Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TNFRSF8	943	broad.mit.edu	37	1	12172043	12172043	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12172043C>T	uc001atq.2	+	7	987	c.765C>T	c.(763-765)CGC>CGT	p.R255R	TNFRSF8_uc010obc.1_Silent_p.R144R	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	255	TNFR-Cys 5.|Extracellular (Potential).				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCCGGCCGCTGCACGGCCT	0.587													23	38	---	---	---	---	capture	Silent	SNP	12172043	12172043	TNFRSF8	1	C	T	T	T	1	0	0	0	0	0	0	0	1	353	28	2	2	16182	109
LOC440563	440563	broad.mit.edu	37	1	13183578	13183578	+	Nonsense_Mutation	SNP	G	A	A	rs115194400	by1000genomes	TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:13183578G>A	uc010obg.1	-	1	390	c.295C>T	c.(295-297)CGA>TGA	p.R99*		NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	99						ribonucleoprotein complex	nucleic acid binding|nucleotide binding				0						GCTGCGGATCGTTTCACACCT	0.502													28	46	---	---	---	---	capture	Nonsense_Mutation	SNP	13183578	13183578	LOC440563	1	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	8797	109
EPHA10	284656	broad.mit.edu	37	1	38227194	38227194	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38227194C>T	uc009vvi.2	-	3	819	c.733G>A	c.(733-735)GAA>AAA	p.E245K	EPHA10_uc001cbw.3_Missense_Mutation_p.E245K	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	245	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGCTCCCCTTCCGAGTGCGCC	0.736													11	24	---	---	---	---	capture	Missense_Mutation	SNP	38227194	38227194	EPHA10	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	5121	109
MACF1	23499	broad.mit.edu	37	1	39924911	39924911	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39924911G>A	uc010oiu.1	+	56	16810	c.16679G>A	c.(16678-16680)CGG>CAG	p.R5560Q	MACF1_uc010ois.1_Missense_Mutation_p.R5058Q|MACF1_uc001cde.1_5'Flank|MACF1_uc001cdf.1_5'Flank	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	7016					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCCTTGGATCGGCTGGAGGAG	0.512													20	32	---	---	---	---	capture	Missense_Mutation	SNP	39924911	39924911	MACF1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9059	109
KIAA0467	23334	broad.mit.edu	37	1	43912755	43912755	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43912755G>A	uc001cjk.1	+	51	6967	c.6505G>A	c.(6505-6507)GGC>AGC	p.G2169S	KIAA0467_uc001cjl.1_Missense_Mutation_p.G157S	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	3068						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCTGCGGCACGGCTACCACCT	0.607													13	19	---	---	---	---	capture	Missense_Mutation	SNP	43912755	43912755	KIAA0467	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8100	109
JUN	3725	broad.mit.edu	37	1	59248392	59248392	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:59248392G>A	uc001cze.2	-	1	1394	c.351C>T	c.(349-351)GCC>GCT	p.A117A	uc001czf.2_5'Flank|uc010oop.1_5'Flank	NM_002228	NP_002219	P05412	JUN_HUMAN	jun oncogene	117					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation by host of viral transcription|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein import into nucleus|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		R-SMAD binding|Rho GTPase activator activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity|transcription factor binding|transcription regulatory region DNA binding				0	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Vinblastine(DB00570)	GTTCGGCCAGGGCGCGCACGA	0.697			A		sarcoma								23	70	---	---	---	---	capture	Silent	SNP	59248392	59248392	JUN	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7892	109
CTSS	1520	broad.mit.edu	37	1	150730364	150730364	+	Silent	SNP	G	A	A	rs139535421		TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150730364G>A	uc001evn.2	-	3	352	c.219C>T	c.(217-219)TAC>TAT	p.Y73Y	CTSS_uc010pcj.1_Silent_p.Y73Y|CTSS_uc001evo.1_Silent_p.Y73Y	NM_004079	NP_004070	P25774	CATS_HUMAN	cathepsin S preproprotein	73					immune response|proteolysis	extracellular region|lysosome	cysteine-type endopeptidase activity				0	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)			TGCCCAGATCGTATGAGTGCA	0.428													16	15	---	---	---	---	capture	Silent	SNP	150730364	150730364	CTSS	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4002	109
FLG	2312	broad.mit.edu	37	1	152285059	152285059	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152285059G>A	uc001ezu.1	-	3	2339	c.2303C>T	c.(2302-2304)GCT>GTT	p.A768V	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	768	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGGTGACCAGCCTGTCCATG	0.562									Ichthyosis				101	465	---	---	---	---	capture	Missense_Mutation	SNP	152285059	152285059	FLG	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	5867	109
NUF2	83540	broad.mit.edu	37	1	163315530	163315530	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:163315530G>T	uc001gcq.1	+	11	1170	c.870G>T	c.(868-870)CAG>CAT	p.Q290H	NUF2_uc001gcp.2_Missense_Mutation_p.Q290H|NUF2_uc001gcr.1_Missense_Mutation_p.Q290H|NUF2_uc009wvc.1_Intron	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	290	Interaction with the N-terminus of NDC80.|Potential.				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)					CTTCATGTCAGTTGGAAGTGC	0.358													37	48	---	---	---	---	capture	Missense_Mutation	SNP	163315530	163315530	NUF2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	10654	109
HMCN1	83872	broad.mit.edu	37	1	186092310	186092310	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186092310G>A	uc001grq.1	+	81	12686	c.12457G>A	c.(12457-12459)GTA>ATA	p.V4153I		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4153	Ig-like C2-type 40.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGCAGCCAATGTAGCAGGATC	0.498													10	18	---	---	---	---	capture	Missense_Mutation	SNP	186092310	186092310	HMCN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	7145	109
CAMSAP1L1	23271	broad.mit.edu	37	1	200823985	200823985	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200823985C>T	uc001gvl.2	+	15	4167	c.3897C>T	c.(3895-3897)AAC>AAT	p.N1299N	CAMSAP1L1_uc001gvk.2_Silent_p.N1288N|CAMSAP1L1_uc001gvm.2_Silent_p.N1272N	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein	1299						cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						CGGGTGATAACGAGAGTGTAC	0.343													8	32	---	---	---	---	capture	Silent	SNP	200823985	200823985	CAMSAP1L1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2588	109
CHML	1122	broad.mit.edu	37	1	241797187	241797187	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:241797187G>A	uc001hzd.2	-	1	2046	c.1882C>T	c.(1882-1884)CCT>TCT	p.P628S	OPN3_uc001hza.2_Intron|OPN3_uc001hzb.2_Intron|OPN3_uc001hzc.2_Intron	NM_001821	NP_001812	P26374	RAE2_HUMAN	choroideremia-like Rab escort protein 2	628					intracellular protein transport|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity	p.P628S(1)		ovary(4)|skin(2)	6	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TTGGTTCCAGGAGCCTCTGGC	0.418													73	107	---	---	---	---	capture	Missense_Mutation	SNP	241797187	241797187	CHML	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3316	109
MYOF	26509	broad.mit.edu	37	10	95134679	95134679	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:95134679G>A	uc001kin.2	-	23	2265	c.2142C>T	c.(2140-2142)AAC>AAT	p.N714N	MYOF_uc001kio.2_Silent_p.N701N|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	714	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						GAACTGTGACGTTGGCTTTTC	0.448													39	12	---	---	---	---	capture	Silent	SNP	95134679	95134679	MYOF	10	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9999	109
LRRC27	80313	broad.mit.edu	37	10	134165159	134165159	+	Silent	SNP	G	A	A	rs147065829		TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:134165159G>A	uc010quw.1	+	7	1170	c.975G>A	c.(973-975)CCG>CCA	p.P325P	LRRC27_uc001llf.2_Missense_Mutation_p.R357H|LRRC27_uc010quv.1_Silent_p.P325P|LRRC27_uc001llg.2_RNA|LRRC27_uc001lli.2_Silent_p.P325P|LRRC27_uc001llj.2_Silent_p.P263P|LRRC27_uc001llk.3_Silent_p.P198P	NM_030626	NP_085129	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27 isoform a	325										ovary(1)	1		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		TCTTGTCACCGTACCAAATGG	0.527													5	262	---	---	---	---	capture	Silent	SNP	134165159	134165159	LRRC27	10	G	A	A	A	1	0	0	0	0	0	0	0	1	520	40	1	1	8897	109
FAM160A2	84067	broad.mit.edu	37	11	6239211	6239211	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6239211G>A	uc001mcl.3	-	9	1964	c.1605C>T	c.(1603-1605)GGC>GGT	p.G535G	FAM160A2_uc001mck.3_Silent_p.G549G|FAM160A2_uc001mcm.2_Silent_p.G535G	NM_001098794	NP_001092264	Q8N612	F16A2_HUMAN	hypothetical protein LOC84067 isoform 2	535					early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|protein transport	FHF complex	protein binding			skin(2)	2						TAGGCCGTCGGCCAGGGCTGG	0.652													6	45	---	---	---	---	capture	Silent	SNP	6239211	6239211	FAM160A2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	5423	109
SLC35C1	55343	broad.mit.edu	37	11	45827648	45827648	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45827648C>T	uc001nbp.2	+	1	1008	c.296C>T	c.(295-297)CCT>CTT	p.P99L	SLC35C1_uc001nbo.2_Missense_Mutation_p.P86L|SLC35C1_uc010rgm.1_Missense_Mutation_p.P86L	NM_018389	NP_060859	Q96A29	FUCT1_HUMAN	GDP-fucose transporter 1 isoform a	99						Golgi membrane|integral to membrane	GDP-fucose transmembrane transporter activity				0				GBM - Glioblastoma multiforme(35;0.227)		GCCTGCTGCCCTGGTGCCGTG	0.652													28	7	---	---	---	---	capture	Missense_Mutation	SNP	45827648	45827648	SLC35C1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	14471	109
OR4C11	219429	broad.mit.edu	37	11	55371296	55371296	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55371296A>T	uc010rii.1	-	1	554	c.554T>A	c.(553-555)CTT>CAT	p.L185H		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CATGCAGGCAAGTTTCAACAA	0.398													35	18	---	---	---	---	capture	Missense_Mutation	SNP	55371296	55371296	OR4C11	11	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	10949	109
OR4P4	81300	broad.mit.edu	37	11	55405976	55405976	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55405976C>T	uc010rij.1	+	1	143	c.143C>T	c.(142-144)ACG>ATG	p.T48M		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	48	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						ATTTCTATCACGTGCACCCAG	0.388													7	146	---	---	---	---	capture	Missense_Mutation	SNP	55405976	55405976	OR4P4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10984	109
OR5M1	390168	broad.mit.edu	37	11	56380780	56380780	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56380780A>G	uc001nja.1	-	1	199	c.199T>C	c.(199-201)TCC>CCC	p.S67P		NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						TCTACAAAGGAGAGGTGGCCA	0.463													21	73	---	---	---	---	capture	Missense_Mutation	SNP	56380780	56380780	OR5M1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	11076	109
OR5AR1	219493	broad.mit.edu	37	11	56431356	56431356	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56431356C>A	uc010rjm.1	+	1	195	c.195C>A	c.(193-195)AAC>AAA	p.N65K		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCCTCTGCAACCTCTCCTTTG	0.453													9	180	---	---	---	---	capture	Missense_Mutation	SNP	56431356	56431356	OR5AR1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	11049	109
LRP5	4041	broad.mit.edu	37	11	68191121	68191121	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68191121G>A	uc001ont.2	+	14	3267	c.3192G>A	c.(3190-3192)GGG>GGA	p.G1064G	LRP5_uc009ysg.2_Silent_p.G474G	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	1064	LDL-receptor class B 17.|Beta-propeller 4.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						TGCTGCGTGGGGACCGCGACA	0.677													63	15	---	---	---	---	capture	Silent	SNP	68191121	68191121	LRP5	11	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	8876	109
CLPB	81570	broad.mit.edu	37	11	72005108	72005108	+	Silent	SNP	G	A	A	rs147296630		TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72005108G>A	uc001osj.2	-	16	1883	c.1833C>T	c.(1831-1833)GAC>GAT	p.D611D	CLPB_uc010rqx.1_Silent_p.D566D|CLPB_uc010rqy.1_Silent_p.D552D|CLPB_uc001osk.2_Silent_p.D581D|CLPB_uc009ytg.2_RNA|CLPB_uc010rqz.1_Silent_p.D410D|CLPB_uc001osi.2_Silent_p.D219D	NM_030813	NP_110440	Q9H078	CLPB_HUMAN	caseinolytic peptidase B	611					cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1						CATTGTAGCCGTCGACCAGCA	0.612													13	20	---	---	---	---	capture	Silent	SNP	72005108	72005108	CLPB	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3516	109
TMEM25	84866	broad.mit.edu	37	11	118403822	118403822	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118403822C>T	uc010rye.1	+	4	747	c.573C>T	c.(571-573)ACC>ACT	p.T191T	TMEM25_uc010ryd.1_Silent_p.T191T|TMEM25_uc001ptk.3_Silent_p.T191T|TMEM25_uc001pth.2_Silent_p.T191T|TMEM25_uc009zad.2_Silent_p.T191T|TMEM25_uc001pti.2_Silent_p.T87T|TMEM25_uc010ryf.1_Intron|TMEM25_uc001ptl.2_Silent_p.T191T|TMEM25_uc001ptm.2_Silent_p.T191T|TMEM25_uc001ptn.2_Silent_p.T191T	NM_032780	NP_116169	Q86YD3	TMM25_HUMAN	transmembrane protein 25 isoform 1	191	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		CCTGGCTCACCAACCACACGG	0.632													30	13	---	---	---	---	capture	Silent	SNP	118403822	118403822	TMEM25	11	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	16033	109
AICDA	57379	broad.mit.edu	37	12	8757515	8757515	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8757515T>A	uc001qur.2	-	4	510	c.431A>T	c.(430-432)TAT>TTT	p.Y144F	AICDA_uc001qup.1_Intron|AICDA_uc001quq.1_Intron|AICDA_uc009zgd.1_Intron	NM_020661	NP_065712	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	144					B cell differentiation|DNA demethylation|mRNA processing|negative regulation of methylation-dependent chromatin silencing	cytoplasm	cytidine deaminase activity|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung SC(5;0.184)					GCAGTAAAAATAATCTTCAAA	0.428									Immune_Deficiency_with_Hyper-IgM				9	26	---	---	---	---	capture	Missense_Mutation	SNP	8757515	8757515	AICDA	12	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	422	109
MFSD5	84975	broad.mit.edu	37	12	53646716	53646716	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53646716T>A	uc001sci.1	+	2	288	c.97T>A	c.(97-99)TGC>AGC	p.C33S	MFSD5_uc001sch.1_Missense_Mutation_p.C140S	NM_032889	NP_116278	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing	33					transport	integral to membrane				skin(2)|ovary(1)	3						TGGAAGGGCCTGCAGCAATCC	0.572													11	124	---	---	---	---	capture	Missense_Mutation	SNP	53646716	53646716	MFSD5	12	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	9446	109
SPIC	121599	broad.mit.edu	37	12	101880531	101880531	+	Silent	SNP	A	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101880531A>G	uc001tid.2	+	6	888	c.729A>G	c.(727-729)CTA>CTG	p.L243L	SPIC_uc009zua.2_Silent_p.L118L|SPIC_uc010svp.1_Silent_p.L242L	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	243						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						ACCATGAGCTAAATCACCATG	0.323													3	91	---	---	---	---	capture	Silent	SNP	101880531	101880531	SPIC	12	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	14943	109
CIT	11113	broad.mit.edu	37	12	120148180	120148180	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120148180C>T	uc001txi.1	-	38	4874	c.4821G>A	c.(4819-4821)GTG>GTA	p.V1607V	CIT_uc001txh.1_Silent_p.V1126V|CIT_uc001txj.1_Silent_p.V1649V	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1607	CNH.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CCTCGGTGCCCACCAACACCA	0.512													5	39	---	---	---	---	capture	Silent	SNP	120148180	120148180	CIT	12	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3403	109
OASL	8638	broad.mit.edu	37	12	121471350	121471350	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121471350A>G	uc001tzj.1	-	2	401	c.395T>C	c.(394-396)GTC>GCC	p.V132A	OASL_uc001tzk.1_Missense_Mutation_p.V132A	NM_003733	NP_003724	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like isoform a	132					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoplasm|nucleolus	ATP binding|DNA binding|double-stranded RNA binding|thyroid hormone receptor binding|transferase activity			skin(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGCATCGGGGACTCTCTGCTC	0.587													5	69	---	---	---	---	capture	Missense_Mutation	SNP	121471350	121471350	OASL	12	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	10707	109
RIMBP2	23504	broad.mit.edu	37	12	130927081	130927081	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130927081G>A	uc001uil.2	-	8	929	c.765C>T	c.(763-765)TCC>TCT	p.S255S	RIMBP2_uc001uim.2_Silent_p.S163S|RIMBP2_uc001uin.1_5'UTR	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	255						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGCCGATGCCGGAATGGTTGA	0.597													49	23	---	---	---	---	capture	Silent	SNP	130927081	130927081	RIMBP2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13255	109
PABPC3	5042	broad.mit.edu	37	13	25671129	25671129	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25671129C>T	uc001upy.2	+	1	854	c.793C>T	c.(793-795)CGA>TGA	p.R265*		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	265	RRM 3.				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TTACGTTGGTCGAGCTCAGAA	0.403													16	56	---	---	---	---	capture	Nonsense_Mutation	SNP	25671129	25671129	PABPC3	13	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	11269	109
OR4M1	441670	broad.mit.edu	37	14	20249075	20249075	+	Silent	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20249075G>T	uc010tku.1	+	1	594	c.594G>T	c.(592-594)GTG>GTT	p.V198V		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	198	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGGAGTTAGTGATGATCTGTA	0.478													45	578	---	---	---	---	capture	Silent	SNP	20249075	20249075	OR4M1	14	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	10979	109
JPH4	84502	broad.mit.edu	37	14	24040215	24040215	+	Silent	SNP	C	T	T	rs144311601		TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24040215C>T	uc001wkq.2	-	6	2643	c.1725G>A	c.(1723-1725)TCG>TCA	p.S575S	AP1G2_uc001wkl.2_5'Flank|AP1G2_uc001wkn.2_5'Flank|AP1G2_uc010tnp.1_5'Flank|AP1G2_uc010akt.2_5'Flank|JPH4_uc010tnr.1_Silent_p.S240S|JPH4_uc001wkr.2_Silent_p.S575S	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN	junctophilin 4	575	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane				ovary(1)|pancreas(1)	2	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		CCCTCGAGGACGAGCCCCTCA	0.687													23	29	---	---	---	---	capture	Silent	SNP	24040215	24040215	JPH4	14	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	7886	109
IRF9	10379	broad.mit.edu	37	14	24635334	24635334	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24635334G>A	uc001wmq.2	+	9	1238	c.1111G>A	c.(1111-1113)GAG>AAG	p.E371K	RNF31_uc001wmp.2_RNA|IRF9_uc010alj.2_Missense_Mutation_p.E155K	NM_006084	NP_006075	Q00978	IRF9_HUMAN	interferon-stimulated transcription factor 3,	371					interferon-gamma-mediated signaling pathway|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)		AATACAGATGGAGCAGGCCTT	0.597													14	23	---	---	---	---	capture	Missense_Mutation	SNP	24635334	24635334	IRF9	14	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	7760	109
FNTB	2342	broad.mit.edu	37	14	65520032	65520032	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65520032G>A	uc001xia.2	+	10	1197	c.1032G>A	c.(1030-1032)CAG>CAA	p.Q344Q	FNTB_uc010tsl.1_Silent_p.Q378Q|FNTB_uc010tsm.1_Silent_p.Q298Q|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_Silent_p.Q100Q|FNTB_uc010tso.1_Silent_p.Q259Q	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	344	PFTB 5.				protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TGTGCTGCCAGTGCCCTGCGG	0.592													3	25	---	---	---	---	capture	Silent	SNP	65520032	65520032	FNTB	14	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	5922	109
MAP1A	4130	broad.mit.edu	37	15	43820051	43820051	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43820051C>G	uc001zrt.2	+	4	6847	c.6380C>G	c.(6379-6381)CCT>CGT	p.P2127R		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2127						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TCCCCAAGTCCTCCTCACCCC	0.582													11	41	---	---	---	---	capture	Missense_Mutation	SNP	43820051	43820051	MAP1A	15	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	9141	109
FGF7	2252	broad.mit.edu	37	15	49776594	49776594	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49776594G>A	uc001zxn.2	+	4	1007	c.478G>A	c.(478-480)GGA>AGA	p.G160R	C15orf33_uc001zxl.2_Intron|C15orf33_uc001zxm.2_Intron	NM_002009	NP_002000	P21781	FGF7_HUMAN	fibroblast growth factor 7 precursor	160					actin cytoskeleton reorganization|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|mesenchymal cell proliferation|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization at cell surface|secretion by lung epithelial cell involved in lung growth		chemoattractant activity|growth factor activity				0		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)	Palifermin(DB00039)	GACACACAACGGAGGGGAAAT	0.353													17	26	---	---	---	---	capture	Missense_Mutation	SNP	49776594	49776594	FGF7	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5803	109
BCL2L10	10017	broad.mit.edu	37	15	52404684	52404684	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:52404684C>T	uc002abq.2	-	1	289	c.240G>A	c.(238-240)CTG>CTA	p.L80L		NM_020396	NP_065129	Q9HD36	B2L10_HUMAN	BCL2-like 10 (apoptosis facilitator)	70					activation of caspase activity|anti-apoptosis|female gamete generation|spermatogenesis	cytosol|integral to membrane|membrane fraction|mitochondrion|nuclear membrane	protein binding				0				all cancers(107;0.0148)		AATCCGCCATCAGCGCCACCA	0.692													3	11	---	---	---	---	capture	Silent	SNP	52404684	52404684	BCL2L10	15	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	1357	109
RFX7	64864	broad.mit.edu	37	15	56387837	56387837	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56387837G>T	uc010bfn.2	-	9	2089	c.2089C>A	c.(2089-2091)CAA>AAA	p.Q697K	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Missense_Mutation_p.Q511K	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	600					regulation of transcription, DNA-dependent	nucleus	DNA binding				0						GGAACCTTTTGGTCCTTCTTA	0.453													6	96	---	---	---	---	capture	Missense_Mutation	SNP	56387837	56387837	RFX7	15	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	13163	109
RPP25	54913	broad.mit.edu	37	15	75248658	75248658	+	Silent	SNP	C	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75248658C>A	uc002azj.1	-	1	1118	c.267G>T	c.(265-267)GCG>GCT	p.A89A		NM_017793	NP_060263	Q9BUL9	RPP25_HUMAN	ribonuclease P 25kDa subunit	89					tRNA processing	nucleus	protein binding|ribonuclease P activity|RNA binding				0						GGTGCAGGCCCGCCAGGCGGC	0.736													3	20	---	---	---	---	capture	Silent	SNP	75248658	75248658	RPP25	15	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	13503	109
IGF1R	3480	broad.mit.edu	37	15	99251218	99251218	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99251218C>T	uc002bul.2	+	2	572	c.522C>T	c.(520-522)CCC>CCT	p.P174P	IGF1R_uc010urq.1_Silent_p.P174P|IGF1R_uc010bon.2_Silent_p.P174P	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	174					anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	GGAATAAGCCCCCAAAGGAAT	0.517													25	59	---	---	---	---	capture	Silent	SNP	99251218	99251218	IGF1R	15	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7496	109
TEKT5	146279	broad.mit.edu	37	16	10788195	10788195	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10788195G>A	uc002czz.1	-	1	608	c.536C>T	c.(535-537)GCG>GTG	p.A179V		NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5	179	Potential.				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						CTCATTGGCCGCGCACTCCAG	0.577													98	181	---	---	---	---	capture	Missense_Mutation	SNP	10788195	10788195	TEKT5	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15641	109
ITGAM	3684	broad.mit.edu	37	16	31286944	31286944	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31286944C>T	uc002ebq.2	+	9	1031	c.933C>T	c.(931-933)CAC>CAT	p.H311H	ITGAM_uc002ebr.2_Silent_p.H311H|ITGAM_uc010cam.1_Translation_Start_Site	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	311	VWFA.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						CTCGTGATCACGTGTTCCAGG	0.512													29	32	---	---	---	---	capture	Silent	SNP	31286944	31286944	ITGAM	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7810	109
CNGB1	1258	broad.mit.edu	37	16	57992360	57992360	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57992360T>C	uc002emt.2	-	11	856	c.791A>G	c.(790-792)GAG>GGG	p.E264G	CNGB1_uc010cdh.2_Missense_Mutation_p.E258G|CNGB1_uc002emu.2_Missense_Mutation_p.E264G	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	264					sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						CAAGGCCATCTCCAGCCTGTG	0.622													36	40	---	---	---	---	capture	Missense_Mutation	SNP	57992360	57992360	CNGB1	16	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	3565	109
DULLARD	23399	broad.mit.edu	37	17	7154554	7154554	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7154554C>T	uc002gfd.2	-	1	442	c.62G>A	c.(61-63)TGG>TAG	p.W21*	DULLARD_uc002gfe.2_Nonsense_Mutation_p.W21*|DULLARD_uc002gff.2_Nonsense_Mutation_p.W21*|DULLARD_uc002gfc.2_RNA|C17orf81_uc002gfg.1_5'Flank|C17orf81_uc002gfj.2_5'Flank|C17orf81_uc010cmb.2_5'Flank|C17orf81_uc002gfh.1_5'Flank|C17orf81_uc002gfi.1_5'Flank|C17orf81_uc002gfk.1_5'Flank|C17orf81_uc002gfl.1_5'Flank	NM_001143775	NP_001137247	O95476	CNEP1_HUMAN	dullard homolog	21	Helical; (Potential).				nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0						GAAGAAGCTCCAGAGCTTGGC	0.542													8	25	---	---	---	---	capture	Nonsense_Mutation	SNP	7154554	7154554	DULLARD	17	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	4754	109
TP53	7157	broad.mit.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577568C>A	uc002gim.2	-	7	907	c.713G>T	c.(712-714)TGT>TTT	p.C238F	TP53_uc002gig.1_Missense_Mutation_p.C238F|TP53_uc002gih.2_Missense_Mutation_p.C238F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C106F|TP53_uc010cng.1_Missense_Mutation_p.C106F|TP53_uc002gii.1_Missense_Mutation_p.C106F|TP53_uc010cnh.1_Missense_Mutation_p.C238F|TP53_uc010cni.1_Missense_Mutation_p.C238F|TP53_uc002gij.2_Missense_Mutation_p.C238F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C145F|TP53_uc002gio.2_Missense_Mutation_p.C106F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	238	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C238Y(47)|p.C238F(34)|p.C238S(18)|p.C238R(14)|p.0?(7)|p.C238*(4)|p.C238W(2)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.C238fs*9(1)|p.M237_N239delMCN(1)|p.C238fs*21(1)|p.C238del(1)|p.C238G(1)|p.C238C(1)|p.M237fs*1(1)|p.C145F(1)|p.H233fs*6(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.M237_C238insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGAACTGTTACACATGTAGTT	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			40	16	---	---	---	---	capture	Missense_Mutation	SNP	7577568	7577568	TP53	17	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	16264	109
PER1	5187	broad.mit.edu	37	17	8048179	8048179	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8048179G>A	uc002gkd.2	-	18	2589	c.2351C>T	c.(2350-2352)TCC>TTC	p.S784F	PER1_uc010cns.2_5'Flank|PER1_uc010vuq.1_RNA|PER1_uc010vur.1_Missense_Mutation_p.S768F	NM_002616	NP_002607	O15534	PER1_HUMAN	period 1	784	CSNK1E binding domain (By similarity).				circadian rhythm|entrainment of circadian clock|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			lung(2)|breast(2)|skin(2)|large_intestine(1)|ovary(1)|kidney(1)	9						TGTGTGCAGGGACAGCACGGC	0.443			T	ETV6	AML|CMML			Other_conserved_DNA_damage_response_genes					6	14	---	---	---	---	capture	Missense_Mutation	SNP	8048179	8048179	PER1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11632	109
LLGL1	3996	broad.mit.edu	37	17	18135847	18135847	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18135847G>A	uc002gsp.2	+	3	279	c.218G>A	c.(217-219)CGG>CAG	p.R73Q		NM_004140	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1	73					cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity			breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6	all_neural(463;0.228)					GGCCTGCACCGGGATGCAGCC	0.587													7	30	---	---	---	---	capture	Missense_Mutation	SNP	18135847	18135847	LLGL1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8753	109
MBTD1	54799	broad.mit.edu	37	17	49270165	49270165	+	Silent	SNP	T	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:49270165T>C	uc002itr.3	-	15	2012	c.1668A>G	c.(1666-1668)CAA>CAG	p.Q556Q	MBTD1_uc002itp.3_Silent_p.Q392Q|MBTD1_uc002itq.3_3'UTR	NM_017643	NP_060113	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	556	MBT 4.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	p.Q392Q(1)		ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			GAGGCTGTAGTTGATATCCAG	0.423													33	50	---	---	---	---	capture	Silent	SNP	49270165	49270165	MBTD1	17	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	9273	109
ZBTB7C	201501	broad.mit.edu	37	18	45566526	45566526	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:45566526G>A	uc002lda.2	-	1	969	c.953C>T	c.(952-954)CCG>CTG	p.P318L	ZBTB7C_uc002ldb.2_Missense_Mutation_p.P318L|ZBTB7C_uc010dnu.2_Missense_Mutation_p.P327L|ZBTB7C_uc010dnv.2_Missense_Mutation_p.P340L|ZBTB7C_uc010dnw.2_Missense_Mutation_p.P318L|ZBTB7C_uc010dnx.1_Missense_Mutation_p.P318L|ZBTB7C_uc010dny.1_Missense_Mutation_p.P318L|ZBTB7C_uc010dnz.1_Missense_Mutation_p.P340L|ZBTB7C_uc010dob.1_Missense_Mutation_p.P318L|ZBTB7C_uc010doc.1_Missense_Mutation_p.P327L|ZBTB7C_uc010dod.1_Missense_Mutation_p.P340L|ZBTB7C_uc010doe.1_Missense_Mutation_p.P318L|ZBTB7C_uc010dof.1_Missense_Mutation_p.P318L|ZBTB7C_uc010dog.1_Missense_Mutation_p.P318L|ZBTB7C_uc010doh.1_Missense_Mutation_p.P327L|ZBTB7C_uc010doi.1_Missense_Mutation_p.P318L|ZBTB7C_uc010doj.1_Missense_Mutation_p.P327L|ZBTB7C_uc010dok.1_Missense_Mutation_p.P367L|ZBTB7C_uc010dol.1_Missense_Mutation_p.P327L|ZBTB7C_uc010doa.1_Missense_Mutation_p.P340L|ZBTB7C_uc010don.1_Missense_Mutation_p.P326L|ZBTB7C_uc010doo.1_Missense_Mutation_p.P318L|ZBTB7C_uc010dop.1_Missense_Mutation_p.P318L|ZBTB7C_uc010doq.1_Missense_Mutation_p.P327L|ZBTB7C_uc010dor.1_Missense_Mutation_p.P340L|ZBTB7C_uc010dos.1_Missense_Mutation_p.P318L|ZBTB7C_uc010dot.1_Missense_Mutation_p.P318L|ZBTB7C_uc010dou.1_Missense_Mutation_p.P327L|ZBTB7C_uc010dom.1_Missense_Mutation_p.P327L	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	318	Pro-rich.					intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						AGGCCCCCCCGGCAGGTCAGG	0.617													22	62	---	---	---	---	capture	Missense_Mutation	SNP	45566526	45566526	ZBTB7C	18	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17435	109
C3	718	broad.mit.edu	37	19	6680198	6680198	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6680198G>T	uc002mfm.2	-	36	4489	c.4427C>A	c.(4426-4428)GCA>GAA	p.A1476E	C3_uc002mfl.2_Missense_Mutation_p.A212E	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1476					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		GACCTTGACTGCTCCAGGCTG	0.512													8	162	---	---	---	---	capture	Missense_Mutation	SNP	6680198	6680198	C3	19	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	2184	109
KANK3	256949	broad.mit.edu	37	19	8389585	8389585	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8389585C>T	uc010dwa.2	-	9	2278	c.2212G>A	c.(2212-2214)GAG>AAG	p.E738K		NM_198471	NP_940873	Q6NY19	KANK3_HUMAN	ankyrin repeat domain 47	738	ANK 4.										0						CGCCCATACTCACTGGCACAC	0.627													22	38	---	---	---	---	capture	Missense_Mutation	SNP	8389585	8389585	KANK3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	7901	109
ZNF626	199777	broad.mit.edu	37	19	20807460	20807460	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:20807460T>C	uc002npb.1	-	4	1373	c.1223A>G	c.(1222-1224)TAC>TGC	p.Y408C	ZNF626_uc002npc.1_Missense_Mutation_p.Y332C	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	408	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						GTTAGAGGAGTACTTAAAAGC	0.408													3	112	---	---	---	---	capture	Missense_Mutation	SNP	20807460	20807460	ZNF626	19	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	17928	109
ZNF257	113835	broad.mit.edu	37	19	22270778	22270778	+	Splice_Site	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22270778G>A	uc010ecx.2	+	4	396	c.227_splice	c.e4-1	p.V76_splice	ZNF257_uc010ecy.2_Splice_Site_p.V44_splice	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTTCTTTTAGTTATGTGTTC	0.294													6	50	---	---	---	---	capture	Splice_Site	SNP	22270778	22270778	ZNF257	19	G	A	A	A	1	0	0	0	0	0	0	1	0	468	36	5	2	17680	109
ZNF302	55900	broad.mit.edu	37	19	35175737	35175737	+	Silent	SNP	C	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35175737C>G	uc002nvr.1	+	6	1190	c.927C>G	c.(925-927)GCC>GCG	p.A309A	ZNF302_uc002nvp.1_Silent_p.A265A|ZNF302_uc002nvq.1_Silent_p.A265A|ZNF302_uc002nvs.1_Silent_p.A265A	NM_018443	NP_060913	Q9NR11	ZN302_HUMAN	zinc finger protein 302	344	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_lung(56;6.16e-07)|Lung NSC(56;9.71e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GTGGGAAGGCCTTTAGCCATG	0.448													19	63	---	---	---	---	capture	Silent	SNP	35175737	35175737	ZNF302	19	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	17712	109
CGB8	94115	broad.mit.edu	37	19	49551985	49551985	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49551985G>A	uc002pmb.3	-	1	384	c.12C>T	c.(10-12)TTC>TTT	p.F4F	CGB_uc010yad.1_Intron|CGB8_uc002pma.2_5'Flank|CGB8_uc002pmc.2_Intron	NM_033183	NP_149439	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 8	4					apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	GTCTTACCTGGAACATCTCCA	0.602													9	258	---	---	---	---	capture	Silent	SNP	49551985	49551985	CGB8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	3267	109
C19orf18	147685	broad.mit.edu	37	19	58485726	58485726	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58485726C>T	uc002qqv.2	-	1	179	c.75G>A	c.(73-75)CCG>CCA	p.P25P		NM_152474	NP_689687	Q8NEA5	CS018_HUMAN	hypothetical protein LOC147685 precursor	25						integral to membrane				ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		CATCTGCATACGGCAAGCATA	0.393													13	56	---	---	---	---	capture	Silent	SNP	58485726	58485726	C19orf18	19	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	1894	109
FBLN7	129804	broad.mit.edu	37	2	112944813	112944813	+	Silent	SNP	G	A	A	rs140504449		TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:112944813G>A	uc002tho.1	+	8	1321	c.1050G>A	c.(1048-1050)ACG>ACA	p.T350T	FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Silent_p.T304T|FBLN7_uc010fkj.1_Silent_p.T216T	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1	350					cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2						ACCTGAAGACGCCCATCACGC	0.652													68	63	---	---	---	---	capture	Silent	SNP	112944813	112944813	FBLN7	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5647	109
XIRP2	129446	broad.mit.edu	37	2	168103045	168103045	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168103045C>T	uc002udx.2	+	8	5161	c.5143C>T	c.(5143-5145)CGT>TGT	p.R1715C	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.R1540C|XIRP2_uc010fpq.2_Missense_Mutation_p.R1493C|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1540					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TGATGTCAAACGTACCATTCA	0.338													19	29	---	---	---	---	capture	Missense_Mutation	SNP	168103045	168103045	XIRP2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17311	109
ABCB11	8647	broad.mit.edu	37	2	169814525	169814525	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:169814525C>T	uc002ueo.1	-	19	2418	c.2292G>A	c.(2290-2292)GTG>GTA	p.V764V	ABCB11_uc010zda.1_Silent_p.V206V|ABCB11_uc010zdb.1_Silent_p.V240V	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	764	Helical; (Potential).|ABC transmembrane type-1 2.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	CTGTCCCGTTCACAGCTGCAC	0.473													21	7	---	---	---	---	capture	Silent	SNP	169814525	169814525	ABCB11	2	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	42	109
DES	1674	broad.mit.edu	37	2	220286194	220286194	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220286194C>T	uc002vll.2	+	6	1242	c.1156C>T	c.(1156-1158)CGC>TGC	p.R386C		NM_001927	NP_001918	P17661	DESM_HUMAN	desmin	386	Rod.|Coil 2B.				cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCGCCATCTGCGCGAGTACCA	0.622													27	49	---	---	---	---	capture	Missense_Mutation	SNP	220286194	220286194	DES	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4407	109
RALGAPA2	57186	broad.mit.edu	37	20	20571899	20571899	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:20571899C>T	uc002wrz.2	-	17	2406	c.2263G>A	c.(2263-2265)GTG>ATG	p.V755M	RALGAPA2_uc010gcx.2_Missense_Mutation_p.V459M|RALGAPA2_uc010zsg.1_Missense_Mutation_p.V203M	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	755					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						TGCTGTCCCACTGTGAGATGG	0.512													3	82	---	---	---	---	capture	Missense_Mutation	SNP	20571899	20571899	RALGAPA2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	12909	109
MYLK2	85366	broad.mit.edu	37	20	30409482	30409482	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30409482C>T	uc002wwq.2	+	4	816	c.714C>T	c.(712-714)TCC>TCT	p.S238S		NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase	238					cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CAGAGAAATCCGAGGTGGGGC	0.637													13	130	---	---	---	---	capture	Silent	SNP	30409482	30409482	MYLK2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9967	109
TTPAL	79183	broad.mit.edu	37	20	43115268	43115268	+	Silent	SNP	T	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43115268T>C	uc002xmc.1	+	5	796	c.672T>C	c.(670-672)CAT>CAC	p.H224H	TTPAL_uc002xmd.1_Silent_p.H224H|TTPAL_uc010ggr.1_Silent_p.H37H	NM_024331	NP_077307	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	224	CRAL-TRIO.					intracellular	transporter activity			breast(1)	1						AAGCAGTCCATGTGGTGAATG	0.408													4	56	---	---	---	---	capture	Silent	SNP	43115268	43115268	TTPAL	20	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	16619	109
TRAPPC10	7109	broad.mit.edu	37	21	45513965	45513965	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45513965G>A	uc002zea.2	+	20	3188	c.3019G>A	c.(3019-3021)GTG>ATG	p.V1007M	TRAPPC10_uc010gpo.2_Missense_Mutation_p.V718M|TRAPPC10_uc011afa.1_Missense_Mutation_p.V385M|TRAPPC10_uc011afb.1_Missense_Mutation_p.V112M	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1007					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CAAGCAGTCGGTGTTCTTCGT	0.542													41	58	---	---	---	---	capture	Missense_Mutation	SNP	45513965	45513965	TRAPPC10	21	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	16340	109
COL6A1	1291	broad.mit.edu	37	21	47421892	47421892	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47421892G>A	uc002zhu.1	+	31	2076	c.1974G>A	c.(1972-1974)TCG>TCA	p.S658S	COL6A1_uc010gqd.1_5'UTR|COL6A1_uc002zhv.1_5'UTR|COL6A1_uc002zhw.1_5'Flank	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	658	VWFA 2.|C-terminal globular domain.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	CAGGGCAGTCGTACGCGGGTG	0.652													23	28	---	---	---	---	capture	Silent	SNP	47421892	47421892	COL6A1	21	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	3664	109
CCT8L2	150160	broad.mit.edu	37	22	17072055	17072055	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17072055G>A	uc002zlp.1	-	1	1646	c.1386C>T	c.(1384-1386)GAC>GAT	p.D462D		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	462					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTGCCATCACGTCTGAGACAG	0.527													73	94	---	---	---	---	capture	Silent	SNP	17072055	17072055	CCT8L2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2932	109
SETD5	55209	broad.mit.edu	37	3	9489393	9489393	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9489393C>T	uc003brt.2	+	15	2241	c.1806C>T	c.(1804-1806)GTC>GTT	p.V602V	SETD5_uc003brs.1_Silent_p.V583V|SETD5_uc003bru.2_Silent_p.V504V|SETD5_uc003brv.2_Silent_p.V491V|SETD5_uc010hck.2_Silent_p.V84V|SETD5_uc003brx.2_Silent_p.V271V	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5	602										ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AAAAACTAGTCCCCAAGCCAC	0.468													58	91	---	---	---	---	capture	Silent	SNP	9489393	9489393	SETD5	3	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	14027	109
FAM19A4	151647	broad.mit.edu	37	3	68929927	68929927	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:68929927G>T	uc003dnh.1	-	3	527	c.84C>A	c.(82-84)TGC>TGA	p.C28*	FAM19A4_uc003dni.1_Nonsense_Mutation_p.C28*	NM_182522	NP_872328	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine	28						extracellular region				skin(2)	2		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		TCAGCTTACAGCACACCATTA	0.512													26	35	---	---	---	---	capture	Nonsense_Mutation	SNP	68929927	68929927	FAM19A4	3	G	T	T	T	1	0	0	0	0	0	1	0	0	438	34	5	4	5486	109
CEP97	79598	broad.mit.edu	37	3	101476715	101476715	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:101476715G>T	uc003dvk.1	+	9	1292	c.1265G>T	c.(1264-1266)AGG>ATG	p.R422M	CEP97_uc010hpm.1_Missense_Mutation_p.R388M|CEP97_uc011bhf.1_Missense_Mutation_p.R363M|CEP97_uc003dvl.1_Missense_Mutation_p.R118M|CEP97_uc003dvm.1_Missense_Mutation_p.R260M	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	422	CEP110 binding.					centrosome|nucleus	protein binding			ovary(2)	2						GTTGAGCTGAGGCTGCAGGGC	0.473													37	66	---	---	---	---	capture	Missense_Mutation	SNP	101476715	101476715	CEP97	3	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	3231	109
SPON2	10417	broad.mit.edu	37	4	1165082	1165082	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1165082G>T	uc003gcn.3	-	2	440	c.413C>A	c.(412-414)GCG>GAG	p.A138E	SPON2_uc003gco.3_Missense_Mutation_p.A138E|SPON2_uc010ibr.2_Missense_Mutation_p.A138E|SPON2_uc003gcm.1_Missense_Mutation_p.A56E	NM_012445	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	138	Spondin.				axon guidance|cell adhesion|innate immune response	proteinaceous extracellular matrix	metal ion binding	p.A138A(1)		central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		CTCCAGCTCCGCCGACGTCTG	0.552													9	4	---	---	---	---	capture	Missense_Mutation	SNP	1165082	1165082	SPON2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	14975	109
HELQ	113510	broad.mit.edu	37	4	84368060	84368060	+	Silent	SNP	T	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:84368060T>C	uc003hom.2	-	4	1499	c.1320A>G	c.(1318-1320)AAA>AAG	p.K440K	HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	440	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						AGCTATGTCCTTTTTCAATAG	0.373								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	108	---	---	---	---	capture	Silent	SNP	84368060	84368060	HELQ	4	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	6973	109
BMPR1B	658	broad.mit.edu	37	4	96075770	96075770	+	Silent	SNP	G	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96075770G>C	uc003htm.3	+	13	1729	c.1455G>C	c.(1453-1455)CTG>CTC	p.L485L	BMPR1B_uc010ilb.2_Silent_p.L485L|BMPR1B_uc003htn.3_Silent_p.L485L	NM_001203	NP_001194	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	485	Cytoplasmic (Potential).|Protein kinase.				BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		TGACAGCCCTGCGGGTTAAGA	0.448													49	26	---	---	---	---	capture	Silent	SNP	96075770	96075770	BMPR1B	4	G	C	C	C	1	0	0	0	0	0	0	0	1	587	46	4	4	1458	109
DKK2	27123	broad.mit.edu	37	4	107845338	107845338	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:107845338G>A	uc003hyi.2	-	4	1258	c.553C>T	c.(553-555)CGA>TGA	p.R185*	DKK2_uc003hyj.1_3'UTR	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor	185	DKK-type Cys-2.				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		TCTGATGATCGTAGGCAGGGG	0.448													54	35	---	---	---	---	capture	Nonsense_Mutation	SNP	107845338	107845338	DKK2	4	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	4503	109
ZFR	51663	broad.mit.edu	37	5	32390482	32390482	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32390482G>A	uc003jhr.1	-	12	2121	c.2041C>T	c.(2041-2043)CGC>TGC	p.R681C	ZFR_uc011cny.1_5'Flank	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	681					multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		ATTCGGCGGCGATCATCCCAA	0.507													37	48	---	---	---	---	capture	Missense_Mutation	SNP	32390482	32390482	ZFR	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17539	109
CARTPT	9607	broad.mit.edu	37	5	71015195	71015195	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71015195C>T	uc003kbv.1	+	1	202	c.75C>T	c.(73-75)ACC>ACT	p.T25T		NM_004291	NP_004282	Q16568	CART_HUMAN	cocaine- and amphetamine-regulated transcript	25					activation of MAPKK activity|adult feeding behavior|cellular glucose homeostasis|cellular response to starvation|circadian regulation of gene expression|negative regulation of appetite|negative regulation of bone resorption|negative regulation of osteoclast differentiation|neuropeptide signaling pathway|positive regulation of blood pressure|positive regulation of epinephrine secretion|positive regulation of transmission of nerve impulse|synaptic transmission	extracellular space				ovary(1)	1		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)	TGTTGGGTACCCGTGCCCAGG	0.657													24	41	---	---	---	---	capture	Silent	SNP	71015195	71015195	CARTPT	5	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	2635	109
GCNT4	51301	broad.mit.edu	37	5	74325583	74325583	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:74325583C>A	uc003kdn.2	-	1	1142	c.280G>T	c.(280-282)GAC>TAC	p.D94Y		NM_016591	NP_057675	Q9P109	GCNT4_HUMAN	core 2 beta-1,6-N-acetylglucosaminyltransferase	94	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		TCAATGATGTCCCTTCTTCTT	0.403													49	98	---	---	---	---	capture	Missense_Mutation	SNP	74325583	74325583	GCNT4	5	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	6243	109
SLC36A2	153201	broad.mit.edu	37	5	150704898	150704898	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150704898C>T	uc003lty.2	-	8	1089	c.959G>A	c.(958-960)CGG>CAG	p.R320Q	GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_Missense_Mutation_p.R122Q|SLC36A2_uc010jhv.2_Missense_Mutation_p.R320Q	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2	320	Extracellular (Potential).				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCTCCAAACCGCAGGTAGCC	0.488													11	21	---	---	---	---	capture	Missense_Mutation	SNP	150704898	150704898	SLC36A2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14486	109
IL12B	3593	broad.mit.edu	37	5	158743808	158743808	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:158743808G>A	uc003lxr.1	-	7	914	c.872C>T	c.(871-873)ACG>ATG	p.T291M		NM_002187	NP_002178	P29460	IL12B_HUMAN	interleukin 12B precursor	291	Fibronectin type-III.				cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTCTTGTCCGTGAAGACTCT	0.512											OREG0016989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	42	---	---	---	---	capture	Missense_Mutation	SNP	158743808	158743808	IL12B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7548	109
FOXF2	2295	broad.mit.edu	37	6	1391312	1391312	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:1391312A>G	uc003mtm.2	+	1	1244	c.1130A>G	c.(1129-1131)GAG>GGG	p.E377G	FOXF2_uc003mtn.2_Missense_Mutation_p.E377G	NM_001452	NP_001443	Q12947	FOXF2_HUMAN	forkhead box F2	377					epithelial to mesenchymal transition|genitalia development|palate development|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		TACTCGCTGGAGCAGAGCTAC	0.682													4	17	---	---	---	---	capture	Missense_Mutation	SNP	1391312	1391312	FOXF2	6	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5950	109
TFAP2A	7020	broad.mit.edu	37	6	10410393	10410393	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:10410393G>A	uc003myr.2	-	2	473	c.221C>T	c.(220-222)TCC>TTC	p.S74F	TFAP2A_uc003myq.2_Missense_Mutation_p.S68F|TFAP2A_uc003mys.2_Intron|TFAP2A_uc011dih.1_Missense_Mutation_p.S74F|TFAP2A_uc003myt.2_Missense_Mutation_p.S70F|TFAP2A_uc003myu.1_Missense_Mutation_p.S74F|TFAP2A_uc003myv.1_Missense_Mutation_p.S60F|TFAP2A_uc011dii.1_Missense_Mutation_p.S70F|uc003myw.2_5'Flank	NM_003220	NP_003211	P05549	AP2A_HUMAN	transcription factor AP-2 alpha isoform a	74	Gln/Pro-rich (transactivation domain).				ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GTTGACGTGGGAGTAAGGATC	0.682													45	45	---	---	---	---	capture	Missense_Mutation	SNP	10410393	10410393	TFAP2A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	15672	109
BAI3	577	broad.mit.edu	37	6	70042889	70042889	+	Silent	SNP	A	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70042889A>G	uc003pev.3	+	24	3625	c.3177A>G	c.(3175-3177)AAA>AAG	p.K1059K	BAI3_uc010kak.2_Silent_p.K1059K|BAI3_uc011dxx.1_Silent_p.K265K|BAI3_uc003pex.1_Silent_p.K189K	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1059	Cytoplasmic (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				AAAAGCTCAAACACAGAGCCG	0.398													5	23	---	---	---	---	capture	Silent	SNP	70042889	70042889	BAI3	6	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	1289	109
CDK19	23097	broad.mit.edu	37	6	110959910	110959910	+	Splice_Site	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:110959910C>T	uc003puh.1	-	5	530	c.457_splice	c.e5-1	p.K153_splice	CDK19_uc003pui.1_Splice_Site_p.K93_splice|CDK19_uc011eax.1_Splice_Site_p.K29_splice	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)								ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						TTGCTGGTTTCTAGAAATAAA	0.289													30	89	---	---	---	---	capture	Splice_Site	SNP	110959910	110959910	CDK19	6	C	T	T	T	1	0	0	0	0	0	0	1	0	416	32	5	2	3105	109
C6orf170	221322	broad.mit.edu	37	6	121560260	121560260	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:121560260G>A	uc003pyo.1	-	20	2388	c.2320C>T	c.(2320-2322)CCC>TCC	p.P774S	C6orf170_uc003pyq.1_RNA|C6orf170_uc010kej.1_5'Flank|C6orf170_uc003pyp.1_Missense_Mutation_p.P293S	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	774					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		GTAGTTCTGGGATGGGTTACC	0.333													61	83	---	---	---	---	capture	Missense_Mutation	SNP	121560260	121560260	C6orf170	6	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	2321	109
LPA	4018	broad.mit.edu	37	6	160998167	160998167	+	Splice_Site	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160998167C>T	uc003qtl.2	-	29	4751	c.4631_splice	c.e29+1	p.A1544_splice		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAAATACATACGCATTTGGGT	0.433													42	158	---	---	---	---	capture	Splice_Site	SNP	160998167	160998167	LPA	6	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	8819	109
SLC29A4	222962	broad.mit.edu	37	7	5331368	5331368	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5331368G>A	uc003sod.2	+	5	621	c.460G>A	c.(460-462)GAC>AAC	p.D154N	SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Missense_Mutation_p.D154N|SLC29A4_uc003soe.2_Silent_p.A141A	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	154	Helical; (Potential).			D->A: Loss of cationic transport activity; increase in uridine uptake.	nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		CAGCATCTGCGACGTGTGGCT	0.647													6	82	---	---	---	---	capture	Missense_Mutation	SNP	5331368	5331368	SLC29A4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14429	109
GRM3	2913	broad.mit.edu	37	7	86468659	86468659	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86468659C>T	uc003uid.2	+	4	2928	c.1829C>T	c.(1828-1830)TCG>TTG	p.S610L	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.S482L|GRM3_uc010leh.2_Missense_Mutation_p.S202L	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	610	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane		p.S610L(1)		lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GTCAAAGCATCGGGCCGAGAA	0.468													7	158	---	---	---	---	capture	Missense_Mutation	SNP	86468659	86468659	GRM3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6731	109
TECPR1	25851	broad.mit.edu	37	7	97858368	97858368	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97858368C>T	uc003upg.2	-	16	2598	c.2393G>A	c.(2392-2394)GGA>GAA	p.G798E	TECPR1_uc003uph.1_Missense_Mutation_p.G728E	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	798						integral to membrane	protein binding			pancreas(1)	1						GCAGCCGCCTCCATAGCCGCC	0.677													6	8	---	---	---	---	capture	Missense_Mutation	SNP	97858368	97858368	TECPR1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	15628	109
CYP3A4	1576	broad.mit.edu	37	7	99359709	99359709	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99359709C>T	uc003urv.1	-	11	1312	c.1208G>A	c.(1207-1209)CGT>CAT	p.R403H	CYP3A4_uc003urw.1_Missense_Mutation_p.R402H|CYP3A4_uc011kiz.1_Missense_Mutation_p.R362H|CYP3A4_uc011kja.1_Missense_Mutation_p.R354H|CYP3A4_uc011kjb.1_Missense_Mutation_p.R253H	NM_017460	NP_059488	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A,	403					alkaloid catabolic process|androgen metabolic process|exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid catabolic process|xenobiotic metabolic process	cell surface|endoplasmic reticulum membrane|integral to membrane|microsome	albendazole monooxygenase activity|caffeine oxidase activity|electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding|quinine 3-monooxygenase activity|steroid binding|taurochenodeoxycholate 6alpha-hydroxylase activity|testosterone 6-beta-hydroxylase activity|vitamin D 24-hydroxylase activity|vitamin D3 25-hydroxylase activity			central_nervous_system(3)|ovary(1)	4	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Albendazole(DB00518)|Alclometasone(DB00240)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Aliskiren(DB01258)|Almotriptan(DB00918)|Alosetron(DB00969)|Alprazolam(DB00404)|Amlodipine(DB00381)|Amprenavir(DB00701)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Benazepril(DB00542)|Bepridil(DB01244)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bortezomib(DB00188)|Bosentan(DB00559)|Bromocriptine(DB01200)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Buspirone(DB00490)|Busulfan(DB01008)|Carbamazepine(DB00564)|Cevimeline(DB00185)|Chlorpheniramine(DB01114)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cinacalcet(DB01012)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clindamycin(DB01190)|Clofibrate(DB00636)|Clonazepam(DB01068)|Clopidogrel(DB00758)|Cocaine(DB00907)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cyproterone(DB04839)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Delavirdine(DB00705)|Desogestrel(DB00304)|Dexamethasone(DB01234)|Diazepam(DB00829)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dofetilide(DB00204)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Doxorubicin(DB00997)|Drospirenone(DB01395)|Dutasteride(DB01126)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Epirubicin(DB00445)|Eplerenone(DB00700)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Exemestane(DB00990)|Felodipine(DB01023)|Fentanyl(DB00813)|Fexofenadine(DB00950)|Finasteride(DB01216)|Fluconazole(DB00196)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Fosamprenavir(DB01319)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Granisetron(DB00889)|Grepafloxacin(DB00365)|Halofantrine(DB01218)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Imatinib(DB00619)|Indinavir(DB00224)|Ipratropium(DB00332)|Irinotecan(DB00762)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levomethadyl Acetate(DB01227)|Levothyroxine(DB00451)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Maraviroc(DB04835)|Marinol(DB00470)|Mebendazole(DB00643)|Medroxyprogesterone(DB00603)|Methadone(DB00333)|Methylprednisolone(DB00959)|Metyrapone(DB01011)|Mibefradil(DB01388)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirtazapine(DB00370)|Modafinil(DB00745)|Mometasone(DB00764)|Montelukast(DB00471)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norgestrel(DB00506)|Nystatin(DB00646)|Ondansetron(DB00904)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paricalcitol(DB00910)|Phenmetrazine(DB00830)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prednisolone(DB00860)|Prednisone(DB00635)|Prochlorperazine(DB00433)|Quetiapine(DB01224)|Quinapril(DB00881)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranolazine(DB00243)|Reboxetine(DB00234)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampin(DB01045)|Rimonabant(DB06155)|Ritonavir(DB00503)|Rofecoxib(DB00533)|Roxithromycin(DB00778)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sertindole(DB06144)|Sibutramine(DB01105)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Terconazole(DB00251)|Terfenadine(DB00342)|Testosterone(DB00624)|Tiagabine(DB00906)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tiotropium(DB01409)|Tipranavir(DB00932)|Toremifene(DB00539)|Triazolam(DB00897)|Trimetrexate(DB01157)|Troglitazone(DB00197)|Valdecoxib(DB00580)|Vardenafil(DB00862)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Voriconazole(DB00582)|Zaleplon(DB00962)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)	CTTTGGGTCACGGTGAAGAGC	0.507													20	232	---	---	---	---	capture	Missense_Mutation	SNP	99359709	99359709	CYP3A4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4138	109
ACHE	43	broad.mit.edu	37	7	100490909	100490909	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100490909G>A	uc003uxd.2	-	1	1101	c.945C>T	c.(943-945)CAC>CAT	p.H315H	ACHE_uc003uxe.2_Silent_p.H315H|ACHE_uc003uxf.2_Silent_p.H315H|ACHE_uc003uxg.2_Silent_p.H315H|ACHE_uc003uxh.2_Silent_p.H315H|ACHE_uc003uxi.2_Silent_p.H315H|ACHE_uc003uxj.1_Silent_p.H434H	NM_000665	NP_000656	P22303	ACES_HUMAN	acetylcholinesterase isoform E4-E6 precursor	315					acetylcholine catabolic process in synaptic cleft|amyloid precursor protein metabolic process|cell adhesion|cell proliferation|choline metabolic process|DNA replication|muscle organ development|neurotransmitter biosynthetic process|osteoblast development|positive regulation of protein secretion|regulation of axonogenesis|regulation of dendrite morphogenesis|response to wounding|synapse assembly	anchored to membrane|axon|basal lamina|cell junction|cell surface|dendrite|endoplasmic reticulum lumen|extracellular space|Golgi apparatus|neuromuscular junction|nucleus|perinuclear region of cytoplasm|postsynaptic membrane|presynaptic membrane|synaptic cleft	acetylcholine binding|acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|collagen binding|laminin-1 binding|protein homodimerization activity|serine hydrolase activity			skin(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Atropine(DB00572)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium bromide(DB00944)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tacrine(DB00382)|Tubocurarine(DB01199)	CGTGCCATTCGTGGTTCACCA	0.607													12	38	---	---	---	---	capture	Silent	SNP	100490909	100490909	ACHE	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	141	109
MUC17	140453	broad.mit.edu	37	7	100692247	100692247	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100692247G>A	uc003uxp.1	+	5	12710	c.12657G>A	c.(12655-12657)ACG>ACA	p.T4219T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4219	Extracellular (Potential).|SEA.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AGACATTCACGGAACAGGTAA	0.507													29	62	---	---	---	---	capture	Silent	SNP	100692247	100692247	MUC17	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9884	109
EPHB6	2051	broad.mit.edu	37	7	142561409	142561409	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142561409G>A	uc011kst.1	+	6	908	c.121G>A	c.(121-123)GGA>AGA	p.G41R	EPHB6_uc011ksu.1_Missense_Mutation_p.G41R|EPHB6_uc003wbs.2_Intron|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_Intron	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	41	Extracellular (Potential).					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					GGACACCACCGGAGAGACATC	0.597													43	117	---	---	---	---	capture	Missense_Mutation	SNP	142561409	142561409	EPHB6	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5133	109
OR2A12	346525	broad.mit.edu	37	7	143792982	143792982	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143792982C>A	uc011kty.1	+	1	782	c.782C>A	c.(781-783)CCC>CAC	p.P261H		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					TACATGGCCCCCAAGTCAAGC	0.547													17	302	---	---	---	---	capture	Missense_Mutation	SNP	143792982	143792982	OR2A12	7	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	10879	109
DLC1	10395	broad.mit.edu	37	8	12952344	12952344	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:12952344C>T	uc003wwm.2	-	12	3894	c.3450G>A	c.(3448-3450)CTG>CTA	p.L1150L	DLC1_uc003wwk.1_Silent_p.L713L|DLC1_uc003wwl.1_Silent_p.L747L|DLC1_uc011kxx.1_Silent_p.L639L	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1150	Rho-GAP.				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						AATACTGCTTCAGCATGTCTG	0.468													12	34	---	---	---	---	capture	Silent	SNP	12952344	12952344	DLC1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	4508	109
TUSC3	7991	broad.mit.edu	37	8	15531274	15531274	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:15531274A>G	uc003wwt.2	+	6	937	c.727A>G	c.(727-729)ACT>GCT	p.T243A	TUSC3_uc003wwr.2_Missense_Mutation_p.T243A|TUSC3_uc003wws.2_Missense_Mutation_p.T243A|TUSC3_uc003wwu.2_Missense_Mutation_p.T243A|TUSC3_uc003wwv.2_Missense_Mutation_p.T243A|TUSC3_uc003www.2_Missense_Mutation_p.T243A|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.T243A	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	243					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		CTTTGCTATGACTTCTGGCCA	0.383													11	56	---	---	---	---	capture	Missense_Mutation	SNP	15531274	15531274	TUSC3	8	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	16660	109
SFTPC	6440	broad.mit.edu	37	8	22020640	22020640	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22020640C>T	uc003xax.3	+	3	407	c.249C>T	c.(247-249)GCC>GCT	p.A83A	SFTPC_uc003xaw.3_Silent_p.A132A|SFTPC_uc011kza.1_Silent_p.A83A|SFTPC_uc003xaz.2_Silent_p.A83A|SFTPC_uc003xay.3_Silent_p.A83A|BMP1_uc011kzb.1_5'Flank|BMP1_uc003xba.2_5'Flank|BMP1_uc003xbb.2_5'Flank|BMP1_uc003xbe.2_5'Flank|BMP1_uc003xbc.2_5'Flank|BMP1_uc003xbd.2_5'Flank|BMP1_uc003xbf.2_5'Flank|BMP1_uc003xbg.2_5'Flank|BMP1_uc011kzc.1_5'Flank|BMP1_uc003xbh.2_5'Flank|BMP1_uc003xbi.2_5'Flank	NM_003018	NP_003009	P11686	PSPC_HUMAN	surfactant protein C precursor	83					respiratory gaseous exchange	extracellular space					0				Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		AACGCCTGGCCCTGAGTGAGC	0.617													33	51	---	---	---	---	capture	Silent	SNP	22020640	22020640	SFTPC	8	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14085	109
ADAMDEC1	27299	broad.mit.edu	37	8	24256489	24256489	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24256489A>G	uc003xdz.2	+	9	1085	c.865A>G	c.(865-867)AAC>GAC	p.N289D	ADAMDEC1_uc010lub.2_Missense_Mutation_p.N210D|ADAMDEC1_uc011lab.1_Missense_Mutation_p.N210D	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1	289	Peptidase M12B.				integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		CACGTTTGACAACTTCCTGAG	0.488													13	53	---	---	---	---	capture	Missense_Mutation	SNP	24256489	24256489	ADAMDEC1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	254	109
JAK2	3717	broad.mit.edu	37	9	5080558	5080558	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5080558A>T	uc010mhm.2	+	17	2422	c.2309A>T	c.(2308-2310)CAT>CTT	p.H770L	JAK2_uc003ziw.2_Missense_Mutation_p.H770L	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	770	Protein kinase 1.				actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		GAAGATAGGCATCAGCTTCCT	0.358		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				32	14	---	---	---	---	capture	Missense_Mutation	SNP	5080558	5080558	JAK2	9	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	7861	109
FAM120A	23196	broad.mit.edu	37	9	96289441	96289441	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96289441A>C	uc004atw.2	+	8	1448	c.1423A>C	c.(1423-1425)ATC>CTC	p.I475L	FAM120A_uc004atv.2_Missense_Mutation_p.I475L|FAM120A_uc004atx.2_Missense_Mutation_p.I257L|FAM120A_uc004aty.2_Missense_Mutation_p.I256L|FAM120A_uc004atz.2_Missense_Mutation_p.I124L|FAM120A_uc010mrf.1_RNA	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator	475						cytoplasm|plasma membrane	RNA binding				0						GTTTAGCCATATCAGCGGGAA	0.463													32	21	---	---	---	---	capture	Missense_Mutation	SNP	96289441	96289441	FAM120A	9	A	C	C	C	1	0	0	0	0	1	0	0	0	208	16	4	4	5369	109
ZNF169	169841	broad.mit.edu	37	9	97063382	97063382	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97063382C>T	uc004aum.1	+	5	1647	c.1542C>T	c.(1540-1542)TAC>TAT	p.Y514Y		NM_194320	NP_919301	Q14929	ZN169_HUMAN	zinc finger protein 169	514	C2H2-type 11; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				AGGAGCTTTACGTAGACAGGG	0.537													32	19	---	---	---	---	capture	Silent	SNP	97063382	97063382	ZNF169	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17622	109
RAI2	10742	broad.mit.edu	37	X	17819726	17819726	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:17819726G>A	uc004cyf.2	-	3	975	c.405C>T	c.(403-405)AAC>AAT	p.N135N	RAI2_uc004cyg.2_Silent_p.N135N|RAI2_uc010nfa.2_Silent_p.N135N|RAI2_uc004cyh.3_Silent_p.N135N|RAI2_uc011miy.1_Silent_p.N85N	NM_021785	NP_068557	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	135					embryo development			p.N135D(1)		ovary(1)|breast(1)	2	Hepatocellular(33;0.183)					CCAGAGGGGAGTTGAGGTGCT	0.642													24	87	---	---	---	---	capture	Silent	SNP	17819726	17819726	RAI2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	12904	109
ACOT9	23597	broad.mit.edu	37	X	23731303	23731303	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:23731303G>T	uc004dap.2	-	8	730	c.584C>A	c.(583-585)CCT>CAT	p.P195H	ACOT9_uc004dao.2_Missense_Mutation_p.P204H|ACOT9_uc004daq.2_Missense_Mutation_p.P153H|ACOT9_uc004dar.2_Missense_Mutation_p.P135H|ACOT9_uc011mjt.1_Intron|ACOT9_uc004das.2_Missense_Mutation_p.P135H|ACOT9_uc004dat.1_Missense_Mutation_p.P195H	NM_001033583	NP_001028755	Q9Y305	ACOT9_HUMAN	acyl-Coenzyme A thioesterase 2, mitochondrial	195					acyl-CoA metabolic process	mitochondrion	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(2)|pancreas(1)	3						ATCCAAAACAGGACAAAATTC	0.299													14	53	---	---	---	---	capture	Missense_Mutation	SNP	23731303	23731303	ACOT9	23	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	157	109
FAM47C	442444	broad.mit.edu	37	X	37027694	37027694	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37027694C>T	uc004ddl.1	+	1	1225	c.1211C>T	c.(1210-1212)CCG>CTG	p.P404L		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	404										ovary(3)	3						CCTCTCTTCCCGGAGCCTCCC	0.607													38	41	---	---	---	---	capture	Missense_Mutation	SNP	37027694	37027694	FAM47C	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5519	109
SYN1	6853	broad.mit.edu	37	X	47478794	47478794	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47478794C>G	uc004die.2	-	1	463	c.334G>C	c.(334-336)GCC>CCC	p.A112P	SYN1_uc004did.2_Missense_Mutation_p.A112P	NM_006950	NP_008881	P17600	SYN1_HUMAN	synapsin I isoform Ia	112	B; linker.					cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1						ACCCTGGAGGCGGCTCCCCCG	0.716													5	19	---	---	---	---	capture	Missense_Mutation	SNP	47478794	47478794	SYN1	23	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	15328	109
ZNF182	7569	broad.mit.edu	37	X	47836621	47836621	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47836621G>A	uc004dir.2	-	7	1211	c.865C>T	c.(865-867)CCC>TCC	p.P289S	ZNF182_uc004dis.2_Missense_Mutation_p.P270S|ZNF182_uc004dit.2_Missense_Mutation_p.P289S|ZNF182_uc011mlu.1_Missense_Mutation_p.P269S	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	289					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						CACTCAAAGGGTCTCTCTCCT	0.403													4	81	---	---	---	---	capture	Missense_Mutation	SNP	47836621	47836621	ZNF182	23	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	17630	109
SMC1A	8243	broad.mit.edu	37	X	53439849	53439849	+	Splice_Site	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53439849C>T	uc004dsg.2	-	5	923	c.854_splice	c.e5+1	p.K285_splice	SMC1A_uc011moe.1_Splice_Site_p.K263_splice|SMC1A_uc011mof.1_Intron	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A						cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						CTGCCTCTTACTTGAtctcct	0.264													16	34	---	---	---	---	capture	Splice_Site	SNP	53439849	53439849	SMC1A	23	C	T	T	T	1	0	0	0	0	0	0	1	0	260	20	5	2	14673	109
P2RY10	27334	broad.mit.edu	37	X	78216911	78216911	+	Silent	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78216911C>T	uc004ede.2	+	4	1263	c.894C>T	c.(892-894)TGC>TGT	p.C298C	P2RY10_uc004edf.2_Silent_p.C298C	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	298	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						GTCTCTGCTGCCTTTTGGATC	0.483													141	145	---	---	---	---	capture	Silent	SNP	78216911	78216911	P2RY10	23	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	11251	109
PABPC5	140886	broad.mit.edu	37	X	90690820	90690820	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:90690820G>T	uc004efg.2	+	2	684	c.244G>T	c.(244-246)GAT>TAT	p.D82Y	PABPC5_uc004eff.1_Intron	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	82	RRM 1.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						CATGAATTTTGATTTGATTAA	0.483													5	28	---	---	---	---	capture	Missense_Mutation	SNP	90690820	90690820	PABPC5	23	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	11271	109
PABPC5	140886	broad.mit.edu	37	X	90690988	90690988	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:90690988G>A	uc004efg.2	+	2	852	c.412G>A	c.(412-414)GTA>ATA	p.V138I	PABPC5_uc004eff.1_Intron	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	138	RRM 2.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						CTGCAAAGTCGTATGCGATGA	0.453													34	68	---	---	---	---	capture	Missense_Mutation	SNP	90690988	90690988	PABPC5	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11271	109
BHLHB9	80823	broad.mit.edu	37	X	102005060	102005060	+	Silent	SNP	T	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102005060T>A	uc010nog.2	+	4	1708	c.1137T>A	c.(1135-1137)CCT>CCA	p.P379P	BHLHB9_uc011mrq.1_Silent_p.P379P|BHLHB9_uc011mrr.1_Silent_p.P379P|BHLHB9_uc011mrs.1_Silent_p.P379P|BHLHB9_uc011mrt.1_Silent_p.P379P|BHLHB9_uc004ejo.2_Silent_p.P379P|BHLHB9_uc011mru.1_Silent_p.P379P|BHLHB9_uc011mrv.1_Silent_p.P379P	NM_001142526	NP_001135998	Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class	379						cytoplasm|nucleus	binding			ovary(2)	2						TTCCTTCCCCTGAAATGAGAA	0.378													17	37	---	---	---	---	capture	Silent	SNP	102005060	102005060	BHLHB9	23	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	1408	109
AKAP14	158798	broad.mit.edu	37	X	119048716	119048716	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119048716G>C	uc004ese.2	+	5	454	c.316G>C	c.(316-318)GAC>CAC	p.D106H	AKAP14_uc004esf.2_Intron	NM_178813	NP_848928	Q86UN6	AKA28_HUMAN	A kinase (PRKA) anchor protein 14 isoform a	106						cytoplasm					0						AGAGAGGAAAGACTTAATTCA	0.408													57	114	---	---	---	---	capture	Missense_Mutation	SNP	119048716	119048716	AKAP14	23	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	450	109
DCAF12L2	340578	broad.mit.edu	37	X	125299171	125299171	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125299171C>T	uc004euk.1	-	1	764	c.737G>A	c.(736-738)CGT>CAT	p.R246H		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	246										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						ATCCCTCGGACGGATGTGGGC	0.647													24	28	---	---	---	---	capture	Missense_Mutation	SNP	125299171	125299171	DCAF12L2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4224	109
ZNF449	203523	broad.mit.edu	37	X	134494349	134494349	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134494349C>G	uc004eys.2	+	5	1070	c.905C>G	c.(904-906)TCC>TGC	p.S302C	ZNF449_uc004eyt.2_Missense_Mutation_p.S182C|ZNF449_uc004eyu.2_Missense_Mutation_p.S108C	NM_152695	NP_689908	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	302					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGAGAACTCCAACTTGGAA	0.468													9	68	---	---	---	---	capture	Missense_Mutation	SNP	134494349	134494349	ZNF449	23	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	17799	109
FLNA	2316	broad.mit.edu	37	X	153581222	153581222	+	Silent	SNP	G	A	A			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153581222G>A	uc004fkk.2	-	39	6546	c.6297C>T	c.(6295-6297)GAC>GAT	p.D2099D	FLNA_uc004fki.2_Silent_p.D142D|FLNA_uc011mzn.1_Silent_p.D232D|FLNA_uc010nuu.1_Silent_p.D2091D	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	2099	Filamin 19.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGCACGTCCCGTCCTCCAGGT	0.602													15	50	---	---	---	---	capture	Silent	SNP	153581222	153581222	FLNA	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5877	109
LSMD1	84316	broad.mit.edu	37	17	7760481	7760503	+	Frame_Shift_Del	DEL	CTCAGCCGCCGAGTCCTCGCGCT	-	-			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7760481_7760503delCTCAGCCGCCGAGTCCTCGCGCT	uc002giz.2	-	2	194_216	c.95_117delAGCGCGAGGACTCGGCGGCTGAG	c.(94-117)GAGCGCGAGGACTCGGCGGCTGAGfs	p.E32fs	LSMD1_uc002gja.2_Frame_Shift_Del_p.E80fs|CYB5D1_uc010cnn.1_5'Flank|CYB5D1_uc002gjb.3_5'Flank			Q9BRA0	LSMD1_HUMAN	RecName: Full=LSM domain-containing protein 1; AltName: Full=Phosphonoformate immuno-associated protein 2;	32_39	Potential.					cytoplasm|nucleus				ovary(1)	1		all_cancers(10;0.11)|Prostate(122;0.219)				GTCGGGCGCGCTCAGCCGCCGAGTCCTCGCGCTCTCCGTCCGA	0.682											OREG0024146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	45	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	7760481	7760503	LSMD1	17	CTCAGCCGCCGAGTCCTCGCGCT	-	-	-	1	0	1	0	1	0	0	0	0	363	28	5	5	8977	109
BRIP1	83990	broad.mit.edu	37	17	59761146	59761147	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:59761146_59761147insT	uc002izk.1	-	20	3401_3402	c.3260_3261insA	c.(3259-3261)AATfs	p.N1087fs		NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	1087					DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						GTTCAGAATGATTTTTTCTAGT	0.376			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				8	146	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	59761146	59761147	BRIP1	17	-	T	T	T	1	0	1	1	0	0	0	0	0	154	12	5	5	1502	109
TRAK2	66008	broad.mit.edu	37	2	202272228	202272229	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-06-6694-01	TCGA-06-6694-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202272228_202272229delAG	uc002uyb.3	-	3	629_630	c.183_184delCT	c.(181-186)CTCTTTfs	p.L61fs	TRAK2_uc002uyc.2_Frame_Shift_Del_p.L61fs	NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	61_62						early endosome|plasma membrane	GABA receptor binding				0						TCATATAGAAAGAGAGTGTCTA	0.460													27	33	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	202272228	202272229	TRAK2	2	AG	-	-	-	1	0	1	0	1	0	0	0	0	39	3	5	5	16333	109
