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160753407G>A	uc003lys.1	-	10	1377	c.1159C>T	c.(1159-1161)CGG>TGG	p.R387W	GABRB2_uc011deh.1_Intron|GABRB2_uc003lyr.1_Intron|GABRB2_uc003lyt.1_Intron|GABRB2_uc010jiu.1_Intron	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	387	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	ttggtagtccgtctagttggg	0.159													65	112	---	---	---	---	capture	Missense_Mutation	SNP	160753407	160753407	GABRB2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	6109	100
PKHD1	5314	broad.mit.edu	37	6	51941108	51941108	+	Silent	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51941108G>A	uc003pah.1	-	6	690	c.414C>T	c.(412-414)ATC>ATT	p.I138I	PKHD1_uc003pai.2_Silent_p.I138I	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	138	IPT/TIG 2.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CTTGGTGAACGATGGGTGTCT	0.393													36	73	---	---	---	---	capture	Silent	SNP	51941108	51941108	PKHD1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	11874	100
KCNQ5	56479	broad.mit.edu	37	6	73843328	73843328	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:73843328C>T	uc003pgk.2	+	10	1779	c.1432C>T	c.(1432-1434)CGC>TGC	p.R478C	KCNQ5_uc011dyh.1_Missense_Mutation_p.R497C|KCNQ5_uc011dyi.1_Missense_Mutation_p.R488C|KCNQ5_uc010kat.2_Missense_Mutation_p.R469C|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Missense_Mutation_p.R228C	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	478					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		GCCCTCGCTGCGCCTCAAAAG	0.512													42	65	---	---	---	---	capture	Missense_Mutation	SNP	73843328	73843328	KCNQ5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8008	100
MACC1	346389	broad.mit.edu	37	7	20199376	20199376	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20199376C>G	uc003sus.3	-	5	917	c.608G>C	c.(607-609)GGA>GCA	p.G203A	MACC1_uc010kug.2_Missense_Mutation_p.G203A	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	203					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						CTGGGCCCATCCAGGGCTCTG	0.473													3	144	---	---	---	---	capture	Missense_Mutation	SNP	20199376	20199376	MACC1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9058	100
AMPH	273	broad.mit.edu	37	7	38471801	38471801	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38471801C>T	uc003tgu.2	-	13	1215	c.1146G>A	c.(1144-1146)TGG>TGA	p.W382*	AMPH_uc003tgv.2_Nonsense_Mutation_p.W382*|AMPH_uc003tgt.2_Nonsense_Mutation_p.W135*|AMPH_uc003tgw.1_5'Flank|AMPH_uc010kxl.1_5'Flank	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	382					endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						TCCATAGGTCCCAGGGCAATG	0.318													53	183	---	---	---	---	capture	Nonsense_Mutation	SNP	38471801	38471801	AMPH	7	C	T	T	T	1	0	0	0	0	0	1	0	0	286	22	5	2	588	100
ADCY1	107	broad.mit.edu	37	7	45717648	45717648	+	Missense_Mutation	SNP	G	A	A	rs147187783		TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45717648G>A	uc003tne.3	+	9	1804	c.1786G>A	c.(1786-1788)GAA>AAA	p.E596K		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	596	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAAACATGTCGAACGGGAGCA	0.557													54	186	---	---	---	---	capture	Missense_Mutation	SNP	45717648	45717648	ADCY1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	292	100
POM121L12	285877	broad.mit.edu	37	7	53103406	53103406	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103406C>T	uc003tpz.2	+	1	58	c.42C>T	c.(40-42)AAC>AAT	p.N14N		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	14											0						ACCTCGGGAACTTCTGGAAGG	0.706													11	32	---	---	---	---	capture	Silent	SNP	53103406	53103406	POM121L12	7	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	12143	100
FKBP6	8468	broad.mit.edu	37	7	72744235	72744235	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72744235C>T	uc003tya.2	+	4	480	c.348C>T	c.(346-348)TAC>TAT	p.Y116Y	FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Silent_p.Y111Y|FKBP6_uc010lbe.1_RNA|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	116	PPIase FKBP-type.				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				AACCGAACTACGCCTATGGAA	0.537													76	145	---	---	---	---	capture	Silent	SNP	72744235	72744235	FKBP6	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5857	100
MUC17	140453	broad.mit.edu	37	7	100680821	100680821	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100680821C>T	uc003uxp.1	+	3	6177	c.6124C>T	c.(6124-6126)CGG>TGG	p.R2042W	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2042	Extracellular (Potential).|32.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TCCTAGTGAACGGACCACTCC	0.502													94	377	---	---	---	---	capture	Missense_Mutation	SNP	100680821	100680821	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	9884	100
PIK3CG	5294	broad.mit.edu	37	7	106508855	106508855	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106508855C>T	uc003vdv.3	+	2	934	c.849C>T	c.(847-849)GGC>GGT	p.G283G	PIK3CG_uc003vdu.2_Silent_p.G283G|PIK3CG_uc003vdw.2_Silent_p.G283G	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	283					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						ACCTGGTGGGCGAAACGCCCA	0.552													27	133	---	---	---	---	capture	Silent	SNP	106508855	106508855	PIK3CG	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11819	100
PTDSS1	9791	broad.mit.edu	37	8	97345772	97345772	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:97345772C>G	uc003yht.1	+	13	1502	c.1400C>G	c.(1399-1401)ACC>AGC	p.T467S	PTDSS1_uc003yhu.1_Missense_Mutation_p.T321S	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	467					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	TCAAAAGTCACCAATGGCGTT	0.473											OREG0018880	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	229	---	---	---	---	capture	Missense_Mutation	SNP	97345772	97345772	PTDSS1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	12631	100
ACTL7B	10880	broad.mit.edu	37	9	111617172	111617172	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:111617172T>C	uc004bdi.2	-	1	1104	c.1039A>G	c.(1039-1041)ATG>GTG	p.M347V		NM_006686	NP_006677	Q9Y614	ACL7B_HUMAN	actin-like 7B	347						actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton			pancreas(1)	1						CCATCCAGCATAGTGCAGCCG	0.682													43	61	---	---	---	---	capture	Missense_Mutation	SNP	111617172	111617172	ACTL7B	9	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	201	100
SCAI	286205	broad.mit.edu	37	9	127781214	127781214	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:127781214A>G	uc004bpe.2	-	9	806	c.725T>C	c.(724-726)GTA>GCA	p.V242A	SCAI_uc004bpd.2_Missense_Mutation_p.V265A|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	242					negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						ATCATTTAATACCATTACAGG	0.393													3	91	---	---	---	---	capture	Missense_Mutation	SNP	127781214	127781214	SCAI	9	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	13761	100
LAMC3	10319	broad.mit.edu	37	9	133943586	133943586	+	Silent	SNP	C	T	T			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133943586C>T	uc004caa.1	+	15	2813	c.2715C>T	c.(2713-2715)TTC>TTT	p.F905F		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	905	Laminin EGF-like 9.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		ACCCTGGCTTCTTCGACCTCC	0.667													21	28	---	---	---	---	capture	Silent	SNP	133943586	133943586	LAMC3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	8536	100
COL5A1	1289	broad.mit.edu	37	9	137623922	137623922	+	Silent	SNP	A	G	G			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137623922A>G	uc004cfe.2	+	9	1720	c.1338A>G	c.(1336-1338)GGA>GGG	p.G446G		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	446	Interrupted collagenous region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCCAGATTGGAGGACCTCGGG	0.532													3	203	---	---	---	---	capture	Silent	SNP	137623922	137623922	COL5A1	9	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	3661	100
TBC1D8B	54885	broad.mit.edu	37	X	106097468	106097468	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:106097468G>A	uc004emo.2	+	14	2459	c.2294G>A	c.(2293-2295)CGC>CAC	p.R765H	MORC4_uc004emp.3_Intron	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	765						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CATAGTATGCGCTGTCGAAAT	0.348													56	40	---	---	---	---	capture	Missense_Mutation	SNP	106097468	106097468	TBC1D8B	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15513	100
VAMP3	9341	broad.mit.edu	37	1	7838212	7838214	+	In_Frame_Del	DEL	TCA	-	-			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7838212_7838214delTCA	uc001aol.2	+	4	381_383	c.266_268delTCA	c.(265-270)TTCATC>TTC	p.I94del		NM_004781	NP_004772	Q15836	VAMP3_HUMAN	vesicle-associated membrane protein 3	94	Helical; Anchor for type IV membrane protein; (Potential).				cellular membrane fusion|positive regulation of receptor recycling|protein complex assembly|protein transport|retrograde transport, endosome to Golgi|substrate adhesion-dependent cell spreading|vesicle docking involved in exocytosis	cell junction|clathrin-coated vesicle|integral to membrane|recycling endosome|synapse|synaptosome	protein binding				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;6.33e-69)|GBM - Glioblastoma multiforme(8;2.07e-34)|Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.38e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000805)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		CTGGTTATCTTCATCATCATCAT	0.365													7	382	---	---	---	---	capture_indel	In_Frame_Del	DEL	7838212	7838214	VAMP3	1	TCA	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	16996	100
USP15	9958	broad.mit.edu	37	12	62785633	62785634	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:62785633_62785634insA	uc001src.1	+	17	2280_2281	c.2271_2272insA	c.(2269-2274)TTGAAAfs	p.L757fs	USP15_uc001srb.1_Frame_Shift_Ins_p.L728fs	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	757_758					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATCCTGATTTGAAAAAAAGATA	0.277													23	56	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	62785633	62785634	USP15	12	-	A	A	A	1	0	1	1	0	0	0	0	0	581	45	5	5	16928	100
HAUS8	93323	broad.mit.edu	37	19	17160706	17160707	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17160706_17160707delGA	uc002nfe.2	-	11	1320_1321	c.1209_1210delTC	c.(1207-1212)TCTCGTfs	p.S403fs	HAUS8_uc002nff.2_Frame_Shift_Del_p.S402fs|HAUS8_uc002nfg.1_Frame_Shift_Del_p.S341fs|HAUS8_uc002nfh.1_Frame_Shift_Del_p.S402fs	NM_033417	NP_219485	Q9BT25	HAUS8_HUMAN	sarcoma antigen NY-SAR-48 isoform a	403_404					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole					0						CTCCCTGAACGAGAGAGAGAGG	0.495													8	442	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	17160706	17160707	HAUS8	19	GA	-	-	-	1	0	1	0	1	0	0	0	0	481	37	5	5	6899	100
TLK1	9874	broad.mit.edu	37	2	171902709	171902710	+	Frame_Shift_Ins	INS	-	GG	GG			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:171902709_171902710insGG	uc002ugn.2	-	11	1615_1616	c.1143_1144insCC	c.(1141-1146)CCCTTTfs	p.P381fs	TLK1_uc002ugo.2_Frame_Shift_Ins_p.P402fs|TLK1_uc002ugp.2_Frame_Shift_Ins_p.P333fs|TLK1_uc002ugq.2_RNA|TLK1_uc010zdn.1_Frame_Shift_Ins_p.P285fs|TLK1_uc002ugr.1_Frame_Shift_Ins_p.P164fs	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1	381_382					cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						GGTCTAACAAAGGGATCATTCT	0.366													112	217	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	171902709	171902710	TLK1	2	-	GG	GG	GG	1	0	1	1	0	0	0	0	0	39	3	5	5	15828	100
OGDH	4967	broad.mit.edu	37	7	44684936	44684936	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44684936delT	uc003tln.2	+	3	342	c.233delT	c.(232-234)ATTfs	p.I78fs	OGDH_uc003tlm.2_Frame_Shift_Del_p.I78fs|OGDH_uc011kbx.1_Frame_Shift_Del_p.I78fs|OGDH_uc011kby.1_Intron|OGDH_uc003tlp.2_Frame_Shift_Del_p.I78fs|OGDH_uc011kbz.1_5'UTR|OGDH_uc003tlo.1_5'UTR	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	78					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	TCATGGGACATTTTTTTTCGC	0.577													8	585	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44684936	44684936	OGDH	7	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	10744	100
MUC17	140453	broad.mit.edu	37	7	100684307	100684308	+	In_Frame_Ins	INS	-	CTC	CTC			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100684307_100684308insCTC	uc003uxp.1	+	3	9663_9664	c.9610_9611insCTC	c.(9610-9612)TCT>TCTCCT	p.3204_3205insP	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3204_3205	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|52.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCCACTTCATCTACAACTGCT	0.500													8	985	---	---	---	---	capture_indel	In_Frame_Ins	INS	100684307	100684308	MUC17	7	-	CTC	CTC	CTC	1	0	1	1	0	0	0	0	0	650	50	5	5	9884	100
ZNF618	114991	broad.mit.edu	37	9	116798608	116798608	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116798608delC	uc004bid.2	+	13	1296	c.1197delC	c.(1195-1197)ATCfs	p.I399fs	ZNF618_uc004bic.2_Frame_Shift_Del_p.I306fs|ZNF618_uc011lxi.1_Frame_Shift_Del_p.I366fs|ZNF618_uc011lxj.1_Frame_Shift_Del_p.I367fs|ZNF618_uc010mvb.2_5'UTR	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	399	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCTGTGGGATCCAGTTCCAGT	0.582													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	116798608	116798608	ZNF618	9	C	-	-	-	1	0	1	0	1	0	0	0	0	382	30	5	5	17920	100
IL3RA	3563	broad.mit.edu	37	X	1464293	1464293	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1464293delT	uc004cps.2	+	3	498	c.149delT	c.(148-150)ATCfs	p.I50fs	IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor	50	Extracellular (Potential).					integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GTGACCGATATCGAGTGTGTT	0.348													151	90	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	1464293	1464293	IL3RA	23	T	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	7618	100
PCDH19	57526	broad.mit.edu	37	X	99662549	99662551	+	In_Frame_Del	DEL	CAG	-	-			TCGA-06-5418-01	TCGA-06-5418-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99662549_99662551delCAG	uc010nmz.2	-	1	2721_2723	c.1045_1047delCTG	c.(1045-1047)CTGdel	p.L349del	PCDH19_uc004efw.3_In_Frame_Del_p.L349del|PCDH19_uc004efx.3_In_Frame_Del_p.L349del	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	349	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						TGTTGACTGACAGCAGGTTGATG	0.616													40	41	---	---	---	---	capture_indel	In_Frame_Del	DEL	99662549	99662551	PCDH19	23	CAG	-	-	-	1	0	1	0	1	0	0	0	0	210	17	5	5	11417	100
