Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TNFRSF8	943	broad.mit.edu	37	1	12172031	12172031	+	Silent	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12172031C>T	uc001atq.2	+	7	975	c.753C>T	c.(751-753)GAC>GAT	p.D251D	TNFRSF8_uc010obc.1_Silent_p.D140D	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	251	TNFR-Cys 5.|Extracellular (Potential).				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		ACTACCTGGACGAGGCCGGCC	0.602													11	23	---	---	---	---	capture	Silent	SNP	12172031	12172031	TNFRSF8	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16182	104
NT5C1A	84618	broad.mit.edu	37	1	40131873	40131873	+	Silent	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40131873G>A	uc001cdq.1	-	2	171	c.171C>T	c.(169-171)TCC>TCT	p.S57S		NM_032526	NP_115915	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	57					purine base metabolic process|purine nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGGCTCGGGAGGACACAGCGA	0.582													25	37	---	---	---	---	capture	Silent	SNP	40131873	40131873	NT5C1A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	10592	104
MSH4	4438	broad.mit.edu	37	1	76272802	76272802	+	Silent	SNP	T	C	C			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:76272802T>C	uc001dhd.1	+	3	605	c.564T>C	c.(562-564)TTT>TTC	p.F188F		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	188					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						TATCCCAGTTTGCAGACAACA	0.373								MMR					32	66	---	---	---	---	capture	Silent	SNP	76272802	76272802	MSH4	1	T	C	C	C	1	0	0	0	0	0	0	0	1	816	63	3	3	9782	104
ELTD1	64123	broad.mit.edu	37	1	79392712	79392712	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:79392712G>T	uc001diq.3	-	8	1098	c.942C>A	c.(940-942)AAC>AAA	p.N314K		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	314	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TCAATAAGAAGTTGTCAGATG	0.318													3	52	---	---	---	---	capture	Missense_Mutation	SNP	79392712	79392712	ELTD1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	5039	104
KCND3	3752	broad.mit.edu	37	1	112524445	112524445	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:112524445G>A	uc001ebu.1	-	2	1384	c.904C>T	c.(904-906)CGC>TGC	p.R302C	KCND3_uc001ebv.1_Missense_Mutation_p.R302C	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	302	Helical; Voltage-sensor; Name=Segment S4; (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		TGGGAGTGGCGGGAAAACTTG	0.582													27	42	---	---	---	---	capture	Missense_Mutation	SNP	112524445	112524445	KCND3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7942	104
FLG	2312	broad.mit.edu	37	1	152283656	152283656	+	Missense_Mutation	SNP	G	A	A	rs144184134	byFrequency	TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152283656G>A	uc001ezu.1	-	3	3742	c.3706C>T	c.(3706-3708)CGT>TGT	p.R1236C	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1236	Ser-rich.|Filaggrin 7.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCATGGTGACGTGACCCTGAG	0.562									Ichthyosis				141	230	---	---	---	---	capture	Missense_Mutation	SNP	152283656	152283656	FLG	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5867	104
FLG2	388698	broad.mit.edu	37	1	152328935	152328935	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152328935C>T	uc001ezw.3	-	3	1400	c.1327G>A	c.(1327-1329)GAA>AAA	p.E443K	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	443	Filaggrin 2.|Ser-rich.						calcium ion binding|structural molecule activity	p.E443V(1)		ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACATGTTGTTCGAACCCAGAG	0.448													56	85	---	---	---	---	capture	Missense_Mutation	SNP	152328935	152328935	FLG2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5868	104
SMCP	4184	broad.mit.edu	37	1	152857174	152857174	+	Silent	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152857174G>A	uc001fat.2	+	2	421	c.276G>A	c.(274-276)CCG>CCA	p.P92P		NM_030663	NP_109588	P49901	MCSP_HUMAN	sperm mitochondria-associated cysteine-rich	92					penetration of zona pellucida|sperm motility	mitochondrial membrane					0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCAACTCACCGCAAACTCAGG	0.537													4	135	---	---	---	---	capture	Silent	SNP	152857174	152857174	SMCP	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14681	104
USH2A	7399	broad.mit.edu	37	1	215799138	215799138	+	Silent	SNP	T	C	C			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215799138T>C	uc001hku.1	-	72	15981	c.15594A>G	c.(15592-15594)ACA>ACG	p.T5198T		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	5198	Cytoplasmic (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGTGGGTGTCTGTGAATGTGG	0.463										HNSCC(13;0.011)			3	60	---	---	---	---	capture	Silent	SNP	215799138	215799138	USH2A	1	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	16918	104
RYR2	6262	broad.mit.edu	37	1	237806746	237806746	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237806746A>T	uc001hyl.1	+	48	7461	c.7341A>T	c.(7339-7341)AAA>AAT	p.K2447N		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2447	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAATAGCCAAAGGTAAGGCCA	0.438													46	56	---	---	---	---	capture	Missense_Mutation	SNP	237806746	237806746	RYR2	1	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	13661	104
PCDH15	65217	broad.mit.edu	37	10	55944974	55944974	+	Missense_Mutation	SNP	C	T	T	rs61735473	byFrequency;by1000genomes	TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:55944974C>T	uc001jju.1	-	12	1755	c.1360G>A	c.(1360-1362)GTC>ATC	p.V454I	PCDH15_uc010qhq.1_Missense_Mutation_p.V459I|PCDH15_uc010qhr.1_Missense_Mutation_p.V454I|PCDH15_uc010qhs.1_Missense_Mutation_p.V466I|PCDH15_uc010qht.1_Missense_Mutation_p.V461I|PCDH15_uc010qhu.1_Missense_Mutation_p.V454I|PCDH15_uc001jjv.1_Missense_Mutation_p.V432I|PCDH15_uc010qhv.1_Missense_Mutation_p.V454I|PCDH15_uc010qhw.1_Missense_Mutation_p.V417I|PCDH15_uc010qhx.1_Missense_Mutation_p.V454I|PCDH15_uc010qhy.1_Missense_Mutation_p.V459I|PCDH15_uc010qhz.1_Missense_Mutation_p.V454I|PCDH15_uc010qia.1_Missense_Mutation_p.V432I|PCDH15_uc010qib.1_Missense_Mutation_p.V432I|PCDH15_uc001jjw.2_Missense_Mutation_p.V454I	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	454	Cadherin 4.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	p.V454I(1)		pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GTCTGTGTGACGGTGAAGACT	0.393										HNSCC(58;0.16)			25	21	---	---	---	---	capture	Missense_Mutation	SNP	55944974	55944974	PCDH15	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11414	104
C10orf79	80217	broad.mit.edu	37	10	105928529	105928529	+	Silent	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105928529C>T	uc001kxw.2	-	21	2780	c.2664G>A	c.(2662-2664)TCG>TCA	p.S888S	C10orf79_uc009xxq.2_Silent_p.S196S|C10orf79_uc001kxx.3_Silent_p.S889S	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	888											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		TCACAGCCATCGAATTCCAAC	0.373													42	16	---	---	---	---	capture	Silent	SNP	105928529	105928529	C10orf79	10	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	1606	104
ADRB1	153	broad.mit.edu	37	10	115804336	115804336	+	Silent	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:115804336C>T	uc001lba.2	+	1	531	c.445C>T	c.(445-447)CTG>TTG	p.L149L		NM_000684	NP_000675	P08588	ADRB1_HUMAN	beta-1-adrenergic receptor	149	Helical; Name=3; (By similarity).				positive regulation of cAMP biosynthetic process	integral to plasma membrane	alpha-2A adrenergic receptor binding|beta1-adrenergic receptor activity|protein heterodimerization activity				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0124)|all cancers(201;0.0298)	Acebutolol(DB01193)|Alprenolol(DB00866)|Amiodarone(DB01118)|Arbutamine(DB01102)|Atenolol(DB00335)|Betaxolol(DB00195)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Desipramine(DB01151)|Dobutamine(DB00841)|Dopamine(DB00988)|Epinephrine(DB00668)|Esmolol(DB00187)|Isoetharine(DB00221)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Metoprolol(DB00264)|Nadolol(DB01203)|Norepinephrine(DB00368)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Practolol(DB01297)|Propranolol(DB00571)|Risperidone(DB00734)|Timolol(DB00373)|Ziprasidone(DB00246)	CATCGAGACCCTGTGTGTCAT	0.577													52	46	---	---	---	---	capture	Silent	SNP	115804336	115804336	ADRB1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	340	104
CD6	923	broad.mit.edu	37	11	60780934	60780934	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60780934G>A	uc001nqq.2	+	7	1413	c.1190G>A	c.(1189-1191)CGG>CAG	p.R397Q	CD6_uc009yni.2_Missense_Mutation_p.R296Q|CD6_uc009ynj.2_Missense_Mutation_p.R274Q|CD6_uc001nqp.2_Missense_Mutation_p.R397Q|CD6_uc001nqr.2_Missense_Mutation_p.R397Q|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Missense_Mutation_p.R397Q	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor	397	Extracellular (Potential).				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						AAGGAATCTCGGGAGCTAATG	0.443													6	224	---	---	---	---	capture	Missense_Mutation	SNP	60780934	60780934	CD6	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2999	104
PPP2R5B	5526	broad.mit.edu	37	11	64695622	64695622	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64695622G>T	uc001oby.2	+	5	1168	c.583G>T	c.(583-585)GTC>TTC	p.V195F	PPP2R5B_uc001obz.2_Missense_Mutation_p.V195F	NM_006244	NP_006235	Q15173	2A5B_HUMAN	beta isoform of regulatory subunit B56, protein	195					signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(2)	2						TCAAAAGTTTGTCCTGATGGT	0.582													30	53	---	---	---	---	capture	Missense_Mutation	SNP	64695622	64695622	PPP2R5B	11	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	12294	104
CABP4	57010	broad.mit.edu	37	11	67222962	67222962	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67222962C>T	uc001olo.2	+	1	145	c.68C>T	c.(67-69)GCG>GTG	p.A23V	GPR152_uc001olm.2_5'Flank|CABP4_uc001oln.2_Intron	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	23					visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			AAGCCCCCTGCGGGGGTTGTG	0.632													5	12	---	---	---	---	capture	Missense_Mutation	SNP	67222962	67222962	CABP4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2509	104
AMOTL1	154810	broad.mit.edu	37	11	94554698	94554698	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94554698G>A	uc001pfb.2	+	4	1294	c.1124G>A	c.(1123-1125)CGC>CAC	p.R375H	AMOTL1_uc001pfc.2_Missense_Mutation_p.R325H	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	375						cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CCTTGCAGCCGCCCATGCCAA	0.602													11	17	---	---	---	---	capture	Missense_Mutation	SNP	94554698	94554698	AMOTL1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	583	104
IL26	55801	broad.mit.edu	37	12	68619233	68619233	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68619233C>G	uc001stx.1	-	2	254	c.219G>C	c.(217-219)AAG>AAC	p.K73N		NM_018402	NP_060872	Q9NPH9	IL26_HUMAN	interleukin 26 precursor	73					cell-cell signaling|negative regulation of epithelial cell proliferation|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of JAK-STAT cascade|positive regulation of protein kinase B signaling cascade|positive regulation of stress-activated MAPK cascade|positive regulation of transcription from RNA polymerase II promoter	cytosol|extracellular space|soluble fraction	cytokine activity				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		CCATAAACTGCTTTTTTGTTT	0.274													5	17	---	---	---	---	capture	Missense_Mutation	SNP	68619233	68619233	IL26	12	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	7602	104
RCBTB1	55213	broad.mit.edu	37	13	50140816	50140816	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:50140816C>T	uc001vde.1	-	4	476	c.215G>A	c.(214-216)TGT>TAT	p.C72Y		NM_018191	NP_060661	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and	72	RCC1 1.				cell cycle|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(1)	1		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		CTTCTTTCCACATAAGCCTTC	0.408													34	73	---	---	---	---	capture	Missense_Mutation	SNP	50140816	50140816	RCBTB1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	13066	104
ABCC4	10257	broad.mit.edu	37	13	95715080	95715080	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:95715080T>C	uc001vmd.3	-	26	3363	c.3244A>G	c.(3244-3246)AGT>GGT	p.S1082G	ABCC4_uc010afj.2_5'UTR|ABCC4_uc010afk.2_Missense_Mutation_p.S1035G	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	1082	ABC transporter 2.|ATP 2 (Potential).				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	ATGAGGGAACTTTTTCCAGCT	0.398													25	45	---	---	---	---	capture	Missense_Mutation	SNP	95715080	95715080	ABCC4	13	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	55	104
RYR3	6263	broad.mit.edu	37	15	33873724	33873724	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33873724G>T	uc001zhi.2	+	14	1523	c.1453G>T	c.(1453-1455)GTC>TTC	p.V485F	RYR3_uc010bar.2_Missense_Mutation_p.V485F	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	485	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTTGGCCCTTGTCTTAAATTG	0.438													7	107	---	---	---	---	capture	Missense_Mutation	SNP	33873724	33873724	RYR3	15	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	13662	104
SLTM	79811	broad.mit.edu	37	15	59181723	59181723	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:59181723G>C	uc002afp.2	-	16	2198	c.2110C>G	c.(2110-2112)CGA>GGA	p.R704G	SLTM_uc002afn.2_Missense_Mutation_p.R246G|SLTM_uc002afo.2_Missense_Mutation_p.R686G|SLTM_uc002afq.2_Missense_Mutation_p.R273G|SLTM_uc010bgd.2_Missense_Mutation_p.R273G	NM_024755	NP_079031	Q9NWH9	SLTM_HUMAN	modulator of estrogen induced transcription	704	Arg/Glu-rich.|Potential.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)	1						TCTCTTTCTCGAGCAATCCGT	0.413													14	28	---	---	---	---	capture	Missense_Mutation	SNP	59181723	59181723	SLTM	15	G	C	C	C	1	0	0	0	0	1	0	0	0	480	37	4	4	14646	104
CYP1A2	1544	broad.mit.edu	37	15	75042328	75042328	+	Silent	SNP	G	A	A	rs17861153	byFrequency	TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75042328G>A	uc002ayr.1	+	2	313	c.249G>A	c.(247-249)ACG>ACA	p.T83T		NM_000761	NP_000752	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A,	83			T -> M (in allele CYP1A2*9).		alkaloid metabolic process|exogenous drug catabolic process|methylation|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative deethylation|oxidative demethylation|steroid catabolic process|toxin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|demethylase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding			ovary(3)|breast(1)	4					Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Aciclovir(DB00787)|Alosetron(DB00969)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Anagrelide(DB00261)|Azelastine(DB00972)|Bortezomib(DB00188)|Caffeine(DB00201)|Carmustine(DB00262)|Chlordiazepoxide(DB00475)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Clomipramine(DB01242)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Desloratadine(DB00967)|Diazepam(DB00829)|Dibucaine(DB00527)|Diclofenac(DB00586)|Duloxetine(DB00476)|Enoxacin(DB00467)|Esomeprazole(DB00736)|Estradiol(DB00783)|Estrone(DB00655)|Fluorouracil(DB00544)|Flutamide(DB00499)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Grepafloxacin(DB00365)|Haloperidol(DB00502)|Hesperetin(DB01094)|Imipramine(DB00458)|Ketoconazole(DB01026)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Melatonin(DB01065)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mirtazapine(DB00370)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pefloxacin(DB00487)|Pimozide(DB01100)|Propafenone(DB01182)|Propranolol(DB00571)|Quinidine(DB00908)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifampin(DB01045)|Riluzole(DB00740)|Rofecoxib(DB00533)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Tacrine(DB00382)|Telithromycin(DB00976)|Terfenadine(DB00342)|Theophylline(DB00277)|Thiabendazole(DB00730)|Tizanidine(DB00697)|Tolbutamide(DB01124)|Verapamil(DB00661)|Warfarin(DB00682)|Zileuton(DB00744)|Zolmitriptan(DB00315)	TTGGCTCCACGCCCGTGCTGG	0.667													6	45	---	---	---	---	capture	Silent	SNP	75042328	75042328	CYP1A2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4110	104
IL4R	3566	broad.mit.edu	37	16	27374339	27374339	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27374339C>T	uc002don.2	+	11	1908	c.1666C>T	c.(1666-1668)CGA>TGA	p.R556*	IL4R_uc002dop.3_Nonsense_Mutation_p.R541*|IL4R_uc010bxy.2_Nonsense_Mutation_p.R556*|IL4R_uc002doo.2_Nonsense_Mutation_p.R396*	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	556	Cytoplasmic (Potential).|Required for IRS1 activation and IL4- induced cell growth.				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						GATCCTCCGCCGAAATGTCCT	0.637													12	25	---	---	---	---	capture	Nonsense_Mutation	SNP	27374339	27374339	IL4R	16	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	7621	104
IRX6	79190	broad.mit.edu	37	16	55361572	55361572	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:55361572C>T	uc002ehy.2	+	4	1021	c.488C>T	c.(487-489)GCC>GTC	p.A163V	IRX6_uc002ehx.2_Missense_Mutation_p.A163V|IRX6_uc010ccb.1_RNA	NM_024335	NP_077311	P78412	IRX6_HUMAN	iroquois homeobox protein 6	163	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(1)	6						ACACTCAAGGCCTGGCTCAAC	0.592													29	28	---	---	---	---	capture	Missense_Mutation	SNP	55361572	55361572	IRX6	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7771	104
SOX9	6662	broad.mit.edu	37	17	70118954	70118954	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:70118954C>T	uc002jiw.2	+	2	898	c.526C>T	c.(526-528)CCG>TCG	p.P176S	uc002jiv.2_5'Flank	NM_000346	NP_000337	P48436	SOX9_HUMAN	transcription factor SOX9	176					cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription				0		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CAAGTACCAGCCGCGGCGGAG	0.652													30	49	---	---	---	---	capture	Missense_Mutation	SNP	70118954	70118954	SOX9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14850	104
OTOP3	347741	broad.mit.edu	37	17	72943010	72943010	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72943010G>A	uc010wrr.1	+	6	1060	c.1060G>A	c.(1060-1062)GTC>ATC	p.V354I	OTOP3_uc010wrq.1_Missense_Mutation_p.V336I	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3	354	Helical; (Potential).					integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)					AGGTGTGTGCGTCTTTGTGCT	0.627													27	46	---	---	---	---	capture	Missense_Mutation	SNP	72943010	72943010	OTOP3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11211	104
EPB41L3	23136	broad.mit.edu	37	18	5395093	5395093	+	Silent	SNP	C	A	A	rs144676596		TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5395093C>A	uc002kmt.1	-	21	3212	c.3126G>T	c.(3124-3126)ACG>ACT	p.T1042T	EPB41L3_uc010wzh.1_Silent_p.T873T|EPB41L3_uc002kmu.1_Silent_p.T820T|EPB41L3_uc010dkq.1_Silent_p.T711T|EPB41L3_uc002kms.1_Silent_p.T277T|EPB41L3_uc010wze.1_Silent_p.T347T|EPB41L3_uc010wzf.1_Silent_p.T339T|EPB41L3_uc010wzg.1_Silent_p.T314T|EPB41L3_uc010dkr.2_Silent_p.T434T	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1042	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CTGCATCCCCCGTGATGACTA	0.448													39	79	---	---	---	---	capture	Silent	SNP	5395093	5395093	EPB41L3	18	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	5109	104
FBXO15	201456	broad.mit.edu	37	18	71791770	71791770	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:71791770G>C	uc002lle.2	-	7	1057	c.721C>G	c.(721-723)CAT>GAT	p.H241D	FBXO15_uc002llf.2_Missense_Mutation_p.H317D	NM_152676	NP_689889	Q8NCQ5	FBX15_HUMAN	F-box protein 15 isoform 1	241										ovary(2)|pancreas(1)	3		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TGATGAAAATGAAGATTTGCC	0.328													35	29	---	---	---	---	capture	Missense_Mutation	SNP	71791770	71791770	FBXO15	18	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	5674	104
FUT5	2527	broad.mit.edu	37	19	5867028	5867028	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5867028G>A	uc002mdo.3	-	2	797	c.709C>T	c.(709-711)CGC>TGC	p.R237C	FUT5_uc010duo.2_Missense_Mutation_p.R237C	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	237	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						TTGTGGGAGCGTCCGTACACG	0.622													31	54	---	---	---	---	capture	Missense_Mutation	SNP	5867028	5867028	FUT5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6049	104
MUC16	94025	broad.mit.edu	37	19	9091524	9091524	+	Silent	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9091524G>A	uc002mkp.2	-	1	495	c.291C>T	c.(289-291)TCC>TCT	p.S97S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	97	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCTTTGCTCGGAGTGTGTCA	0.537													6	144	---	---	---	---	capture	Silent	SNP	9091524	9091524	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9883	104
LYPD4	147719	broad.mit.edu	37	19	42342222	42342222	+	Missense_Mutation	SNP	C	T	T	rs142442476	byFrequency	TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42342222C>T	uc002orp.1	-	4	1309	c.325G>A	c.(325-327)GTC>ATC	p.V109I	LYPD4_uc002orq.1_Missense_Mutation_p.V74I	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	109						anchored to membrane|plasma membrane				ovary(1)	1						GACCGGCAGACGCGACTGTAG	0.522													22	84	---	---	---	---	capture	Missense_Mutation	SNP	42342222	42342222	LYPD4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9027	104
PSG2	5670	broad.mit.edu	37	19	43576027	43576027	+	Silent	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43576027C>T	uc002ovr.2	-	4	882	c.789G>A	c.(787-789)GCG>GCA	p.A263A	PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Silent_p.A263A|PSG2_uc010eiq.1_Silent_p.A263A|PSG2_uc002ovs.3_Silent_p.A263A|PSG2_uc002ovt.3_Silent_p.A263A	NM_031246	NP_112536	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	263	Ig-like C2-type 2.				cell migration|female pregnancy	extracellular region					0		Prostate(69;0.00682)				GGTTAGAGTTCGCGAAGCAAG	0.443													83	232	---	---	---	---	capture	Silent	SNP	43576027	43576027	PSG2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	12550	104
PSG4	5672	broad.mit.edu	37	19	43708378	43708378	+	Silent	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43708378C>T	uc002ovy.2	-	2	192	c.90G>A	c.(88-90)CCG>CCA	p.P30P	PSG4_uc002owa.2_RNA|PSG4_uc002owb.2_Silent_p.P30P|PSG4_uc002ovz.2_Silent_p.P30P	NM_002780	NP_002771	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4 isoform	30					defense response|female pregnancy	extracellular region				ovary(1)	1		Prostate(69;0.00682)				CAGTTGTGGGCGGATTCCAGA	0.468													64	147	---	---	---	---	capture	Silent	SNP	43708378	43708378	PSG4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12552	104
NLRP4	147945	broad.mit.edu	37	19	56370207	56370207	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56370207T>A	uc002qmd.3	+	3	1870	c.1448T>A	c.(1447-1449)TTG>TAG	p.L483*	NLRP4_uc002qmf.2_Nonsense_Mutation_p.L408*|NLRP4_uc010etf.2_Nonsense_Mutation_p.L314*	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	483							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GTACAGGAATTGCTAGTTGCC	0.423													34	155	---	---	---	---	capture	Nonsense_Mutation	SNP	56370207	56370207	NLRP4	19	T	A	A	A	1	0	0	0	0	0	1	0	0	819	63	5	4	10386	104
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													4	13	---	---	---	---	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	104
RAD51AP2	729475	broad.mit.edu	37	2	17692095	17692095	+	Silent	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:17692095G>A	uc002rcl.1	-	3	3480	c.3456C>T	c.(3454-3456)TAC>TAT	p.Y1152Y	RAD51AP2_uc010exn.1_Silent_p.Y1143Y	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1152	Interaction with RAD51.									ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTAAGTTTCCGTAACACATTT	0.338													7	12	---	---	---	---	capture	Silent	SNP	17692095	17692095	RAD51AP2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12882	104
TMEM17	200728	broad.mit.edu	37	2	62728426	62728426	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:62728426C>T	uc002sbt.2	-	4	855	c.515G>A	c.(514-516)CGT>CAT	p.R172H	TMEM17_uc002sbu.2_3'UTR|TMEM17_uc002sbv.1_3'UTR	NM_198276	NP_938017	Q86X19	TMM17_HUMAN	transmembrane protein 17	172						integral to membrane					0	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			GAGGTGGAAACGAACTGCCAA	0.423													26	57	---	---	---	---	capture	Missense_Mutation	SNP	62728426	62728426	TMEM17	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15968	104
TGFA	7039	broad.mit.edu	37	2	70683568	70683568	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70683568C>T	uc002sgs.3	-	4	474	c.268G>A	c.(268-270)GTG>ATG	p.V90M	TGFA_uc010fdq.2_Missense_Mutation_p.V96M|TGFA_uc010fdr.2_Missense_Mutation_p.V95M|TGFA_uc002sgt.3_Missense_Mutation_p.V89M|TGFA_uc002sgu.2_Missense_Mutation_p.V89M|TGFA_uc002sgv.2_Missense_Mutation_p.V90M|TGFA_uc002sgw.2_Missense_Mutation_p.V89M	NM_003236	NP_003227	P01135	TGFA_HUMAN	transforming growth factor, alpha isoform 1	90	Extracellular (Potential).				activation of MAPK activity|cell proliferation|positive regulation of cell division|positive regulation of epidermal growth factor receptor activity|positive regulation of epithelial cell proliferation|positive regulation of mitosis	cell surface|extracellular space|integral to membrane|plasma membrane	epidermal growth factor receptor binding|growth factor activity|MAP kinase kinase activity|signal transducer activity	p.V90M(1)		prostate(1)	1						GCAGCCACCACGGCCAGGAGG	0.577													6	9	---	---	---	---	capture	Missense_Mutation	SNP	70683568	70683568	TGFA	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15700	104
RGPD3	653489	broad.mit.edu	37	2	107040566	107040566	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107040566T>A	uc010ywi.1	-	20	3914	c.3857A>T	c.(3856-3858)GAT>GTT	p.D1286V		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1286					intracellular transport		binding			ovary(1)	1						TGTTGACTCATCAAAGTGGAA	0.408													15	371	---	---	---	---	capture	Missense_Mutation	SNP	107040566	107040566	RGPD3	2	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	13180	104
RALGAPA2	57186	broad.mit.edu	37	20	20493785	20493785	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:20493785G>A	uc002wrz.2	-	32	4371	c.4228C>T	c.(4228-4230)CAT>TAT	p.H1410Y	RALGAPA2_uc010gcx.2_Missense_Mutation_p.H1114Y|RALGAPA2_uc010zsg.1_Missense_Mutation_p.H858Y|RALGAPA2_uc002wsa.1_Missense_Mutation_p.H182Y	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1410					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						CCTTCCACATGGGCATTGTCA	0.547													9	29	---	---	---	---	capture	Missense_Mutation	SNP	20493785	20493785	RALGAPA2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	12909	104
MYH7B	57644	broad.mit.edu	37	20	33584258	33584258	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33584258A>G	uc002xbi.1	+	27	3271	c.3179A>G	c.(3178-3180)CAG>CGG	p.Q1060R		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	1018	Potential.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGTGACCTGCAGGCCGAGGAG	0.672													3	34	---	---	---	---	capture	Missense_Mutation	SNP	33584258	33584258	MYH7B	20	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9950	104
NPBWR2	2832	broad.mit.edu	37	20	62737704	62737704	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62737704G>A	uc011abt.1	-	1	481	c.481C>T	c.(481-483)CGG>TGG	p.R161W		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	161	Cytoplasmic (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					TTCGCCCCCCGGTAGGTGCGC	0.632													13	37	---	---	---	---	capture	Missense_Mutation	SNP	62737704	62737704	NPBWR2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	10476	104
MME	4311	broad.mit.edu	37	3	154832945	154832945	+	Splice_Site	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:154832945G>A	uc010hvr.1	+	4	569	c.358_splice	c.e4+1	p.D120_splice	MME_uc003fab.1_Splice_Site_p.D120_splice|MME_uc003fac.1_Splice_Site_p.D120_splice|MME_uc003fad.1_Splice_Site_p.D120_splice|MME_uc003fae.1_Splice_Site_p.D120_splice	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase						cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	GTTTTGAAAGGTTAGTAGAGA	0.378													28	38	---	---	---	---	capture	Splice_Site	SNP	154832945	154832945	MME	3	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	9557	104
PLD1	5337	broad.mit.edu	37	3	171330189	171330189	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:171330189C>G	uc003fhs.2	-	25	2878	c.2762G>C	c.(2761-2763)GGA>GCA	p.G921A	PLD1_uc003fht.2_Missense_Mutation_p.G883A|PLD1_uc003fhu.3_Missense_Mutation_p.G215A	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	921	Catalytic.				cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GTCACGCTTTCCCAGCATGCT	0.423													31	46	---	---	---	---	capture	Missense_Mutation	SNP	171330189	171330189	PLD1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	11948	104
LPHN3	23284	broad.mit.edu	37	4	62452954	62452954	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:62452954G>A	uc010ihh.2	+	2	238	c.65G>A	c.(64-66)CGT>CAT	p.R22H	LPHN3_uc003hcq.3_Missense_Mutation_p.R22H|LPHN3_uc010ihg.1_Missense_Mutation_p.R90H	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	22	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						GCTTTCAGCCGTGCCCCAATT	0.453													7	15	---	---	---	---	capture	Missense_Mutation	SNP	62452954	62452954	LPHN3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8833	104
CXCL1	2919	broad.mit.edu	37	4	74735288	74735288	+	Splice_Site	SNP	G	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74735288G>T	uc003hhh.1	+	1	179	c.100_splice	c.e1+1	p.G34_splice		NM_001511	NP_001502	P09341	GROA_HUMAN	chemokine (C-X-C motif) ligand 1						actin cytoskeleton organization|cell proliferation|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|intracellular signal transduction|negative regulation of cell proliferation|nervous system development	extracellular space|intracellular	chemokine activity|enzyme activator activity|growth factor activity				0	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			CGCGCAGCAGGTGGGTACCGG	0.726													11	9	---	---	---	---	capture	Splice_Site	SNP	74735288	74735288	CXCL1	4	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	4037	104
EPGN	255324	broad.mit.edu	37	4	75174232	75174232	+	Translation_Start_Site	SNP	A	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:75174232A>T	uc003hic.1	+	1	29	c.-18A>T	c.(-20--16)AAAGT>AATGT		uc003hhv.1_Intron|EPGN_uc003hhw.2_Translation_Start_Site|EPGN_uc003hhx.1_RNA|EPGN_uc003hhy.1_Translation_Start_Site|EPGN_uc003hhz.1_Translation_Start_Site|EPGN_uc010iin.1_Translation_Start_Site|EPGN_uc003hia.1_Translation_Start_Site|EPGN_uc003hib.1_Translation_Start_Site			Q6UW88	EPGN_HUMAN	SubName: Full=cDNA FLJ75542;						activation of MAPK activity|angiogenesis|positive regulation of epidermal growth factor receptor activity|positive regulation of epithelial cell proliferation|positive regulation of mitosis	extracellular region|integral to plasma membrane	epidermal growth factor receptor binding|growth factor activity|MAP kinase kinase activity				0			Lung(101;0.196)			AGAGAAAGAAAGTTAAGCAAC	0.363													26	46	---	---	---	---	capture	Translation_Start_Site	SNP	75174232	75174232	EPGN	4	A	T	T	T	1	0	0	0	0	0	0	0	0	27	3	4	4	5119	104
PDHA2	5161	broad.mit.edu	37	4	96761394	96761394	+	Silent	SNP	C	T	T	rs143281239		TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96761394C>T	uc003htr.3	+	1	156	c.93C>T	c.(91-93)GAC>GAT	p.D31D		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	31					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	CCTCAAATGACGCTACATTTG	0.502													12	14	---	---	---	---	capture	Silent	SNP	96761394	96761394	PDHA2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11568	104
PRMT10	90826	broad.mit.edu	37	4	148591889	148591889	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:148591889G>A	uc003ilc.2	-	5	891	c.749C>T	c.(748-750)TCC>TTC	p.S250F	PRMT10_uc003ild.2_Missense_Mutation_p.S137F	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10	250						cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						TACAACTAGGGACACTCTATA	0.328													23	57	---	---	---	---	capture	Missense_Mutation	SNP	148591889	148591889	PRMT10	4	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12432	104
PIK3R1	5295	broad.mit.edu	37	5	67592121	67592121	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67592121T>C	uc003jva.2	+	15	2497	c.1937T>C	c.(1936-1938)TTT>TCT	p.F646S	PIK3R1_uc003jvb.2_Missense_Mutation_p.F646S|PIK3R1_uc003jvc.2_Missense_Mutation_p.F346S|PIK3R1_uc003jvd.2_Missense_Mutation_p.F376S|PIK3R1_uc003jve.2_Missense_Mutation_p.F325S	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	646	SH2 2.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GATGGCACTTTTCTTGTCCGG	0.453			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			45	89	---	---	---	---	capture	Missense_Mutation	SNP	67592121	67592121	PIK3R1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	11821	104
LNPEP	4012	broad.mit.edu	37	5	96320900	96320900	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:96320900C>T	uc003kmv.1	+	3	1491	c.977C>T	c.(976-978)ACC>ATC	p.T326I	LNPEP_uc003kmw.1_Missense_Mutation_p.T312I	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	326	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		GAGCAATACACCGCTTTATCA	0.378													41	63	---	---	---	---	capture	Missense_Mutation	SNP	96320900	96320900	LNPEP	5	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8784	104
FAT2	2196	broad.mit.edu	37	5	150925630	150925630	+	Silent	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150925630G>A	uc003lue.3	-	9	5071	c.5058C>T	c.(5056-5058)AGC>AGT	p.S1686S	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1686	Cadherin 15.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTCAGAGGGGCTCATAGCAG	0.443													28	53	---	---	---	---	capture	Silent	SNP	150925630	150925630	FAT2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5636	104
ENPP4	22875	broad.mit.edu	37	6	46107513	46107513	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46107513G>A	uc003oxy.2	+	2	452	c.193G>A	c.(193-195)GTT>ATT	p.V65I		NM_014936	NP_055751	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	65	Extracellular (Potential).					integral to membrane	hydrolase activity			ovary(3)|skin(1)	4						TGTTAAAAATGTTTTTATCAC	0.363													20	41	---	---	---	---	capture	Missense_Mutation	SNP	46107513	46107513	ENPP4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5087	104
KIF25	3834	broad.mit.edu	37	6	168443353	168443353	+	Silent	SNP	G	A	A	rs147561163		TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168443353G>A	uc003qwk.1	+	8	1204	c.942G>A	c.(940-942)CCG>CCA	p.P314P	KIF25_uc003qwl.1_Intron	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN	kinesin family member 25 isoform 1	314					microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GCCATGCCCCGTACCGGAACA	0.652													28	48	---	---	---	---	capture	Silent	SNP	168443353	168443353	KIF25	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	8215	104
SDK1	221935	broad.mit.edu	37	7	4153898	4153898	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4153898G>A	uc003smx.2	+	25	3954	c.3815G>A	c.(3814-3816)CGG>CAG	p.R1272Q	SDK1_uc010kso.2_Missense_Mutation_p.R548Q	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1272					cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGCCGGACGCGGGAGTCAGGT	0.652													8	7	---	---	---	---	capture	Missense_Mutation	SNP	4153898	4153898	SDK1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13861	104
HGF	3082	broad.mit.edu	37	7	81386513	81386513	+	Silent	SNP	G	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81386513G>A	uc003uhl.2	-	4	639	c.474C>T	c.(472-474)CAC>CAT	p.H158H	HGF_uc003uhm.2_Silent_p.H158H|HGF_uc003uhn.1_Silent_p.H158H|HGF_uc003uho.1_Silent_p.H158H|HGF_uc003uhp.2_Silent_p.H158H	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	158	Kringle 1.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						ACCTGTGTTCGTGTGGTATCA	0.393													27	64	---	---	---	---	capture	Silent	SNP	81386513	81386513	HGF	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7010	104
SAMD12	401474	broad.mit.edu	37	8	119452171	119452171	+	Silent	SNP	C	G	G			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:119452171C>G	uc003yom.2	-	3	351	c.222G>C	c.(220-222)GTG>GTC	p.V74V	SAMD12_uc010mda.1_Silent_p.V74V|SAMD12_uc010mdb.1_RNA	NM_207506	NP_997389	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12 isoform	74										ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			TCCATAGAGCCACCGGTTTAG	0.428													26	45	---	---	---	---	capture	Silent	SNP	119452171	119452171	SAMD12	8	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	13709	104
WWC3	55841	broad.mit.edu	37	X	10106937	10106937	+	Silent	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:10106937C>T	uc004csx.3	+	21	3243	c.3045C>T	c.(3043-3045)GAC>GAT	p.D1015D	WWC3_uc010nds.2_Silent_p.D679D|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	1015	Potential.									ovary(4)	4						TGCTTCGGGACGAGCGGCTCC	0.711													11	23	---	---	---	---	capture	Silent	SNP	10106937	10106937	WWC3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17294	104
MAGED2	10916	broad.mit.edu	37	X	54841851	54841851	+	Silent	SNP	C	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54841851C>T	uc004dtk.1	+	12	1651	c.1557C>T	c.(1555-1557)GAC>GAT	p.D519D	MAGED2_uc004dtl.1_Silent_p.D519D|MAGED2_uc004dtm.1_Silent_p.D434D|MAGED2_uc010nkc.1_Intron|MAGED2_uc004dtn.1_Silent_p.D519D|MAGED2_uc004dto.1_Silent_p.D493D	NM_177433	NP_803182	Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	519										ovary(2)|breast(1)	3						GCAACTGGGACGAAGCTGATA	0.488													8	11	---	---	---	---	capture	Silent	SNP	54841851	54841851	MAGED2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9098	104
NLGN3	54413	broad.mit.edu	37	X	70368006	70368006	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70368006A>G	uc004dzd.1	+	1	607	c.407A>G	c.(406-408)GAG>GGG	p.E136G	NLGN3_uc010nlb.1_Missense_Mutation_p.E136G|NLGN3_uc004dzb.2_Missense_Mutation_p.E136G|NLGN3_uc004dzc.2_Missense_Mutation_p.E19G|NLGN3_uc011mps.1_Missense_Mutation_p.E136G|NLGN3_uc011mpr.1_Missense_Mutation_p.E136G	NM_018977	NP_061850	Q9NZ94	NLGN3_HUMAN	neuroligin 3	136	Extracellular (Potential).				neuron cell-cell adhesion|positive regulation of synaptogenesis|receptor-mediated endocytosis|social behavior|synapse assembly	cell surface|endocytic vesicle|integral to plasma membrane|synapse	neurexin binding|receptor activity			ovary(1)	1	Renal(35;0.156)					TACATCCAGGAGCCCAACGAA	0.612													6	90	---	---	---	---	capture	Missense_Mutation	SNP	70368006	70368006	NLGN3	23	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10370	104
ATRX	546	broad.mit.edu	37	X	76937694	76937694	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76937694C>A	uc004ecp.3	-	9	3286	c.3054G>T	c.(3052-3054)AAG>AAT	p.K1018N	ATRX_uc004ecq.3_Missense_Mutation_p.K980N|ATRX_uc004eco.3_Missense_Mutation_p.K803N|ATRX_uc004ecr.2_Missense_Mutation_p.K950N|ATRX_uc010nlx.1_Missense_Mutation_p.K989N|ATRX_uc010nly.1_Missense_Mutation_p.K963N	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1018					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	GCTCAGGTAACTTTTCAGTGC	0.308			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						64	103	---	---	---	---	capture	Missense_Mutation	SNP	76937694	76937694	ATRX	23	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	1199	104
STAG2	10735	broad.mit.edu	37	X	123205085	123205085	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123205085T>A	uc004etz.3	+	24	2784	c.2445T>A	c.(2443-2445)TAT>TAA	p.Y815*	STAG2_uc004eua.2_Nonsense_Mutation_p.Y815*|STAG2_uc004eub.2_Nonsense_Mutation_p.Y815*|STAG2_uc004euc.2_Nonsense_Mutation_p.Y815*|STAG2_uc004eud.2_Nonsense_Mutation_p.Y815*|STAG2_uc004eue.2_Nonsense_Mutation_p.Y815*	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	815					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CATTAGTGTATACCCCTGATT	0.363													69	138	---	---	---	---	capture	Nonsense_Mutation	SNP	123205085	123205085	STAG2	23	T	A	A	A	1	0	0	0	0	0	1	0	0	634	49	5	4	15133	104
CCDC76	54482	broad.mit.edu	37	1	100602642	100602643	+	Splice_Site	INS	-	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:100602642_100602643insT	uc001dsv.2	+	3	280	c.261_splice	c.e3+1	p.P87_splice	CCDC76_uc010ouf.1_Splice_Site|CCDC76_uc009wea.2_Splice_Site_p.P87_splice	NM_019083	NP_061956	Q9NUP7	TRM13_HUMAN	coiled-coil domain containing 76						tRNA processing		metal ion binding|methyltransferase activity			ovary(1)	1		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0814)|all cancers(265;0.133)|COAD - Colon adenocarcinoma(174;0.146)|Lung(183;0.194)		ACCAAAACCTGTAAGTGTTTGA	0.238													34	47	---	---	---	---	capture_indel	Splice_Site	INS	100602642	100602643	CCDC76	1	-	T	T	T	1	0	1	1	0	0	0	1	0	624	48	5	5	2824	104
SNX32	254122	broad.mit.edu	37	11	65617743	65617744	+	Splice_Site	INS	-	T	T			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65617743_65617744insT	uc001ofr.2	+	4	501	c.374_splice	c.e4+1	p.A125_splice	SNX32_uc010rop.1_3'UTR	NM_152760	NP_689973	Q86XE0	SNX32_HUMAN	sorting nexin 6B						cell communication|protein transport		phosphatidylinositol binding				0				READ - Rectum adenocarcinoma(159;0.171)		AGCTGGAAGCGTGAGTGCCCCC	0.554													17	53	---	---	---	---	capture_indel	Splice_Site	INS	65617743	65617744	SNX32	11	-	T	T	T	1	0	1	1	0	0	0	1	0	520	40	5	5	14794	104
JAG1	182	broad.mit.edu	37	20	10644609	10644612	+	Splice_Site	DEL	ACGA	-	-			TCGA-06-6388-01	TCGA-06-6388-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:10644609_10644612delACGA	uc002wnw.2	-	3	955	c.439_splice	c.e3+1	p.Q147_splice		NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor						angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						AGCGATACTTACGAACGGTGTCAT	0.466									Alagille_Syndrome				13	49	---	---	---	---	capture_indel	Splice_Site	DEL	10644609	10644612	JAG1	20	ACGA	-	-	-	1	0	1	0	1	0	0	1	0	182	14	5	5	7857	104
