Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HTR1D	3352	broad.mit.edu	37	1	23520158	23520158	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23520158C>T	uc001bgn.2	-	1	1065	c.555G>A	c.(553-555)ATG>ATA	p.M185I		NM_000864	NP_000855	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D	185	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|intestine smooth muscle contraction|synaptic transmission	integral to plasma membrane	serotonin receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Tegaserod(DB01079)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GACAGTCCGACATCTCCTCCT	0.592													18	61	---	---	---	---	capture	Missense_Mutation	SNP	23520158	23520158	HTR1D	1	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	7363	107
MTF1	4520	broad.mit.edu	37	1	38305766	38305766	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38305766C>T	uc001cce.1	-	3	614	c.473G>A	c.(472-474)CGA>CAA	p.R158Q	MTF1_uc009vvj.1_5'UTR	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	158	C2H2-type 1.					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTGGTGGGTTCGCAGGTTGCC	0.527													16	114	---	---	---	---	capture	Missense_Mutation	SNP	38305766	38305766	MTF1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9832	107
IL12RB2	3595	broad.mit.edu	37	1	67861543	67861543	+	Missense_Mutation	SNP	C	T	T	rs141507006		TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67861543C>T	uc001ddu.2	+	16	3000	c.2360C>T	c.(2359-2361)ACG>ATG	p.T787M	IL12RB2_uc010oqi.1_3'UTR|IL12RB2_uc010oqj.1_3'UTR|IL12RB2_uc010oqk.1_RNA|IL12RB2_uc010oql.1_Missense_Mutation_p.T701M|IL12RB2_uc010oqm.1_3'UTR|IL12RB2_uc010oqn.1_RNA	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor	787	Cytoplasmic (Potential).				positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						TGTCCCTGGACGGTGCTCCCA	0.582													31	178	---	---	---	---	capture	Missense_Mutation	SNP	67861543	67861543	IL12RB2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7550	107
LRRC8D	55144	broad.mit.edu	37	1	90400304	90400304	+	Silent	SNP	C	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:90400304C>G	uc001dnm.2	+	3	2102	c.1677C>G	c.(1675-1677)CTC>CTG	p.L559L	LRRC8D_uc001dnn.2_Silent_p.L559L	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member	559	LRR 2.					integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TGTATTTGCTCAAAAACCTTC	0.418													19	90	---	---	---	---	capture	Silent	SNP	90400304	90400304	LRRC8D	1	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	8939	107
C1orf85	112770	broad.mit.edu	37	1	156264001	156264001	+	Silent	SNP	T	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156264001T>A	uc001foh.2	-	4	619	c.606A>T	c.(604-606)CGA>CGT	p.R202R	C1orf85_uc001fof.3_5'Flank|C1orf85_uc001fog.1_Intron|C1orf85_uc001foi.2_Silent_p.R202R|C1orf85_uc009wrx.2_Silent_p.R135R|C1orf85_uc001foj.2_Silent_p.R116R	NM_144580	NP_653181	Q8WWB7	NCUG1_HUMAN	kidney predominant protein NCU-G1 precursor	202	Lumenal (Potential).				positive regulation of transcription from RNA polymerase II promoter	cytosol|integral to membrane|lysosomal membrane|nucleus	ligand-dependent nuclear receptor activity|protein binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)	2	Hepatocellular(266;0.158)					GTTGGGCTGGTCGGCTGGACC	0.592													6	44	---	---	---	---	capture	Silent	SNP	156264001	156264001	C1orf85	1	T	A	A	A	1	0	0	0	0	0	0	0	1	743	58	4	4	2044	107
NTRK1	4914	broad.mit.edu	37	1	156841494	156841494	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156841494G>A	uc001fqh.1	+	7	853	c.797G>A	c.(796-798)TGG>TAG	p.W266*	NTRK1_uc001fqf.1_Nonsense_Mutation_p.W236*|NTRK1_uc009wsi.1_Intron|NTRK1_uc001fqi.1_Nonsense_Mutation_p.W266*|NTRK1_uc009wsk.1_Nonsense_Mutation_p.W266*	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	266	Ig-like C2-type 1.|Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	GTGACGTGCTGGGCAGAGAAC	0.592			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			22	83	---	---	---	---	capture	Nonsense_Mutation	SNP	156841494	156841494	NTRK1	1	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	10613	107
SPTA1	6708	broad.mit.edu	37	1	158592861	158592861	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158592861G>A	uc001fst.1	-	43	6231	c.6032C>T	c.(6031-6033)GCC>GTC	p.A2011V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2011	Spectrin 19.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CAGCAGAGCGGCATAACGCTC	0.483													5	439	---	---	---	---	capture	Missense_Mutation	SNP	158592861	158592861	SPTA1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15008	107
SIPA1L2	57568	broad.mit.edu	37	1	232574923	232574923	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232574923G>A	uc001hvg.2	-	13	4120	c.3962C>T	c.(3961-3963)TCC>TTC	p.S1321F	SIPA1L2_uc001hvf.2_Missense_Mutation_p.S395F	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1321	Ser-rich.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GGAGATGGTGGACGCGTAGCC	0.602													15	45	---	---	---	---	capture	Missense_Mutation	SNP	232574923	232574923	SIPA1L2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	14223	107
SORBS1	10580	broad.mit.edu	37	10	97096883	97096883	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:97096883C>G	uc001kkp.2	-	28	3079	c.3034G>C	c.(3034-3036)GAG>CAG	p.E1012Q	SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Missense_Mutation_p.E966Q|SORBS1_uc010qoe.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	1012					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ATAGAAGCCTCTGGCAGAGGA	0.607													10	36	---	---	---	---	capture	Missense_Mutation	SNP	97096883	97096883	SORBS1	10	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	14819	107
OR10Q1	219960	broad.mit.edu	37	11	57996044	57996044	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57996044C>T	uc010rkd.1	-	1	304	c.304G>A	c.(304-306)GGG>AGG	p.G102R		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	102	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				ATTTGGGCCCCACATCCAGCC	0.547													13	26	---	---	---	---	capture	Missense_Mutation	SNP	57996044	57996044	OR10Q1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10820	107
GAB2	9846	broad.mit.edu	37	11	77934481	77934481	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77934481C>T	uc001ozh.2	-	6	1544	c.1544G>A	c.(1543-1545)CGC>CAC	p.R515H	GAB2_uc001ozg.2_Missense_Mutation_p.R477H	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a	515	SH3-binding.				osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			TTTGAGGTTGCGGTTGACAGG	0.547													4	120	---	---	---	---	capture	Missense_Mutation	SNP	77934481	77934481	GAB2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6091	107
PDGFD	80310	broad.mit.edu	37	11	103797801	103797801	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:103797801T>C	uc001phq.2	-	6	1198	c.826A>G	c.(826-828)AAT>GAT	p.N276D	PDGFD_uc001php.2_Missense_Mutation_p.N270D	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1	276					positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		ACCGAGTAATTCCTGGGAGTG	0.478													14	69	---	---	---	---	capture	Missense_Mutation	SNP	103797801	103797801	PDGFD	11	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11563	107
CD163	9332	broad.mit.edu	37	12	7639374	7639374	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7639374G>A	uc001qsz.3	-	10	2307	c.2179C>T	c.(2179-2181)CGC>TGC	p.R727C	CD163_uc001qta.3_Missense_Mutation_p.R727C|CD163_uc009zfw.2_Missense_Mutation_p.R760C	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	727	SRCR 7.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						CCAGCACAGCGACCTCCTCCA	0.458													14	79	---	---	---	---	capture	Missense_Mutation	SNP	7639374	7639374	CD163	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2938	107
GUCY2C	2984	broad.mit.edu	37	12	14840978	14840978	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14840978G>A	uc001rcd.2	-	2	374	c.237C>T	c.(235-237)AAC>AAT	p.N79N	GUCY2C_uc009zhz.2_Silent_p.N79N	NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	79	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						TGAAAGTAGCGTTCACAGTCA	0.433													9	57	---	---	---	---	capture	Silent	SNP	14840978	14840978	GUCY2C	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6825	107
RERGL	79785	broad.mit.edu	37	12	18237578	18237578	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18237578G>T	uc001rdq.2	-	5	402	c.208C>A	c.(208-210)CTC>ATC	p.L70I	RERGL_uc001rdr.2_Missense_Mutation_p.L69I	NM_024730	NP_079006	Q9H628	RERGL_HUMAN	RERG/RAS-like	70	Small GTPase-like.				signal transduction	membrane	GTP binding|GTPase activity				0						TCACTTGTGAGGGAGAATTTT	0.383													32	114	---	---	---	---	capture	Missense_Mutation	SNP	18237578	18237578	RERGL	12	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	13128	107
C12orf40	283461	broad.mit.edu	37	12	40114778	40114778	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40114778A>G	uc001rmc.2	+	13	1851	c.1684A>G	c.(1684-1686)AAT>GAT	p.N562D	C12orf40_uc009zjv.1_Intron	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	562										ovary(6)	6						AGTGAAAAATAATACAGATCA	0.393													13	86	---	---	---	---	capture	Missense_Mutation	SNP	40114778	40114778	C12orf40	12	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	1672	107
C12orf40	283461	broad.mit.edu	37	12	40114932	40114932	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40114932A>G	uc001rmc.2	+	13	2005	c.1838A>G	c.(1837-1839)CAG>CGG	p.Q613R	C12orf40_uc009zjv.1_Intron	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	613										ovary(6)	6						GTTGCCATACAGTGTGATCTA	0.408													14	105	---	---	---	---	capture	Missense_Mutation	SNP	40114932	40114932	C12orf40	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	1672	107
C12orf40	283461	broad.mit.edu	37	12	40114983	40114983	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40114983A>C	uc001rmc.2	+	13	2056	c.1889A>C	c.(1888-1890)AAC>ACC	p.N630T	C12orf40_uc009zjv.1_Intron	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	630										ovary(6)	6						TCTCTTTGCAACCTTGAAAGG	0.363													20	95	---	---	---	---	capture	Missense_Mutation	SNP	40114983	40114983	C12orf40	12	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	1672	107
SLC2A13	114134	broad.mit.edu	37	12	40153845	40153845	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40153845C>T	uc010skm.1	-	10	1981	c.1930G>A	c.(1930-1932)GCT>ACT	p.A644T	C12orf40_uc009zjv.1_Intron	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	644	Cytoplasmic (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				ACATCAGAAGCATCATTGTCA	0.383										HNSCC(50;0.14)			16	93	---	---	---	---	capture	Missense_Mutation	SNP	40153845	40153845	SLC2A13	12	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	14434	107
HOXC5	3222	broad.mit.edu	37	12	54427115	54427115	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54427115A>C	uc001sew.2	+	1	284	c.209A>C	c.(208-210)CAC>CCC	p.H70P	HOXC5_uc001set.2_Intron|HOXC4_uc001seu.2_Intron|MIR615_hsa-mir-615|MI0003628_5'Flank	NM_018953	NP_061826	Q00444	HXC5_HUMAN	homeobox C5	70					regulation of transcription from RNA polymerase II promoter	cell junction|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCCCGGGCTCACCCCGACCGC	0.672													8	46	---	---	---	---	capture	Missense_Mutation	SNP	54427115	54427115	HOXC5	12	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	7239	107
R3HDM2	22864	broad.mit.edu	37	12	57677642	57677642	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57677642C>G	uc009zpm.1	-	11	1129	c.1094G>C	c.(1093-1095)AGT>ACT	p.S365T	R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_Missense_Mutation_p.S26T|R3HDM2_uc001snr.2_Missense_Mutation_p.S92T|R3HDM2_uc001sns.2_Missense_Mutation_p.S365T|R3HDM2_uc001snt.2_Missense_Mutation_p.S379T	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	365	Ser-rich.					nucleus	nucleic acid binding			ovary(2)	2						GCCGCCTTTACTGCTGCCGAT	0.532													36	504	---	---	---	---	capture	Missense_Mutation	SNP	57677642	57677642	R3HDM2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	12783	107
PTPRR	5801	broad.mit.edu	37	12	71286523	71286523	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:71286523G>A	uc001swi.1	-	2	709	c.293C>T	c.(292-294)GCC>GTC	p.A98V		NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	98	Extracellular (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		ACCATCCATGGCCAGCAGATT	0.458													48	211	---	---	---	---	capture	Missense_Mutation	SNP	71286523	71286523	PTPRR	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12705	107
MYF5	4617	broad.mit.edu	37	12	81110965	81110965	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:81110965G>A	uc001szg.2	+	1	258	c.123G>A	c.(121-123)GCG>GCA	p.A41A		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	41					muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						CCTTCGGAGCGCACAAAGCAG	0.617													3	59	---	---	---	---	capture	Silent	SNP	81110965	81110965	MYF5	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9937	107
ALX1	8092	broad.mit.edu	37	12	85695019	85695019	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85695019G>A	uc001tae.3	+	4	751	c.747G>A	c.(745-747)ATG>ATA	p.M249I		NM_006982	NP_008913	Q15699	ALX1_HUMAN	cartilage paired-class homeoprotein 1	249					brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(134;0.134)		CCTCCTGTATGACACCTTATT	0.453													17	174	---	---	---	---	capture	Missense_Mutation	SNP	85695019	85695019	ALX1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	556	107
HAL	3034	broad.mit.edu	37	12	96389510	96389510	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96389510C>T	uc001tem.1	-	2	476	c.179G>A	c.(178-180)GGC>GAC	p.G60D	HAL_uc009zti.1_RNA|HAL_uc010suw.1_5'UTR|HAL_uc010sux.1_Missense_Mutation_p.G60D	NM_002108	NP_002099	P42357	HUTH_HUMAN	histidine ammonia-lyase	60					biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity			ovary(2)|skin(1)	3					L-Histidine(DB00117)	CAGGCCCAGGCCCTTGCACCG	0.642													18	57	---	---	---	---	capture	Missense_Mutation	SNP	96389510	96389510	HAL	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6874	107
KL	9365	broad.mit.edu	37	13	33629339	33629339	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:33629339T>C	uc001uus.2	+	3	1494	c.1486T>C	c.(1486-1488)TTC>CTC	p.F496L	KL_uc001uur.1_Missense_Mutation_p.F189L	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	496	Glycosyl hydrolase-1 1.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		TTCAGCCTTGTTCTACCAAAA	0.463													33	126	---	---	---	---	capture	Missense_Mutation	SNP	33629339	33629339	KL	13	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	8252	107
MYO16	23026	broad.mit.edu	37	13	109859183	109859183	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:109859183G>A	uc001vqt.1	+	35	5702	c.5576G>A	c.(5575-5577)TGA>TAA	p.*1859*	MYO16_uc010agk.1_Silent_p.*1881*	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1859					cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ACCACCATTTGATGTGGCCTG	0.572													5	14	---	---	---	---	capture	Silent	SNP	109859183	109859183	MYO16	13	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	9974	107
OR5AU1	390445	broad.mit.edu	37	14	21623219	21623219	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21623219G>A	uc010tlp.1	-	1	966	c.966C>T	c.(964-966)GAC>GAT	p.D322D		NM_001004731	NP_001004731	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU,	322	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		CAACTGTGCGGTCCTGGGTCA	0.493													14	89	---	---	---	---	capture	Silent	SNP	21623219	21623219	OR5AU1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	11051	107
HEATR5A	25938	broad.mit.edu	37	14	31782317	31782317	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31782317C>T	uc001wrf.3	-	22	3496	c.3419G>A	c.(3418-3420)AGA>AAA	p.R1140K	HEATR5A_uc010ami.2_Missense_Mutation_p.R1038K	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1427							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TGATCCATTTCTGATACCGTC	0.398													33	188	---	---	---	---	capture	Missense_Mutation	SNP	31782317	31782317	HEATR5A	14	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	6958	107
SRP54	6729	broad.mit.edu	37	14	35470222	35470222	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:35470222T>C	uc001wso.2	+	4	602	c.251T>C	c.(250-252)GTG>GCG	p.V84A	SRP54_uc010tpp.1_Missense_Mutation_p.V35A|SRP54_uc010tpq.1_Missense_Mutation_p.V20A	NM_003136	NP_003127	P61011	SRP54_HUMAN	signal recognition particle 54kDa isoform 1	84	G-domain.				GTP catabolic process|response to drug|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition|SRP-dependent cotranslational protein targeting to membrane, translocation	cytosol|nuclear speck|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|drug binding|endoplasmic reticulum signal peptide binding|GDP binding|GTP binding|nucleoside-triphosphatase activity|ribonucleoprotein binding			ovary(1)	1	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		AAAGAACTTGTGAAGGTAAAA	0.313													16	29	---	---	---	---	capture	Missense_Mutation	SNP	35470222	35470222	SRP54	14	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	15047	107
SPINT1	6692	broad.mit.edu	37	15	41137192	41137192	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41137192G>A	uc001zna.2	+	2	644	c.440G>A	c.(439-441)CGC>CAC	p.R147H	SPINT1_uc001znb.2_Missense_Mutation_p.R147H|SPINT1_uc001znc.2_Missense_Mutation_p.R147H|SPINT1_uc010ucs.1_Missense_Mutation_p.R147H	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	147						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GAAGTGTACCGCTCCTACCGC	0.582													12	68	---	---	---	---	capture	Missense_Mutation	SNP	41137192	41137192	SPINT1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14960	107
TPSAB1	7177	broad.mit.edu	37	16	1291199	1291199	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1291199A>G	uc002ckz.2	+	3	159	c.107A>G	c.(106-108)GAG>GGG	p.E36G	TPSAB1_uc010uux.1_5'UTR	NM_003294	NP_003285	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1 precursor	36	Peptidase S1.				defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				GGGGGTCAGGAGGCCCCCAGG	0.711													17	56	---	---	---	---	capture	Missense_Mutation	SNP	1291199	1291199	TPSAB1	16	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	16306	107
MYH11	4629	broad.mit.edu	37	16	15813552	15813552	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15813552G>C	uc002ddy.2	-	35	5079	c.4972C>G	c.(4972-4974)CAA>GAA	p.Q1658E	MYH11_uc002ddv.2_Missense_Mutation_p.Q1665E|MYH11_uc002ddw.2_Missense_Mutation_p.Q1658E|MYH11_uc002ddx.2_Missense_Mutation_p.Q1665E|MYH11_uc010bvg.2_Missense_Mutation_p.Q1490E|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Missense_Mutation_p.Q364E|NDE1_uc002ddz.1_5'Flank	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1658	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						AGCTCTCTTTGAAAGTCCTTC	0.517			T	CBFB	AML								20	109	---	---	---	---	capture	Missense_Mutation	SNP	15813552	15813552	MYH11	16	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	9941	107
SMG1	23049	broad.mit.edu	37	16	18830977	18830977	+	Splice_Site	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:18830977C>T	uc002dfm.2	-	56	10105	c.9742_splice	c.e56-1	p.E3248_splice	SMG1_uc010bwb.2_Splice_Site_p.E3108_splice|SMG1_uc010bwa.2_Splice_Site_p.E1979_splice	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						CTAGCTTCTCCTATAAAAGCC	0.413													2	6	---	---	---	---	capture	Splice_Site	SNP	18830977	18830977	SMG1	16	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	14687	107
DNAH3	55567	broad.mit.edu	37	16	21123036	21123036	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21123036G>A	uc010vbe.1	-	14	2010	c.2010C>T	c.(2008-2010)GCC>GCT	p.A670A	DNAH3_uc002die.2_Silent_p.A610A	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	670	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CATGATTTAGGGCCGTAGCAT	0.418													28	62	---	---	---	---	capture	Silent	SNP	21123036	21123036	DNAH3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	4560	107
PRKCB	5579	broad.mit.edu	37	16	24166173	24166173	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24166173A>G	uc002dmd.2	+	10	1431	c.1234A>G	c.(1234-1236)ACC>GCC	p.T412A	PRKCB_uc002dme.2_Missense_Mutation_p.T412A	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	412	Protein kinase.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CTGCTTCCAGACCATGGTAAC	0.582													6	21	---	---	---	---	capture	Missense_Mutation	SNP	24166173	24166173	PRKCB	16	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	12404	107
OR3A2	4995	broad.mit.edu	37	17	3181702	3181702	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3181702G>C	uc002fvg.2	-	1	567	c.528C>G	c.(526-528)AAC>AAG	p.N176K		NM_002551	NP_002542	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A,	176	Extracellular (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						GGCCACAGAAGTTGAGCGTGG	0.567													27	105	---	---	---	---	capture	Missense_Mutation	SNP	3181702	3181702	OR3A2	17	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	10942	107
KRT40	125115	broad.mit.edu	37	17	39140113	39140113	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39140113C>T	uc010cxh.1	-	3	574	c.413G>A	c.(412-414)CGT>CAT	p.R138H	KRT40_uc002hvq.1_RNA	NM_182497	NP_872303	Q6A162	K1C40_HUMAN	type I hair keratin KA36	138	Rod.|Coil 1B.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)				GTTGAAGTAACGCTGATAATC	0.483													30	148	---	---	---	---	capture	Missense_Mutation	SNP	39140113	39140113	KRT40	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8398	107
SERPINB4	6318	broad.mit.edu	37	18	61309010	61309010	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61309010G>A	uc002ljf.2	-	4	421	c.335C>T	c.(334-336)ACG>ATG	p.T112M	SERPINB4_uc002lje.2_Missense_Mutation_p.T112M|SERPINB4_uc002ljg.2_Intron	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	112					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						AAATTGATACGTCTTTTCTCC	0.423													36	176	---	---	---	---	capture	Missense_Mutation	SNP	61309010	61309010	SERPINB4	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13996	107
BEST2	54831	broad.mit.edu	37	19	12863444	12863444	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12863444G>A	uc002mux.2	+	1	38	c.38G>A	c.(37-39)CGC>CAC	p.R13H		NM_017682	NP_060152	Q8NFU1	BEST2_HUMAN	vitelliform macular dystrophy 2-like 1	13	Cytoplasmic (Potential).				membrane depolarization|sensory perception of smell	chloride channel complex|cilium|plasma membrane	chloride channel activity			ovary(1)|pancreas(1)	2						GCGAACGCCCGCTTCGGTGGC	0.657													21	68	---	---	---	---	capture	Missense_Mutation	SNP	12863444	12863444	BEST2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1394	107
SLC35E1	79939	broad.mit.edu	37	19	16664592	16664592	+	Silent	SNP	G	A	A	rs139815009		TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16664592G>A	uc010xph.1	-	6	1149	c.1131C>T	c.(1129-1131)CAC>CAT	p.H377H	MED26_uc002nee.2_RNA	NM_024881	NP_079157	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	377					transport	integral to membrane				ovary(1)|central_nervous_system(1)	2						GATAGTCCCCGTGCTGGGGGA	0.582													33	123	---	---	---	---	capture	Silent	SNP	16664592	16664592	SLC35E1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14476	107
FCGBP	8857	broad.mit.edu	37	19	40411954	40411954	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40411954T>C	uc002omp.3	-	7	3682	c.3674A>G	c.(3673-3675)GAG>GGG	p.E1225G		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	1225	Cys-rich.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCTGGAGGACTCACAGGACAC	0.677													3	69	---	---	---	---	capture	Missense_Mutation	SNP	40411954	40411954	FCGBP	19	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	5724	107
CYP2B6	1555	broad.mit.edu	37	19	41515193	41515193	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41515193C>T	uc002opr.1	+	5	722	c.715C>T	c.(715-717)CAG>TAG	p.Q239*	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Intron	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	239					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	CAAAAACCTGCAGGAAATCAA	0.522													23	128	---	---	---	---	capture	Nonsense_Mutation	SNP	41515193	41515193	CYP2B6	19	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	4124	107
APOB	338	broad.mit.edu	37	2	21229086	21229086	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21229086C>G	uc002red.2	-	26	10782	c.10654G>C	c.(10654-10656)GGA>CGA	p.G3552R		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3552					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GTGGCTTCTCCAGCAAAATTT	0.443													26	101	---	---	---	---	capture	Missense_Mutation	SNP	21229086	21229086	APOB	2	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	778	107
APOB	338	broad.mit.edu	37	2	21245793	21245793	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21245793G>A	uc002red.2	-	18	2854	c.2726C>T	c.(2725-2727)TCG>TTG	p.S909L		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	909	Heparin-binding.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTCCAGACCCGACTCGTGGAA	0.498													11	68	---	---	---	---	capture	Missense_Mutation	SNP	21245793	21245793	APOB	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	778	107
NEB	4703	broad.mit.edu	37	2	152476016	152476016	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152476016G>A	uc010fnx.2	-	69	10283	c.10092C>T	c.(10090-10092)CCC>CCT	p.P3364P		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3364	Nebulin 92.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CATTCTGGTCGGGCAGGCAGA	0.483													30	102	---	---	---	---	capture	Silent	SNP	152476016	152476016	NEB	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10209	107
ZNF142	7701	broad.mit.edu	37	2	219509392	219509392	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219509392C>T	uc002vin.2	-	8	2283	c.1847G>A	c.(1846-1848)GGG>GAG	p.G616E	ZNF142_uc002vil.2_Missense_Mutation_p.G577E|ZNF142_uc010fvt.2_Missense_Mutation_p.G453E|ZNF142_uc002vim.2_Missense_Mutation_p.G453E	NM_001105537	NP_001099007	P52746	ZN142_HUMAN	zinc finger protein 142	616					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CTGCATGGCCCCTTCTGGCTC	0.607													18	59	---	---	---	---	capture	Missense_Mutation	SNP	219509392	219509392	ZNF142	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	17611	107
ASB18	401036	broad.mit.edu	37	2	237103656	237103656	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:237103656G>A	uc010znh.1	-	6	1260	c.1260C>T	c.(1258-1260)ACC>ACT	p.T420T		NM_212556	NP_997721	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box-containing 18	420	SOCS box.				intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		GGCAGCGTGGGGTGAGGGCCA	0.557													3	31	---	---	---	---	capture	Silent	SNP	237103656	237103656	ASB18	2	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	1013	107
C20orf71	128861	broad.mit.edu	37	20	31811632	31811632	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31811632T>C	uc002wyr.2	+	2	351	c.143T>C	c.(142-144)CTC>CCC	p.L48P	C20orf71_uc002wys.2_Missense_Mutation_p.L48P	NM_178466	NP_848561	Q9BQP9	SPLC3_HUMAN	short long palate, lung and nasal epithelium	48						extracellular region	lipid binding			ovary(1)|skin(1)	2						GCTCAGGGCCTCATAAAGCAC	0.373													3	68	---	---	---	---	capture	Missense_Mutation	SNP	31811632	31811632	C20orf71	20	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	2098	107
CASS4	57091	broad.mit.edu	37	20	55021057	55021057	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55021057G>A	uc002xxp.2	+	4	786	c.561G>A	c.(559-561)AAG>AAA	p.K187K	CASS4_uc002xxq.3_Silent_p.K187K|CASS4_uc002xxr.2_Silent_p.K187K|CASS4_uc010zze.1_Silent_p.K133K|CASS4_uc010gio.2_Silent_p.K187K	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	187					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						TGGTCCTGAAGGTGAGCCTTG	0.622													4	26	---	---	---	---	capture	Silent	SNP	55021057	55021057	CASS4	20	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	2659	107
SCN10A	6336	broad.mit.edu	37	3	38743393	38743393	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38743393G>A	uc003ciq.2	-	26	4594	c.4594C>T	c.(4594-4596)CAG>TAG	p.Q1532*		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1532	IV.				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	AAGTAGTACTGCCTCAAAGCG	0.483													15	60	---	---	---	---	capture	Nonsense_Mutation	SNP	38743393	38743393	SCN10A	3	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	13805	107
CCR5	1234	broad.mit.edu	37	3	46414869	46414869	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46414869C>T	uc003cpo.3	+	3	598	c.476C>T	c.(475-477)GCG>GTG	p.A159V	CCR5_uc010hjd.2_Missense_Mutation_p.A159V	NM_001100168	NP_001093638	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5	159	Helical; Name=4; (Potential).				cell-cell signaling|cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|entry into host cell|immune response|inflammatory response|initiation of viral infection	endosome|external side of plasma membrane|integral to plasma membrane	actin binding|C-C chemokine receptor activity|coreceptor activity|phosphatidylinositol phospholipase C activity			lung(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	GCTGTGTTTGCGTCTCTCCCA	0.468													47	217	---	---	---	---	capture	Missense_Mutation	SNP	46414869	46414869	CCR5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2915	107
SEMA3G	56920	broad.mit.edu	37	3	52469856	52469856	+	Silent	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52469856C>T	uc003dea.1	-	16	2112	c.2112G>A	c.(2110-2112)AAG>AAA	p.K704K		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	704					multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		TGTACCAGGCCTTGGGTGGGG	0.642													39	129	---	---	---	---	capture	Silent	SNP	52469856	52469856	SEMA3G	3	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	13923	107
EAF2	55840	broad.mit.edu	37	3	121573665	121573665	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121573665A>T	uc003een.2	+	3	432	c.333A>T	c.(331-333)AAA>AAT	p.K111N	EAF2_uc003eeo.2_Intron	NM_018456	NP_060926	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	111					apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding				0				GBM - Glioblastoma multiforme(114;0.0972)		CTGTAAAAAAAACAAGGTATG	0.249													8	54	---	---	---	---	capture	Missense_Mutation	SNP	121573665	121573665	EAF2	3	A	T	T	T	1	0	0	0	0	1	0	0	0	11	1	4	4	4831	107
MBNL1	4154	broad.mit.edu	37	3	152163096	152163096	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:152163096A>T	uc003ezm.2	+	4	1364	c.575A>T	c.(574-576)AAT>ATT	p.N192I	MBNL1_uc003ezh.2_Missense_Mutation_p.N192I|MBNL1_uc003ezi.2_Missense_Mutation_p.N192I|MBNL1_uc003ezj.2_Missense_Mutation_p.N135I|MBNL1_uc003ezl.2_Missense_Mutation_p.N192I|MBNL1_uc003ezp.2_Missense_Mutation_p.N192I|MBNL1_uc003ezn.2_Missense_Mutation_p.N124I|MBNL1_uc003ezo.2_Missense_Mutation_p.N124I|MBNL1_uc010hvp.2_Missense_Mutation_p.N100I	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	192	C3H1-type 3.				embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CAACGTGGCAATTGCAACCGA	0.403													22	66	---	---	---	---	capture	Missense_Mutation	SNP	152163096	152163096	MBNL1	3	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	9266	107
PIK3CA	5290	broad.mit.edu	37	3	178916876	178916876	+	Missense_Mutation	SNP	G	A	A	rs121913287		TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916876G>A	uc003fjk.2	+	2	420	c.263G>A	c.(262-264)CGA>CAA	p.R88Q		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	88	PI3K-ABD.		R -> Q (in cancer; may disrupt the interaction between the PI3K-ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R88Q(26)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAAACAAGACGACTTTGTGAC	0.363	R88Q(SKUT1_SOFT_TISSUE)|R88Q(JHUEM1_ENDOMETRIUM)|R88Q(SNGM_ENDOMETRIUM)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			132	129	---	---	---	---	capture	Missense_Mutation	SNP	178916876	178916876	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11816	107
TXK	7294	broad.mit.edu	37	4	48106929	48106929	+	Silent	SNP	A	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48106929A>G	uc003gxx.3	-	6	576	c.490T>C	c.(490-492)TTG>CTG	p.L164L	TXK_uc003gxy.1_Silent_p.L164L	NM_003328	NP_003319	P42681	TXK_HUMAN	TXK tyrosine kinase	164	SH2.					cytoplasm	ATP binding|non-membrane spanning protein tyrosine kinase activity				0						TCTTGTCTCAATAGATGTTCT	0.244													12	59	---	---	---	---	capture	Silent	SNP	48106929	48106929	TXK	4	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	16668	107
CCDC158	339965	broad.mit.edu	37	4	77283442	77283442	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77283442C>A	uc003hkb.3	-	12	2010	c.1857G>T	c.(1855-1857)AAG>AAT	p.K619N		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	619	Potential.									skin(3)|ovary(2)|pancreas(1)	6						GCTCCCGGATCTTTGCATCTT	0.393													32	102	---	---	---	---	capture	Missense_Mutation	SNP	77283442	77283442	CCDC158	4	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	2764	107
DNAH5	1767	broad.mit.edu	37	5	13871097	13871097	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13871097C>T	uc003jfd.2	-	24	3655	c.3613G>A	c.(3613-3615)GCC>ACC	p.A1205T		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1205	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GCAGTCAGGGCGAACTTCAAG	0.403									Kartagener_syndrome				15	95	---	---	---	---	capture	Missense_Mutation	SNP	13871097	13871097	DNAH5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4561	107
HEATR7B2	133558	broad.mit.edu	37	5	41051145	41051145	+	Silent	SNP	T	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41051145T>C	uc003jmj.3	-	13	1768	c.1278A>G	c.(1276-1278)GAA>GAG	p.E426E	HEATR7B2_uc003jmi.3_5'UTR	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	426	HEAT 5.						binding			ovary(6)|central_nervous_system(2)	8						CTCGGACAGATTCCTCTTCCT	0.423													5	29	---	---	---	---	capture	Silent	SNP	41051145	41051145	HEATR7B2	5	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	6961	107
PCDHA3	56145	broad.mit.edu	37	5	140181903	140181903	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140181903T>C	uc003lhf.2	+	1	1121	c.1121T>C	c.(1120-1122)GTG>GCG	p.V374A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.V374A	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	374	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGATCAGCGTGTCCGACCGC	0.483													18	93	---	---	---	---	capture	Missense_Mutation	SNP	140181903	140181903	PCDHA3	5	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	11428	107
GLRA1	2741	broad.mit.edu	37	5	151230995	151230995	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151230995T>A	uc003lut.2	-	7	1155	c.868A>T	c.(868-870)ACC>TCC	p.T290S	GLRA1_uc003lur.2_Missense_Mutation_p.T290S|GLRA1_uc003lus.2_Missense_Mutation_p.T207S	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor	290	Helical; (Probable).				muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTGGTCATGGTGAGCACAGTG	0.547													4	52	---	---	---	---	capture	Missense_Mutation	SNP	151230995	151230995	GLRA1	5	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	6390	107
ZNF165	7718	broad.mit.edu	37	6	28056507	28056507	+	Silent	SNP	A	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28056507A>G	uc003nkg.2	+	5	1801	c.717A>G	c.(715-717)AAA>AAG	p.K239K	ZNF165_uc003nkh.2_Silent_p.K239K|ZNF165_uc003nki.3_Silent_p.K239K|ZSCAN12P1_uc003nkj.3_5'Flank	NM_003447	NP_003438	P49910	ZN165_HUMAN	zinc finger protein 165	239					viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AATGGGAAAAAGAATCAGGGG	0.433													3	144	---	---	---	---	capture	Silent	SNP	28056507	28056507	ZNF165	6	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	17620	107
SLC26A8	116369	broad.mit.edu	37	6	35922972	35922972	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35922972A>T	uc003olm.2	-	17	2300	c.2189T>A	c.(2188-2190)ATG>AAG	p.M730K	SLC26A8_uc010jwa.2_RNA|SLC26A8_uc003olk.2_Missense_Mutation_p.M312K|SLC26A8_uc003oln.2_Missense_Mutation_p.M730K|SLC26A8_uc003oll.2_Missense_Mutation_p.M625K	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	730	Interaction with RACGAP1.|STAS.|Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						GTAGTGTACCATGGAGAAATC	0.547													12	97	---	---	---	---	capture	Missense_Mutation	SNP	35922972	35922972	SLC26A8	6	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	14415	107
EPM2A	7957	broad.mit.edu	37	6	145948736	145948736	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:145948736C>T	uc003qkw.2	-	4	1169	c.812G>A	c.(811-813)GGC>GAC	p.G271D	EPM2A_uc003qkv.2_Missense_Mutation_p.G271D|EPM2A_uc010khr.2_Silent_p.G190G|EPM2A_uc003qkx.2_Missense_Mutation_p.G133D|EPM2A_uc003qku.2_Missense_Mutation_p.G117D	NM_005670	NP_005661	O95278	EPM2A_HUMAN	laforin isoform a	271	Tyrosine-protein phosphatase.				glycogen metabolic process	cytosol|endoplasmic reticulum|nucleus|plasma membrane|polysome	carbohydrate binding|identical protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		GGTGGAGCGGCCCACCCCAGC	0.632													19	54	---	---	---	---	capture	Missense_Mutation	SNP	145948736	145948736	EPM2A	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5138	107
C7orf10	79783	broad.mit.edu	37	7	40899925	40899925	+	Silent	SNP	G	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40899925G>C	uc003thn.1	+	14	1209	c.1164G>C	c.(1162-1164)GTG>GTC	p.V388V	C7orf10_uc003thm.1_Silent_p.V384V|C7orf10_uc003tho.1_Silent_p.V340V|C7orf10_uc003thp.1_RNA	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	395							transferase activity			ovary(2)	2						GCCCAGCTGTGAGATACAGTA	0.527													71	204	---	---	---	---	capture	Silent	SNP	40899925	40899925	C7orf10	7	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	2353	107
C7orf10	79783	broad.mit.edu	37	7	40899950	40899950	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40899950G>C	uc003thn.1	+	14	1234	c.1189G>C	c.(1189-1191)GAG>CAG	p.E397Q	C7orf10_uc003thm.1_Missense_Mutation_p.E393Q|C7orf10_uc003tho.1_Missense_Mutation_p.E349Q|C7orf10_uc003thp.1_RNA	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	404							transferase activity			ovary(2)	2						CAAGATGTCAGAGGCCAGGCC	0.552													83	230	---	---	---	---	capture	Missense_Mutation	SNP	40899950	40899950	C7orf10	7	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	2353	107
STEAP4	79689	broad.mit.edu	37	7	87912074	87912074	+	Missense_Mutation	SNP	C	A	A	rs79363691		TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87912074C>A	uc003ujs.2	-	3	971	c.866G>T	c.(865-867)TGC>TTC	p.C289F	STEAP4_uc010lek.2_Intron|STEAP4_uc003ujt.2_Missense_Mutation_p.C289F	NM_024636	NP_078912	Q687X5	STEA4_HUMAN	tumor necrosis factor, alpha-induced protein 9	289	Ferric oxidoreductase.				fat cell differentiation|ion transport|iron ion homeostasis	Golgi membrane|integral to membrane|plasma membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	Esophageal squamous(14;0.00802)					CTGCTTTCGGCAAAGCATCCA	0.478													11	52	---	---	---	---	capture	Missense_Mutation	SNP	87912074	87912074	STEAP4	7	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	15170	107
EZH2	2146	broad.mit.edu	37	7	148506237	148506237	+	Silent	SNP	A	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148506237A>T	uc003wfd.1	-	19	2272	c.2106T>A	c.(2104-2106)GTT>GTA	p.V702V	EZH2_uc011kug.1_Silent_p.V651V|EZH2_uc003wfb.1_Silent_p.V707V|EZH2_uc003wfc.1_Silent_p.V663V|EZH2_uc011kuh.1_Silent_p.V693V	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	702	SET.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			GATCACCGTTAACCATCATAA	0.443			Mis		DLBCL								20	143	---	---	---	---	capture	Silent	SNP	148506237	148506237	EZH2	7	A	T	T	T	1	0	0	0	0	0	0	0	1	158	13	4	4	5288	107
ZFHX4	79776	broad.mit.edu	37	8	77766549	77766549	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:77766549G>A	uc003yav.2	+	10	7644	c.7257G>A	c.(7255-7257)TCG>TCA	p.S2419S	ZFHX4_uc003yau.1_Silent_p.S2464S|ZFHX4_uc003yaw.1_Silent_p.S2419S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2419	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GACCTCCCTCGGCCTCTCAAA	0.423										HNSCC(33;0.089)			8	27	---	---	---	---	capture	Silent	SNP	77766549	77766549	ZFHX4	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17515	107
IARS	3376	broad.mit.edu	37	9	95050515	95050515	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95050515C>T	uc004art.1	-	3	426	c.169G>A	c.(169-171)GGA>AGA	p.G57R	IARS_uc004ars.1_5'UTR|IARS_uc004aru.3_Missense_Mutation_p.G57R|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Missense_Mutation_p.M12I	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	57	HIGH region.				isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	AGTATATGTCCATAGTGAGGC	0.368													13	81	---	---	---	---	capture	Missense_Mutation	SNP	95050515	95050515	IARS	9	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	7398	107
DNM1	1759	broad.mit.edu	37	9	130965824	130965824	+	Silent	SNP	G	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130965824G>A	uc011mau.1	+	1	162	c.75G>A	c.(73-75)CAG>CAA	p.Q25Q	CIZ1_uc004btw.2_Intron|CIZ1_uc004btv.2_Intron|DNM1_uc010mxr.2_Silent_p.Q25Q|DNM1_uc011mat.1_Silent_p.Q25Q	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1	25					receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2						CCATCGGCCAGAACGCGGACC	0.692													4	8	---	---	---	---	capture	Silent	SNP	130965824	130965824	DNM1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	4626	107
CDKL5	6792	broad.mit.edu	37	X	18622176	18622176	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18622176C>G	uc004cym.2	+	12	1385	c.1132C>G	c.(1132-1134)CCA>GCA	p.P378A	CDKL5_uc004cyn.2_Missense_Mutation_p.P378A	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	378					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					TAGTCTTAGTCCACTGCACAC	0.522													37	172	---	---	---	---	capture	Missense_Mutation	SNP	18622176	18622176	CDKL5	23	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	3127	107
PHEX	5251	broad.mit.edu	37	X	22051086	22051086	+	Translation_Start_Site	SNP	A	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:22051086A>T	uc004dah.2	+	1	166	c.-37A>T	c.(-39--35)AAAGT>AATGT		PHEX_uc011mjr.1_Translation_Start_Site	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						AACCACGAAAAGTGACTTTCT	0.502													24	92	---	---	---	---	capture	Translation_Start_Site	SNP	22051086	22051086	PHEX	23	A	T	T	T	1	0	0	0	0	0	0	0	0	27	3	4	4	11722	107
DCAF8L1	139425	broad.mit.edu	37	X	27998447	27998447	+	Silent	SNP	G	C	C			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27998447G>C	uc004dbx.1	-	1	1120	c.1005C>G	c.(1003-1005)GTC>GTG	p.V335V		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	335	WD 4.									ovary(3)|skin(1)	4						TATACAGTCCGACTTTCTTAT	0.418													17	101	---	---	---	---	capture	Silent	SNP	27998447	27998447	DCAF8L1	23	G	C	C	C	1	0	0	0	0	0	0	0	1	470	37	4	4	4236	107
CXorf22	170063	broad.mit.edu	37	X	35966473	35966473	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35966473T>A	uc004ddj.2	+	4	619	c.560T>A	c.(559-561)ATT>AAT	p.I187N	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	187										large_intestine(1)|lung(1)|ovary(1)	3						CCCATCCTCATTTTTCCAACT	0.403													29	140	---	---	---	---	capture	Missense_Mutation	SNP	35966473	35966473	CXorf22	23	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	4062	107
OTC	5009	broad.mit.edu	37	X	38260563	38260563	+	Missense_Mutation	SNP	G	C	C	rs68026851		TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:38260563G>C	uc004def.3	+	5	636	c.422G>C	c.(421-423)CGA>CCA	p.R141P		NM_000531	NP_000522	P00480	OTC_HUMAN	ornithine carbamoyltransferase precursor	141		Ornithine.|Carbamoyl phosphate.	R -> Q (in OTCD; activity is 100-fold lower; most common point mutation).|R -> P (in OTCD).		arginine biosynthetic process|urea cycle	mitochondrial matrix|ornithine carbamoyltransferase complex	ornithine carbamoyltransferase activity			ovary(1)|breast(1)	2					L-Citrulline(DB00155)|L-Ornithine(DB00129)	GTATTGGCTCGAGTGTATAAA	0.378													6	45	---	---	---	---	capture	Missense_Mutation	SNP	38260563	38260563	OTC	23	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	11205	107
MAOB	4129	broad.mit.edu	37	X	43626865	43626865	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:43626865C>G	uc004dfz.3	-	15	1587	c.1411G>C	c.(1411-1413)GAT>CAT	p.D471H	MAOB_uc011mkx.1_3'UTR|MAOB_uc011mky.1_Missense_Mutation_p.D455H	NM_000898	NP_000889	P27338	AOFB_HUMAN	monoamine oxidase B	471	Cytoplasmic.				xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	electron carrier activity|primary amine oxidase activity			ovary(1)|central_nervous_system(1)	2					Amantadine(DB00915)|Bupropion(DB01156)|Carbidopa(DB00190)|Citalopram(DB00215)|Dopamine(DB00988)|Entacapone(DB00494)|Furazolidone(DB00614)|Ginkgo biloba(DB01381)|Ibuprofen(DB01050)|Imipramine(DB00458)|Iproniazid(DB04818)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Maprotiline(DB00934)|Meclizine(DB00737)|Moclobemide(DB01171)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Rasagiline(DB01367)|Selegiline(DB01037)|Tranylcypromine(DB00752)	GCAGGGACATCCTAGGTTCAG	0.348													10	53	---	---	---	---	capture	Missense_Mutation	SNP	43626865	43626865	MAOB	23	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9140	107
ATRX	546	broad.mit.edu	37	X	76938530	76938530	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76938530C>A	uc004ecp.3	-	9	2450	c.2218G>T	c.(2218-2220)GAG>TAG	p.E740*	ATRX_uc004ecq.3_Nonsense_Mutation_p.E702*|ATRX_uc004eco.3_Nonsense_Mutation_p.E525*|ATRX_uc004ecr.2_Nonsense_Mutation_p.E672*|ATRX_uc010nlx.1_Nonsense_Mutation_p.E711*|ATRX_uc010nly.1_Nonsense_Mutation_p.E685*	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	740					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	CTGCTCACCTCTTTGAGGATT	0.358			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						62	239	---	---	---	---	capture	Nonsense_Mutation	SNP	76938530	76938530	ATRX	23	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	1199	107
RPL36A	6173	broad.mit.edu	37	X	100646547	100646547	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100646547C>T	uc004ehk.2	+	2	188	c.104C>T	c.(103-105)GCC>GTC	p.A35V	BTK_uc010nno.2_5'Flank|RPL36A_uc004ehj.1_Missense_Mutation_p.A35V	NM_021029	NP_066357	P83881	RL36A_HUMAN	ribosomal protein L36a	35					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						TCTCTGTACGCCCAGGGTAAG	0.483													29	118	---	---	---	---	capture	Missense_Mutation	SNP	100646547	100646547	RPL36A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13479	107
CDC27	996	broad.mit.edu	37	17	45219612	45219612	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-6391-01	TCGA-06-6391-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45219612delA	uc002ild.3	-	11	1488	c.1361delT	c.(1360-1362)CTAfs	p.L454fs	CDC27_uc002ile.3_Frame_Shift_Del_p.L460fs|CDC27_uc002ilf.3_Frame_Shift_Del_p.L454fs|CDC27_uc010wkp.1_Frame_Shift_Del_p.L393fs|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	454					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGCTTTTTGTAGATTAAAGGC	0.308													9	54	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	45219612	45219612	CDC27	17	A	-	-	-	1	0	1	0	1	0	0	0	0	195	15	5	5	3037	107
