Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHA8	2046	broad.mit.edu	37	1	22902985	22902985	+	Silent	SNP	C	T	T	rs142515766	byFrequency	TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22902985C>T	uc001bfx.1	+	3	560	c.435C>T	c.(433-435)ATC>ATT	p.I145I	EPHA8_uc001bfw.2_Silent_p.I145I	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	145	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCCTCAAAATCGACACCATTG	0.612													9	68	---	---	---	---	capture	Silent	SNP	22902985	22902985	EPHA8	1	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	5128	103
FAM129A	116496	broad.mit.edu	37	1	184764446	184764446	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:184764446C>T	uc001gra.2	-	14	2646	c.2452G>A	c.(2452-2454)GAG>AAG	p.E818K	FAM129A_uc001grb.1_Intron	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	818	Glu-rich.				negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						GTGCAGGCCTCTCCTGGGAGC	0.647													62	94	---	---	---	---	capture	Missense_Mutation	SNP	184764446	184764446	FAM129A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	5390	103
CACNA1S	779	broad.mit.edu	37	1	201052298	201052298	+	Missense_Mutation	SNP	C	T	T	rs146696298		TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201052298C>T	uc001gvv.2	-	10	1612	c.1385G>A	c.(1384-1386)CGT>CAT	p.R462H		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	462	Extracellular (Potential).|II.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	ACCTTGCAAACGGGTCAGCCA	0.557													27	38	---	---	---	---	capture	Missense_Mutation	SNP	201052298	201052298	CACNA1S	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2523	103
PPME1	51400	broad.mit.edu	37	11	73914828	73914828	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:73914828A>T	uc001ouw.2	+	2	256	c.157A>T	c.(157-159)ATG>TTG	p.M53L	PPME1_uc009yty.2_5'Flank	NM_016147	NP_057231	Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	53					protein demethylation		carboxylesterase activity|protein C-terminal methylesterase activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0	Breast(11;3.29e-05)					TTTTGAGTCCATGGAAGATGT	0.373													35	86	---	---	---	---	capture	Missense_Mutation	SNP	73914828	73914828	PPME1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	12248	103
C12orf40	283461	broad.mit.edu	37	12	40040162	40040162	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40040162G>C	uc001rmc.2	+	4	401	c.234G>C	c.(232-234)ATG>ATC	p.M78I	C12orf40_uc009zjv.1_RNA	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	78										ovary(6)	6						ATGTGAACATGAATAGAGACA	0.274													22	36	---	---	---	---	capture	Missense_Mutation	SNP	40040162	40040162	C12orf40	12	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	1672	103
DHRS2	10202	broad.mit.edu	37	14	24108199	24108199	+	Silent	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24108199G>A	uc001wkt.3	+	2	573	c.126G>A	c.(124-126)ACG>ACA	p.T42T	DHRS2_uc010aku.1_Silent_p.T42T|DHRS2_uc001wku.3_Silent_p.T42T|DHRS2_uc010akv.2_RNA|DHRS2_uc001wkv.3_Silent_p.T42T	NM_182908	NP_878912	Q13268	DHRS2_HUMAN	dehydrogenase/reductase member 2 isoform 1	20	NAD or NADP (By similarity).				C21-steroid hormone metabolic process|cellular response to oxidative stress|myeloid dendritic cell differentiation|negative regulation of apoptosis|negative regulation of cell proliferation|response to toxin	mitochondrion|nuclear envelope	binding|carbonyl reductase (NADPH) activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00659)		CCGTGGTCACGGGGTCCACCA	0.597													3	75	---	---	---	---	capture	Silent	SNP	24108199	24108199	DHRS2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4448	103
C15orf42	90381	broad.mit.edu	37	15	90168464	90168464	+	Silent	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90168464C>T	uc002boe.2	+	20	4923	c.4923C>T	c.(4921-4923)ACC>ACT	p.T1641T	C15orf42_uc010upv.1_RNA	NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	1641					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GGGGGCAAACCTACATCTGCC	0.612													35	52	---	---	---	---	capture	Silent	SNP	90168464	90168464	C15orf42	15	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	1782	103
MSLN	10232	broad.mit.edu	37	16	816982	816982	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:816982G>A	uc002cjw.1	+	14	1546	c.1495G>A	c.(1495-1497)GAA>AAA	p.E499K	MSLN_uc002cjt.1_Missense_Mutation_p.E491K|MSLN_uc002cju.1_Missense_Mutation_p.E491K|MSLN_uc010brd.1_Missense_Mutation_p.E490K|MSLN_uc002cjv.1_Missense_Mutation_p.E491K|MSLN_uc002cjx.1_Missense_Mutation_p.E491K|MSLN_uc002cjy.1_Missense_Mutation_p.E156K	NM_013404	NP_037536	Q13421	MSLN_HUMAN	mesothelin isoform 2 preproprotein	499					cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane				pancreas(1)	1		Hepatocellular(780;0.00335)				GAACGGGTCCGAATACTTCGT	0.632													43	37	---	---	---	---	capture	Missense_Mutation	SNP	816982	816982	MSLN	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9791	103
PPL	5493	broad.mit.edu	37	16	4945705	4945705	+	Missense_Mutation	SNP	C	T	T	rs142355114		TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4945705C>T	uc002cyd.1	-	10	1075	c.985G>A	c.(985-987)GTG>ATG	p.V329M		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	329	Potential.|Spectrin 2.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GCGTCCTTCACGTCTTCGTGA	0.577													40	81	---	---	---	---	capture	Missense_Mutation	SNP	4945705	4945705	PPL	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12235	103
SRCAP	10847	broad.mit.edu	37	16	30721206	30721206	+	Silent	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30721206G>A	uc002dze.1	+	8	1276	c.891G>A	c.(889-891)GAG>GAA	p.E297E	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.E154E|SRCAP_uc010bzz.1_5'UTR|SNORA30_uc002dzh.1_5'Flank	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	297	Glu-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			ATGAGGAAGAGGATGATGAGG	0.522													22	25	---	---	---	---	capture	Silent	SNP	30721206	30721206	SRCAP	16	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	15027	103
ZNF99	7652	broad.mit.edu	37	19	22941588	22941588	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22941588C>T	uc010xrh.1	-	5	850	c.850G>A	c.(850-852)GGC>AGC	p.G284S		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AAAGCTTTGCCGCATTCTTCA	0.368													30	64	---	---	---	---	capture	Missense_Mutation	SNP	22941588	22941588	ZNF99	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	18080	103
MAP4K1	11184	broad.mit.edu	37	19	39104548	39104548	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39104548G>A	uc002oix.1	-	8	613	c.505C>T	c.(505-507)CGC>TGC	p.R169C	MAP4K1_uc002oiy.1_Missense_Mutation_p.R169C|MAP4K1_uc010xug.1_Translation_Start_Site	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	169	Protein kinase.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AAAGAGAGGCGTCTGGCCAGT	0.627													5	17	---	---	---	---	capture	Missense_Mutation	SNP	39104548	39104548	MAP4K1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9173	103
ACTN4	81	broad.mit.edu	37	19	39219650	39219650	+	Silent	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39219650C>T	uc002oja.1	+	20	2492	c.2433C>T	c.(2431-2433)TTC>TTT	p.F811F	ACTN4_uc002ojb.1_Silent_p.F133F	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	811	EF-hand 2.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGGCCGAGTTCAACCGCATCA	0.632													43	77	---	---	---	---	capture	Silent	SNP	39219650	39219650	ACTN4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	207	103
NCCRP1	342897	broad.mit.edu	37	19	39691346	39691346	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39691346C>T	uc002okq.1	+	6	797	c.778C>T	c.(778-780)CGG>TGG	p.R260W		NM_001001414	NP_001001414	Q6ZVX7	NCRP1_HUMAN	non-specific cytotoxic cell receptor protein 1	260	FBA.				protein catabolic process					ovary(1)	1						TGGTGGGCTGCGGCGGACACG	0.622													159	269	---	---	---	---	capture	Missense_Mutation	SNP	39691346	39691346	NCCRP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	10120	103
FCGBP	8857	broad.mit.edu	37	19	40396029	40396029	+	Silent	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40396029C>T	uc002omp.3	-	15	7376	c.7368G>A	c.(7366-7368)TCG>TCA	p.S2456S		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2456	VWFD 6.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGGGATCTCCCGACGCCTGGC	0.682													19	83	---	---	---	---	capture	Silent	SNP	40396029	40396029	FCGBP	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5724	103
ZNF526	116115	broad.mit.edu	37	19	42730234	42730234	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42730234C>T	uc002osz.1	+	3	1835	c.1679C>T	c.(1678-1680)CCC>CTC	p.P560L		NM_133444	NP_597701	Q8TF50	ZN526_HUMAN	zinc finger protein 526	560					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0704)				GCCCGCGCCCCCCGCCTCCCC	0.652													28	43	---	---	---	---	capture	Missense_Mutation	SNP	42730234	42730234	ZNF526	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	17846	103
CCDC85A	114800	broad.mit.edu	37	2	56599613	56599613	+	Silent	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:56599613G>A	uc002rzn.2	+	4	1954	c.1452G>A	c.(1450-1452)CCG>CCA	p.P484P		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	484										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CTACTCTCCCGGTGAGTGAAG	0.517													11	15	---	---	---	---	capture	Silent	SNP	56599613	56599613	CCDC85A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2833	103
BCL11A	53335	broad.mit.edu	37	2	60688423	60688423	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:60688423C>T	uc002sae.1	-	4	1852	c.1624G>A	c.(1624-1626)GCC>ACC	p.A542T	BCL11A_uc002sab.2_Missense_Mutation_p.A542T|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Missense_Mutation_p.A211T|BCL11A_uc010ypj.1_Missense_Mutation_p.A508T|BCL11A_uc002sad.1_Missense_Mutation_p.A390T|BCL11A_uc002saf.1_Missense_Mutation_p.A508T	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	542					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TCGGGCAGGGCGCGGCTCTCG	0.701			T	IGH@	B-CLL								10	22	---	---	---	---	capture	Missense_Mutation	SNP	60688423	60688423	BCL11A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1352	103
SGPP2	130367	broad.mit.edu	37	2	223423423	223423423	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223423423C>T	uc010zlo.1	+	5	1006	c.1006C>T	c.(1006-1008)CTC>TTC	p.L336F	SGPP2_uc010zlp.1_Missense_Mutation_p.L208F	NM_152386	NP_689599	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphotase 2	336	Helical; (Potential).				sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		TGTGTTGATCCTCTTGGTTCG	0.478													28	46	---	---	---	---	capture	Missense_Mutation	SNP	223423423	223423423	SGPP2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	14113	103
NCOA6	23054	broad.mit.edu	37	20	33364240	33364240	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33364240G>T	uc002xav.2	-	5	2818	c.247C>A	c.(247-249)CTA>ATA	p.L83I	NCOA6_uc002xaw.2_Missense_Mutation_p.L83I|NCOA6_uc010gew.1_Missense_Mutation_p.L83I	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	83	TBP/GTF2A-binding region.|NCOA1-binding region.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						TGTACTTTTAGCTTGCTGGAC	0.438													31	61	---	---	---	---	capture	Missense_Mutation	SNP	33364240	33364240	NCOA6	20	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	10140	103
SPO11	23626	broad.mit.edu	37	20	55908298	55908298	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55908298C>G	uc002xye.2	+	3	393	c.300C>G	c.(298-300)ATC>ATG	p.I100M	SPO11_uc002xyf.2_Missense_Mutation_p.I62M	NM_012444	NP_036576	Q9Y5K1	SPO11_HUMAN	meiotic recombination protein SPO11 isoform a	100					female gamete generation|reciprocal meiotic recombination	chromosome|nucleus	ATP binding|DNA binding|hydrolase activity			breast(2)|skin(1)	3	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			CCAGAAAGATCAAAAGTGATT	0.303								Editing_and_processing_nucleases					31	56	---	---	---	---	capture	Missense_Mutation	SNP	55908298	55908298	SPO11	20	C	G	G	G	1	0	0	0	0	1	0	0	0	369	29	4	4	14969	103
OSBPL2	9885	broad.mit.edu	37	20	60831247	60831247	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60831247G>A	uc002yck.1	+	2	209	c.7G>A	c.(7-9)GGA>AGA	p.G3R	OSBPL2_uc002ycl.1_Missense_Mutation_p.G3R|OSBPL2_uc011aah.1_5'UTR	NM_144498	NP_653081	Q9H1P3	OSBL2_HUMAN	oxysterol-binding protein-like protein 2 isoform	3					lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			AAGGATGAACGGAGAGGAAGA	0.483													23	40	---	---	---	---	capture	Missense_Mutation	SNP	60831247	60831247	OSBPL2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11182	103
PIWIL3	440822	broad.mit.edu	37	22	25150829	25150829	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:25150829G>A	uc003abd.1	-	7	1112	c.695C>T	c.(694-696)ACT>ATT	p.T232I	PIWIL3_uc011ajx.1_Missense_Mutation_p.T123I|PIWIL3_uc011ajy.1_Missense_Mutation_p.T123I|PIWIL3_uc010gut.1_Missense_Mutation_p.T232I	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	232					cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						CAGCTTGAAAGTTCTGGAAAT	0.333													40	66	---	---	---	---	capture	Missense_Mutation	SNP	25150829	25150829	PIWIL3	22	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	11862	103
PKDREJ	10343	broad.mit.edu	37	22	46655574	46655574	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46655574C>T	uc003bhh.2	-	1	3646	c.3646G>A	c.(3646-3648)GGG>AGG	p.G1216R		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	1216	Cytoplasmic (Potential).				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ATCACATGCCCCCGAAGATGC	0.448													67	129	---	---	---	---	capture	Missense_Mutation	SNP	46655574	46655574	PKDREJ	22	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	11873	103
LHFPL4	375323	broad.mit.edu	37	3	9594193	9594193	+	Silent	SNP	G	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9594193G>T	uc003bry.2	-	2	457	c.171C>A	c.(169-171)GGC>GGA	p.G57G		NM_198560	NP_940962	Q7Z7J7	LHPL4_HUMAN	lipoma HMGIC fusion partner-like 4	57						integral to membrane				ovary(2)|skin(1)	3	Medulloblastoma(99;0.227)					GGCCGAAGTAGCCAGGCTTGG	0.652													23	14	---	---	---	---	capture	Silent	SNP	9594193	9594193	LHFPL4	3	G	T	T	T	1	0	0	0	0	0	0	0	1	431	34	4	4	8687	103
NPRL2	10641	broad.mit.edu	37	3	50386328	50386328	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50386328G>A	uc003daj.1	-	5	965	c.562C>T	c.(562-564)CAG>TAG	p.Q188*	NPRL2_uc003dai.1_Nonsense_Mutation_p.Q68*|CYB561D2_uc003dak.2_5'Flank|CYB561D2_uc003dal.2_5'Flank|CYB561D2_uc003dam.2_5'Flank	NM_006545	NP_006536	Q8WTW4	NPRL2_HUMAN	tumor suppressor candidate 4	188					negative regulation of kinase activity		protein binding|protein kinase activity			lung(1)	1						AGGTCCCACTGTGAGTTGAAG	0.537													4	84	---	---	---	---	capture	Nonsense_Mutation	SNP	50386328	50386328	NPRL2	3	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	6	2	10504	103
KLHL6	89857	broad.mit.edu	37	3	183226008	183226008	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183226008G>A	uc003flr.2	-	3	806	c.748C>T	c.(748-750)CGA>TGA	p.R250*	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Nonsense_Mutation_p.R248*	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	250	BACK.									haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			AAGCAGAGTCGTTCTGATGGC	0.418													57	69	---	---	---	---	capture	Nonsense_Mutation	SNP	183226008	183226008	KLHL6	3	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	8313	103
PDS5A	23244	broad.mit.edu	37	4	39865056	39865056	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39865056C>T	uc003guv.3	-	24	3206	c.2666G>A	c.(2665-2667)CGA>CAA	p.R889Q	PDS5A_uc010ifo.2_Missense_Mutation_p.R849Q	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	889					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						AGCAGCTAATCGCAAGCGAGA	0.348													13	30	---	---	---	---	capture	Missense_Mutation	SNP	39865056	39865056	PDS5A	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11594	103
FRAS1	80144	broad.mit.edu	37	4	79350365	79350365	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79350365G>A	uc003hlb.2	+	36	5268	c.4828G>A	c.(4828-4830)GGC>AGC	p.G1610S	FRAS1_uc003hkw.2_Missense_Mutation_p.G1610S|FRAS1_uc010ijj.1_Missense_Mutation_p.G30S	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1609	CSPG 5.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CAGCCCAGGAGGCAGCACTTC	0.527													5	17	---	---	---	---	capture	Missense_Mutation	SNP	79350365	79350365	FRAS1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	5986	103
TRIML1	339976	broad.mit.edu	37	4	189068102	189068102	+	Missense_Mutation	SNP	C	T	T	rs147254109		TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189068102C>T	uc003izm.1	+	6	1098	c.983C>T	c.(982-984)GCG>GTG	p.A328V	TRIML1_uc003izn.1_Missense_Mutation_p.A52V	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	328	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GACCAGTCTGCGACTGTGCTG	0.537													50	42	---	---	---	---	capture	Missense_Mutation	SNP	189068102	189068102	TRIML1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16433	103
DNAH5	1767	broad.mit.edu	37	5	13762882	13762882	+	Silent	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13762882C>T	uc003jfd.2	-	60	10272	c.10230G>A	c.(10228-10230)ACG>ACA	p.T3410T	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3410	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CCATAGCTTTCGTCCAGGAAC	0.453									Kartagener_syndrome				30	38	---	---	---	---	capture	Silent	SNP	13762882	13762882	DNAH5	5	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	4561	103
OCLN	4950	broad.mit.edu	37	5	68805301	68805301	+	Silent	SNP	C	T	T	rs150730577	byFrequency	TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68805301C>T	uc003jwu.2	+	3	820	c.384C>T	c.(382-384)TAC>TAT	p.Y128Y	OCLN_uc003jwv.3_Silent_p.Y128Y	NM_002538	NP_002529			occludin												0		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		gctatggctaCGGAGGCTATA	0.403													64	78	---	---	---	---	capture	Silent	SNP	68805301	68805301	OCLN	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10725	103
ADAMTS19	171019	broad.mit.edu	37	5	129015540	129015540	+	Missense_Mutation	SNP	G	A	A	rs149851287		TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:129015540G>A	uc003kvb.1	+	17	2572	c.2572G>A	c.(2572-2574)GTT>ATT	p.V858I	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	858	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGGAACTACCGTTCATTATGT	0.433													40	100	---	---	---	---	capture	Missense_Mutation	SNP	129015540	129015540	ADAMTS19	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	264	103
GPX5	2880	broad.mit.edu	37	6	28497279	28497279	+	Missense_Mutation	SNP	G	A	A	rs60523386		TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28497279G>A	uc003nll.2	+	2	141	c.139G>A	c.(139-141)GCA>ACA	p.A47T	GPX5_uc003nlm.2_Missense_Mutation_p.A47T|GPX5_uc003nln.2_RNA	NM_001509	NP_001500	O75715	GPX5_HUMAN	glutathione peroxidase 5 isoform 1 precursor	47					lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity			skin(1)	1					Glutathione(DB00143)	TGAGGCCATCGCACTTAATAA	0.428													30	55	---	---	---	---	capture	Missense_Mutation	SNP	28497279	28497279	GPX5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6676	103
CARD11	84433	broad.mit.edu	37	7	2983971	2983971	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2983971G>A	uc003smv.2	-	5	963	c.559C>T	c.(559-561)CGG>TGG	p.R187W		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	187	Potential.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TAGCTGTCCCGCTCTTCCTTC	0.557			Mis		DLBCL								48	119	---	---	---	---	capture	Missense_Mutation	SNP	2983971	2983971	CARD11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	2621	103
HERPUD2	64224	broad.mit.edu	37	7	35712865	35712865	+	Silent	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:35712865C>T	uc003tet.2	-	2	976	c.171G>A	c.(169-171)GTG>GTA	p.V57V	HERPUD2_uc003tes.3_Silent_p.V57V	NM_022373	NP_071768	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	57	Ubiquitin-like.				response to unfolded protein	integral to membrane				ovary(3)	3						TGCCCGAATACACCAATCTCT	0.373													33	92	---	---	---	---	capture	Silent	SNP	35712865	35712865	HERPUD2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	6990	103
FAM40B	57464	broad.mit.edu	37	7	129104580	129104580	+	Splice_Site	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129104580G>A	uc011koy.1	+	16	1816	c.1776_splice	c.e16+1	p.Q592_splice	FAM40B_uc003vow.2_Splice_Site_p.Q592_splice|FAM40B_uc011koz.1_Splice_Site_p.Q84_splice	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a												0						TATCTACCAGGTGAGCAGCTA	0.468													42	105	---	---	---	---	capture	Splice_Site	SNP	129104580	129104580	FAM40B	7	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	5509	103
CREB3L2	64764	broad.mit.edu	37	7	137686380	137686380	+	Silent	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:137686380G>A	uc003vtw.2	-	1	467	c.72C>T	c.(70-72)CCC>CCT	p.P24P	CREB3L2_uc003vtx.1_Silent_p.P24P|CREB3L2_uc003vty.3_Silent_p.P24P|AKR1D1_uc011kqb.1_5'Flank|AKR1D1_uc011kqc.1_5'Flank|AKR1D1_uc011kqd.1_5'Flank	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like	24	Cytoplasmic (Potential).				chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						CGCCGTCCCCGGGCTCTGACA	0.706			T	FUS	fibromyxoid sarcoma								3	72	---	---	---	---	capture	Silent	SNP	137686380	137686380	CREB3L2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3822	103
TAS2R60	338398	broad.mit.edu	37	7	143140562	143140562	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143140562T>C	uc011ktg.1	+	1	17	c.17T>C	c.(16-18)ATG>ACG	p.M6T	uc003wda.2_Intron	NM_177437	NP_803186	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	6	Extracellular (Potential).				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity			skin(6)	6	Melanoma(164;0.172)					GGAGACCACATGGTTCTAGGA	0.468													65	205	---	---	---	---	capture	Missense_Mutation	SNP	143140562	143140562	TAS2R60	7	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	15473	103
SSPO	23145	broad.mit.edu	37	7	149509076	149509076	+	Missense_Mutation	SNP	C	T	T	rs139588484	by1000genomes	TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149509076C>T	uc010lpk.2	+	69	9622	c.9622C>T	c.(9622-9624)CGG>TGG	p.R3208W		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	3208	TSP type-1 11.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCATCGGCACCGGTTCTGTGC	0.687													21	72	---	---	---	---	capture	Missense_Mutation	SNP	149509076	149509076	SSPO	7	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	15081	103
DOCK5	80005	broad.mit.edu	37	8	25181427	25181427	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25181427C>A	uc003xeg.2	+	17	1816	c.1679C>A	c.(1678-1680)ACC>AAC	p.T560N	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.T274N|DOCK5_uc003xei.2_Missense_Mutation_p.T130N|DOCK5_uc003xej.2_5'Flank	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	560	DHR-1.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CCGGATGGCACCACTCTGCAG	0.488													7	14	---	---	---	---	capture	Missense_Mutation	SNP	25181427	25181427	DOCK5	8	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	4646	103
TEX15	56154	broad.mit.edu	37	8	30700338	30700338	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30700338C>T	uc003xil.2	-	1	6196	c.6196G>A	c.(6196-6198)GTC>ATC	p.V2066I		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2066										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GAGACCATGACGATTTCAATA	0.338													11	21	---	---	---	---	capture	Missense_Mutation	SNP	30700338	30700338	TEX15	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15664	103
PCMTD1	115294	broad.mit.edu	37	8	52733200	52733200	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52733200T>A	uc003xqx.3	-	6	1126	c.785A>T	c.(784-786)GAG>GTG	p.E262V	PCMTD1_uc011ldm.1_Missense_Mutation_p.E132V|PCMTD1_uc003xqw.3_Missense_Mutation_p.E262V|PCMTD1_uc011ldn.1_Missense_Mutation_p.E74V|PCMTD1_uc010lya.2_Missense_Mutation_p.E186V	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	262						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				GGCCTGCATCTCATCATTTAT	0.408													7	173	---	---	---	---	capture	Missense_Mutation	SNP	52733200	52733200	PCMTD1	8	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	11489	103
TCEA1	6917	broad.mit.edu	37	8	54897020	54897020	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:54897020C>T	uc003xru.2	-	7	904	c.581G>A	c.(580-582)AGG>AAG	p.R194K	TCEA1_uc003xrv.2_Missense_Mutation_p.R173K|TCEA1_uc011ldw.1_Intron|TCEA1_uc010lyg.2_RNA	NM_006756	NP_006747	P23193	TCEA1_HUMAN	transcription elongation factor A 1 isoform 1	194	TFIIS central.				positive regulation of viral transcription|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|translation elongation factor activity|zinc ion binding				0		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			ATTTGATATCCTACTTCGTAC	0.333			T	PLAG1	salivary adenoma								8	8	---	---	---	---	capture	Missense_Mutation	SNP	54897020	54897020	TCEA1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	15554	103
OPLAH	26873	broad.mit.edu	37	8	145108275	145108275	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145108275G>A	uc003zar.3	-	20	2790	c.2708C>T	c.(2707-2709)GCG>GTG	p.A903V	OPLAH_uc003zas.1_Silent_p.G177G	NM_017570	NP_060040	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	903							5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)	CTTGCCTGGCGCCCGCAGGGC	0.642													32	63	---	---	---	---	capture	Missense_Mutation	SNP	145108275	145108275	OPLAH	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10780	103
TLE4	7091	broad.mit.edu	37	9	82333807	82333807	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:82333807C>T	uc004ald.2	+	16	2435	c.1586C>T	c.(1585-1587)ACG>ATG	p.T529M	TLE4_uc004alc.2_Missense_Mutation_p.T504M|TLE4_uc010mpr.2_Missense_Mutation_p.T383M|TLE4_uc004ale.2_Missense_Mutation_p.T141M|TLE4_uc011lsq.1_Missense_Mutation_p.T472M|TLE4_uc010mps.2_Missense_Mutation_p.T428M|TLE4_uc004alf.2_Missense_Mutation_p.T443M	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5						CACGTGTACACGGGTGGGAAG	0.602													61	99	---	---	---	---	capture	Missense_Mutation	SNP	82333807	82333807	TLE4	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15826	103
CIZ1	25792	broad.mit.edu	37	9	130952718	130952718	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130952718A>G	uc004btt.2	-	3	339	c.176T>C	c.(175-177)CTC>CCC	p.L59P	CIZ1_uc004btr.2_Missense_Mutation_p.L59P|CIZ1_uc004bts.2_Missense_Mutation_p.L59P|CIZ1_uc011maq.1_Missense_Mutation_p.L59P|CIZ1_uc004btu.2_Missense_Mutation_p.L59P|CIZ1_uc011mar.1_Intron|CIZ1_uc011mas.1_Missense_Mutation_p.L89P|CIZ1_uc004btw.2_Missense_Mutation_p.L59P|CIZ1_uc004btv.2_Missense_Mutation_p.L59P|CIZ1_uc004btx.2_Missense_Mutation_p.L59P	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform	59						nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						CTGCGGGGGGAGCCCCCTGTG	0.582													5	14	---	---	---	---	capture	Missense_Mutation	SNP	130952718	130952718	CIZ1	9	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	3406	103
ABL1	25	broad.mit.edu	37	9	133750310	133750310	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133750310G>T	uc004bzw.2	+	7	1144	c.1141G>T	c.(1141-1143)GAT>TAT	p.D381Y	ABL1_uc004bzv.2_Missense_Mutation_p.D400Y	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	381	Kinase activation loop.|Protein kinase.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	GAAGGTAGCTGATTTTGGCCT	0.537			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								64	95	---	---	---	---	capture	Missense_Mutation	SNP	133750310	133750310	ABL1	9	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	92	103
LHX3	8022	broad.mit.edu	37	9	139091685	139091685	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139091685G>A	uc004cha.2	-	3	390	c.293C>T	c.(292-294)CCG>CTG	p.P98L	LHX3_uc004cgz.2_Missense_Mutation_p.P103L	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a	98	LIM zinc-binding 2.				inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CTGCGTGGGCGGGATGCCCAG	0.716													11	9	---	---	---	---	capture	Missense_Mutation	SNP	139091685	139091685	LHX3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8692	103
P2RY8	286530	broad.mit.edu	37	X	1584486	1584486	+	Silent	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1584486G>A	uc004cpz.2	-	2	1214	c.966C>T	c.(964-966)CGC>CGT	p.R322R		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	322	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGAGGCTCTCGCGGCGCGTGT	0.672			T	CRLF2	B-ALL|Downs associated ALL								50	69	---	---	---	---	capture	Silent	SNP	1584486	1584486	P2RY8	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11259	103
FAM47A	158724	broad.mit.edu	37	X	34149408	34149408	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34149408G>T	uc004ddg.2	-	1	1021	c.988C>A	c.(988-990)CCG>ACG	p.P330T		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	330										ovary(4)|central_nervous_system(1)	5						CCAGTCTCCGGAGGCTCCGGG	0.637													17	2	---	---	---	---	capture	Missense_Mutation	SNP	34149408	34149408	FAM47A	23	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	5517	103
L1CAM	3897	broad.mit.edu	37	X	153130626	153130626	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153130626G>A	uc004fjb.2	-	21	2897	c.2789C>T	c.(2788-2790)TCG>TTG	p.S930L	L1CAM_uc004fjc.2_Missense_Mutation_p.S930L|L1CAM_uc010nuo.2_Missense_Mutation_p.S925L	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	930	Extracellular (Potential).|Fibronectin type-III 4.				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTGGTGTTCGACTGGCACTC	0.701													17	6	---	---	---	---	capture	Missense_Mutation	SNP	153130626	153130626	L1CAM	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8508	103
KLHL12	59349	broad.mit.edu	37	1	202862387	202862387	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202862387delC	uc001gyo.1	-	11	1760	c.1560delG	c.(1558-1560)GGGfs	p.G520fs	KLHL12_uc001gym.1_Intron|KLHL12_uc001gyn.1_Intron|KLHL12_uc010pqc.1_Frame_Shift_Del_p.G558fs|KLHL12_uc009xah.1_Frame_Shift_Del_p.G419fs	NM_021633	NP_067646	Q53G59	KLH12_HUMAN	kelch-like 12	520	Interaction with DVL3.|Kelch 5.				Wnt receptor signaling pathway		protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.166)			CATAGAGTCTCCCCCGAAGCA	0.468													60	104	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	202862387	202862387	KLHL12	1	C	-	-	-	1	0	1	0	1	0	0	0	0	379	30	5	5	8288	103
CLECL1	160365	broad.mit.edu	37	12	9885637	9885637	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9885637delA	uc001qwj.2	-	1	224	c.224delT	c.(223-225)TTGfs	p.L75fs		NM_172004	NP_742001	Q8IZS7	CLCL1_HUMAN	type II transmembrane protein DCAL1	75	Helical; Signal-anchor for type II membrane protein; (Potential).					integral to membrane|plasma membrane	sugar binding				0						TGCACAGATCAAAAAGAGAGA	0.423													22	86	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	9885637	9885637	CLECL1	12	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	3488	103
OGDH	4967	broad.mit.edu	37	7	44684936	44684936	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-5859-01	TCGA-06-5859-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44684936delT	uc003tln.2	+	3	342	c.233delT	c.(232-234)ATTfs	p.I78fs	OGDH_uc003tlm.2_Frame_Shift_Del_p.I78fs|OGDH_uc011kbx.1_Frame_Shift_Del_p.I78fs|OGDH_uc011kby.1_Intron|OGDH_uc003tlp.2_Frame_Shift_Del_p.I78fs|OGDH_uc011kbz.1_5'UTR|OGDH_uc003tlo.1_5'UTR	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	78					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	TCATGGGACATTTTTTTTCGC	0.577													7	413	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44684936	44684936	OGDH	7	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	10744	103
