Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NBPF1	55672	broad.mit.edu	37	1	16892156	16892156	+	Silent	SNP	T	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16892156T>C	uc009vos.1	-	28	4149	c.3261A>G	c.(3259-3261)AAA>AAG	p.K1087K	uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	1087	NBPF 7.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AGCCAACATGTTTTTCCTCCA	0.438													8	585	---	---	---	---	capture	Silent	SNP	16892156	16892156	NBPF1	1	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	10099	110
EPHA8	2046	broad.mit.edu	37	1	22924331	22924331	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22924331G>A	uc001bfx.1	+	11	2218	c.2093G>A	c.(2092-2094)CGC>CAC	p.R698H		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	698	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AACATCATCCGCCTCGAGGGT	0.642													35	47	---	---	---	---	capture	Missense_Mutation	SNP	22924331	22924331	EPHA8	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5128	110
ATP1A2	477	broad.mit.edu	37	1	160106465	160106465	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160106465G>A	uc001fvc.2	+	19	2801	c.2669G>A	c.(2668-2670)CGG>CAG	p.R890Q	ATP1A2_uc001fvb.2_Missense_Mutation_p.R890Q|ATP1A2_uc001fvd.2_Missense_Mutation_p.R609Q	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	890	Extracellular (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TGGGATGACCGGACCATGAAT	0.552													4	66	---	---	---	---	capture	Missense_Mutation	SNP	160106465	160106465	ATP1A2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1120	110
SLC26A9	115019	broad.mit.edu	37	1	205897957	205897957	+	Silent	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205897957G>A	uc001hdq.2	-	8	1065	c.951C>T	c.(949-951)CGC>CGT	p.R317R	SLC26A9_uc001hdo.2_5'Flank|SLC26A9_uc001hdp.2_Silent_p.R317R	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a	317						integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GGACTCACCCGCGTTGGATTT	0.577													18	42	---	---	---	---	capture	Silent	SNP	205897957	205897957	SLC26A9	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14416	110
RYR2	6262	broad.mit.edu	37	1	237659969	237659969	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237659969C>A	uc001hyl.1	+	20	2240	c.2120C>A	c.(2119-2121)CCT>CAT	p.P707H		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	707	Cytoplasmic (By similarity).|B30.2/SPRY 1.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTCCCTACCCTGGAGGGGGC	0.507													43	66	---	---	---	---	capture	Missense_Mutation	SNP	237659969	237659969	RYR2	1	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	13661	110
ADARB2	105	broad.mit.edu	37	10	1284235	1284235	+	Silent	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:1284235C>T	uc009xhq.2	-	5	1694	c.1320G>A	c.(1318-1320)GCG>GCA	p.A440A		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	440	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		AGTGCAGGAACGCCCGCCGGG	0.706													7	6	---	---	---	---	capture	Silent	SNP	1284235	1284235	ADARB2	10	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	283	110
C10orf71	118461	broad.mit.edu	37	10	50530623	50530623	+	Silent	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50530623G>A	uc010qgp.1	+	3	372	c.33G>A	c.(31-33)GCG>GCA	p.A11A		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	11											0						GCACAGACGCGTTCAGCGACT	0.542													9	5	---	---	---	---	capture	Silent	SNP	50530623	50530623	C10orf71	10	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1602	110
ANK3	288	broad.mit.edu	37	10	62149275	62149275	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:62149275A>C	uc001jky.2	-	1	214	c.22T>G	c.(22-24)TTA>GTA	p.L8V	ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	8					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TTTTTCTTTAATTGTGAGGCT	0.423													51	25	---	---	---	---	capture	Missense_Mutation	SNP	62149275	62149275	ANK3	10	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	619	110
ECHS1	1892	broad.mit.edu	37	10	135183513	135183513	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135183513C>T	uc001lmu.2	-	3	380	c.309G>A	c.(307-309)ATG>ATA	p.M103I		NM_004092	NP_004083	P30084	ECHM_HUMAN	mitochondrial short-chain enoyl-coenzyme A	103					fatty acid beta-oxidation	mitochondrial matrix	enoyl-CoA hydratase activity|protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		TCAGGTTCTGCATTTCCTTGA	0.517													17	7	---	---	---	---	capture	Missense_Mutation	SNP	135183513	135183513	ECHS1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	4851	110
KBTBD4	55709	broad.mit.edu	37	11	47594600	47594600	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47594600C>G	uc001nfx.2	-	4	1610	c.1439G>C	c.(1438-1440)CGG>CCG	p.R480P	PTPMT1_uc001nfs.3_3'UTR|PTPMT1_uc001nfv.3_3'UTR|PTPMT1_uc009ylt.2_3'UTR|PTPMT1_uc001nfu.3_3'UTR|NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Missense_Mutation_p.R505P|KBTBD4_uc001nfz.2_Missense_Mutation_p.R496P|KBTBD4_uc001nfy.2_Missense_Mutation_p.R480P	NM_016506	NP_057590	Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	480	Kelch 5.									ovary(1)|central_nervous_system(1)	2						ATATCGGTCCCGGAAGACATA	0.527													15	40	---	---	---	---	capture	Missense_Mutation	SNP	47594600	47594600	KBTBD4	11	C	G	G	G	1	0	0	0	0	1	0	0	0	299	23	4	4	7917	110
OR5AR1	219493	broad.mit.edu	37	11	56432005	56432005	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56432005A>G	uc010rjm.1	+	1	844	c.844A>G	c.(844-846)ATC>GTC	p.I282V		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	282	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CACGGTTATCATCCCCATGTT	0.423													3	42	---	---	---	---	capture	Missense_Mutation	SNP	56432005	56432005	OR5AR1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	11049	110
PRSS23	11098	broad.mit.edu	37	11	86519032	86519032	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:86519032G>A	uc001pcb.2	+	2	563	c.347G>A	c.(346-348)CGA>CAA	p.R116Q	PRSS23_uc001pcc.1_Intron|PRSS23_uc010rts.1_Missense_Mutation_p.R84Q	NM_007173	NP_009104	O95084	PRS23_HUMAN	protease, serine, 23 precursor	116					proteolysis	extracellular region|nucleus	serine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCCCAACACCGAGACTCAGGG	0.517													29	43	---	---	---	---	capture	Missense_Mutation	SNP	86519032	86519032	PRSS23	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12515	110
PVRL1	5818	broad.mit.edu	37	11	119510587	119510587	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119510587G>A	uc001pwu.1	-	6	1311	c.1139C>T	c.(1138-1140)ACG>ATG	p.T380M		NM_203285	NP_976030	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 2	Error:Variant_position_missing_in_Q15223_after_alignment					adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		GGCCCCATCCGTCTCCGGTGG	0.622													32	48	---	---	---	---	capture	Missense_Mutation	SNP	119510587	119510587	PVRL1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12734	110
KIRREL3	84623	broad.mit.edu	37	11	126343282	126343282	+	Silent	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:126343282G>A	uc001qea.2	-	5	874	c.513C>T	c.(511-513)CAC>CAT	p.H171H	KIRREL3_uc001qeb.2_Silent_p.H171H|KIRREL3_uc001qec.1_Silent_p.H171H	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1	171	Ig-like C2-type 2.|Extracellular (Potential).				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CATTGTCTGCGTGGCAGGTGA	0.587													10	4	---	---	---	---	capture	Silent	SNP	126343282	126343282	KIRREL3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8248	110
A2M	2	broad.mit.edu	37	12	9230302	9230302	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9230302T>C	uc001qvk.1	-	26	3384	c.3271A>G	c.(3271-3273)ATA>GTA	p.I1091V	A2M_uc001qvj.1_Missense_Mutation_p.I133V|A2M_uc009zgk.1_Missense_Mutation_p.I941V	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1091					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	TTCACCTTTATGGCATTGTTG	0.443													30	44	---	---	---	---	capture	Missense_Mutation	SNP	9230302	9230302	A2M	12	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	4	110
PZP	5858	broad.mit.edu	37	12	9345184	9345184	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9345184G>A	uc001qvl.2	-	12	1435	c.1406C>T	c.(1405-1407)ACG>ATG	p.T469M	PZP_uc009zgl.2_Missense_Mutation_p.T338M	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						GATAGTCTCCGTGTGGCCACA	0.512													37	58	---	---	---	---	capture	Missense_Mutation	SNP	9345184	9345184	PZP	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12764	110
KLRC1	3821	broad.mit.edu	37	12	10600149	10600149	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10600149C>T	uc001qyl.2	-	6	736	c.572G>A	c.(571-573)GGT>GAT	p.G191D	KLRC1_uc009zhm.1_Missense_Mutation_p.G191D|KLRC1_uc001qym.2_Missense_Mutation_p.G173D|KLRC1_uc001qyn.2_Missense_Mutation_p.G191D|KLRC1_uc001qyo.2_Missense_Mutation_p.G173D	NM_002259	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C,	191	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|regulation of immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0						GAAAGCCAAACCATTCATTGT	0.323													32	32	---	---	---	---	capture	Missense_Mutation	SNP	10600149	10600149	KLRC1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8335	110
LRRK2	120892	broad.mit.edu	37	12	40715936	40715936	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40715936A>G	uc001rmg.3	+	36	5391	c.5270A>G	c.(5269-5271)AAT>AGT	p.N1757S	LRRK2_uc009zjw.2_Missense_Mutation_p.N595S|LRRK2_uc001rmi.2_Missense_Mutation_p.N590S	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1757					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GTCTTAGACAATCATCCAGAG	0.353													21	30	---	---	---	---	capture	Missense_Mutation	SNP	40715936	40715936	LRRK2	12	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	8948	110
COL2A1	1280	broad.mit.edu	37	12	48372465	48372465	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48372465G>A	uc001rqu.2	-	42	2991	c.2810C>T	c.(2809-2811)CCC>CTC	p.P937L	COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.P868L	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	937	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	TCGGCCAGGGGGGCCGCTGTC	0.632													20	24	---	---	---	---	capture	Missense_Mutation	SNP	48372465	48372465	COL2A1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	3652	110
PA2G4	5036	broad.mit.edu	37	12	56505022	56505022	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56505022C>T	uc001sjm.2	+	11	1413	c.994C>T	c.(994-996)CGG>TGG	p.R332W	PA2G4_uc009zol.2_Missense_Mutation_p.R332W|PA2G4_uc009zom.2_Intron	NM_006191	NP_006182	Q9UQ80	PA2G4_HUMAN	ErbB3-binding protein 1	332	Necessary for nucleolar localization.				cell cycle arrest|cell proliferation|negative regulation of transcription, DNA-dependent|regulation of translation|rRNA processing	cytoplasm|nucleolus|ribonucleoprotein complex	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding				0			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			TGGCCCCATGCGGATAACCAG	0.438													4	88	---	---	---	---	capture	Missense_Mutation	SNP	56505022	56505022	PA2G4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11265	110
GRIP1	23426	broad.mit.edu	37	12	66788078	66788078	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66788078C>T	uc001stk.2	-	16	2124	c.1883G>A	c.(1882-1884)GGG>GAG	p.G628E	GRIP1_uc010sta.1_Missense_Mutation_p.G572E|GRIP1_uc001stj.2_Missense_Mutation_p.G410E|GRIP1_uc001stl.1_Missense_Mutation_p.G520E|GRIP1_uc001stm.2_Missense_Mutation_p.G628E	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	680	PDZ 6.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		AAGGGGCCCCCCGTAGCGTTT	0.413													34	18	---	---	---	---	capture	Missense_Mutation	SNP	66788078	66788078	GRIP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6720	110
COL4A1	1282	broad.mit.edu	37	13	110819539	110819539	+	Silent	SNP	A	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:110819539A>C	uc001vqw.3	-	44	4037	c.3915T>G	c.(3913-3915)GGT>GGG	p.G1305G	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	1305	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCCCCATATCACCCTTAGAGC	0.507													6	177	---	---	---	---	capture	Silent	SNP	110819539	110819539	COL4A1	13	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	3654	110
AHNAK2	113146	broad.mit.edu	37	14	105409917	105409917	+	Silent	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105409917G>A	uc010axc.1	-	7	11991	c.11871C>T	c.(11869-11871)GCC>GCT	p.A3957A	AHNAK2_uc001ypx.2_Silent_p.A3857A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3957						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTCCTTGTCGGCCAGGGACA	0.622													113	198	---	---	---	---	capture	Silent	SNP	105409917	105409917	AHNAK2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	415	110
AXIN1	8312	broad.mit.edu	37	16	347056	347056	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:347056C>G	uc002cgp.1	-	7	2132	c.1955G>C	c.(1954-1956)GGG>GCG	p.G652A	AXIN1_uc002cgq.1_Missense_Mutation_p.G652A	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a	652	Interaction with RNF111.|Interaction with PPP2CA.				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GGGTGCTCACCCGTGGCCGGT	0.627													46	92	---	---	---	---	capture	Missense_Mutation	SNP	347056	347056	AXIN1	16	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	1226	110
ERCC4	2072	broad.mit.edu	37	16	14041971	14041971	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:14041971G>A	uc002dce.2	+	11	2527	c.2518G>A	c.(2518-2520)GAG>AAG	p.E840K	ERCC4_uc010uyz.1_Missense_Mutation_p.E390K	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	840	Interaction with EME1 and ERCC1.				double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						AACCCTTCCCGAGTCAGAGAA	0.498			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				21	20	---	---	---	---	capture	Missense_Mutation	SNP	14041971	14041971	ERCC4	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5170	110
PLCG2	5336	broad.mit.edu	37	16	81953271	81953271	+	Splice_Site	SNP	T	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81953271T>A	uc002fgt.2	+	20	2387	c.2235_splice	c.e20+2	p.M745_splice	PLCG2_uc010chg.1_Splice_Site_p.M745_splice	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TACAATATGGTAGGTGGTGGA	0.418													14	29	---	---	---	---	capture	Splice_Site	SNP	81953271	81953271	PLCG2	16	T	A	A	A	1	0	0	0	0	0	0	1	0	741	57	5	4	11939	110
ANKRD11	29123	broad.mit.edu	37	16	89347130	89347130	+	Silent	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89347130G>A	uc002fmx.1	-	9	6281	c.5820C>T	c.(5818-5820)AGC>AGT	p.S1940S	ANKRD11_uc002fmy.1_Silent_p.S1940S|ANKRD11_uc002fnc.1_Silent_p.S1940S|ANKRD11_uc002fna.1_5'Flank|ANKRD11_uc002fnb.1_Silent_p.S1897S	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1940	Pro-rich.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGATGACGGCGCTGAAGGGAC	0.692													23	33	---	---	---	---	capture	Silent	SNP	89347130	89347130	ANKRD11	16	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	636	110
OR3A2	4995	broad.mit.edu	37	17	3181517	3181517	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3181517C>T	uc002fvg.2	-	1	752	c.713G>A	c.(712-714)CGT>CAT	p.R238H		NM_002551	NP_002542	P47893	OR3A2_HUMAN	olfactory receptor, family 3, subfamily A,	238	Cytoplasmic (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						CTCCACTGAACGGATTCGTAG	0.527													25	33	---	---	---	---	capture	Missense_Mutation	SNP	3181517	3181517	OR3A2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10942	110
C19orf35	374872	broad.mit.edu	37	19	2278840	2278840	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2278840C>T	uc002lvn.2	-	3	455	c.355G>A	c.(355-357)GCC>ACC	p.A119T	SPPL2B_uc010dsw.1_Intron	NM_198532	NP_940934	Q6ZS72	CS035_HUMAN	hypothetical protein LOC374872	119										pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCAGTGGGGCGTCAGCCGGG	0.677													3	13	---	---	---	---	capture	Missense_Mutation	SNP	2278840	2278840	C19orf35	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1903	110
TNFSF9	8744	broad.mit.edu	37	19	6535006	6535006	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6535006G>A	uc002mfh.2	+	3	732	c.694G>A	c.(694-696)GCC>ACC	p.A232T		NM_003811	NP_003802	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily,	232	Extracellular (Potential).				apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						TACCCAGGGCGCCACAGTCTT	0.662													14	29	---	---	---	---	capture	Missense_Mutation	SNP	6535006	6535006	TNFSF9	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16195	110
TNPO2	30000	broad.mit.edu	37	19	12813636	12813636	+	Splice_Site	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12813636C>T	uc002muo.2	-	20	2490	c.2305_splice	c.e20+1	p.G769_splice	TNPO2_uc002mup.2_Splice_Site_p.A861_splice|TNPO2_uc002muq.2_Splice_Site_p.A769_splice|TNPO2_uc002mur.2_Splice_Site_p.A769_splice	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)						intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						CAGGTGCCCACCTGTGTTTTC	0.582													62	141	---	---	---	---	capture	Splice_Site	SNP	12813636	12813636	TNPO2	19	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	16219	110
KIR3DL1	3811	broad.mit.edu	37	19	55327961	55327961	+	Silent	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55327961G>A	uc002qhk.3	+	1	69	c.6G>A	c.(4-6)TCG>TCA	p.S2S	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_5'UTR|KIR3DL1_uc010esf.2_Silent_p.S2S|KIR3DL1_uc010yfo.1_5'UTR|KIR3DL1_uc002qhl.3_Silent_p.S2S	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	2					immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		GCACCATGTCGCTCATGGTCG	0.597											OREG0003676	type=REGULATORY REGION|Gene=KIR3DL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	25	28	---	---	---	---	capture	Silent	SNP	55327961	55327961	KIR3DL1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8242	110
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													4	15	---	---	---	---	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	110
EPAS1	2034	broad.mit.edu	37	2	46608818	46608818	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:46608818G>A	uc002ruv.2	+	13	2617	c.2129G>A	c.(2128-2130)CGA>CAA	p.R710Q	EPAS1_uc002ruw.2_Missense_Mutation_p.R176Q	NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	710					angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			AAGCTGAAGCGACAGCTGGAG	0.617													17	21	---	---	---	---	capture	Missense_Mutation	SNP	46608818	46608818	EPAS1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5105	110
GKN1	56287	broad.mit.edu	37	2	69207132	69207132	+	Missense_Mutation	SNP	G	A	A	rs145566771		TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:69207132G>A	uc002sfc.2	+	5	508	c.445G>A	c.(445-447)GGA>AGA	p.G149R		NM_019617	NP_062563	Q9NS71	GKN1_HUMAN	18 kDa antrum mucosa protein precursor	149	BRICHOS.				digestion|positive regulation of cell division	extracellular region				breast(1)	1						GAGCAAGTTCGGAAAAAACAT	0.507													32	31	---	---	---	---	capture	Missense_Mutation	SNP	69207132	69207132	GKN1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6360	110
YSK4	80122	broad.mit.edu	37	2	135745418	135745418	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135745418G>A	uc002tue.1	-	7	1055	c.1024C>T	c.(1024-1026)CCT>TCT	p.P342S	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Missense_Mutation_p.P229S|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Missense_Mutation_p.P70S|YSK4_uc002tui.3_Missense_Mutation_p.P359S	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	342							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		CTAACTGCAGGAATATTGCCT	0.368													20	22	---	---	---	---	capture	Missense_Mutation	SNP	135745418	135745418	YSK4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	17376	110
RAPGEF4	11069	broad.mit.edu	37	2	173866027	173866027	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:173866027G>C	uc002uhv.3	+	17	1800	c.1613G>C	c.(1612-1614)TGT>TCT	p.C538S	RAPGEF4_uc002uhw.3_Missense_Mutation_p.C394S|RAPGEF4_uc010zec.1_Missense_Mutation_p.C385S|RAPGEF4_uc010zed.1_Missense_Mutation_p.C367S|RAPGEF4_uc010zee.1_Missense_Mutation_p.C385S|RAPGEF4_uc010fqo.2_Missense_Mutation_p.C367S|RAPGEF4_uc010zef.1_Missense_Mutation_p.C318S|RAPGEF4_uc010zeg.1_Missense_Mutation_p.C365S|RAPGEF4_uc010zeh.1_Missense_Mutation_p.C318S	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	538	N-terminal Ras-GEF.				blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			ATGATGCACTGTGTTTTTATG	0.398													34	59	---	---	---	---	capture	Missense_Mutation	SNP	173866027	173866027	RAPGEF4	2	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	12941	110
HCK	3055	broad.mit.edu	37	20	30674579	30674579	+	Silent	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30674579C>T	uc002wxh.2	+	9	1155	c.984C>T	c.(982-984)CCC>CCT	p.P328P	HCK_uc010gdy.2_Silent_p.P307P|HCK_uc002wxi.2_Silent_p.P306P	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	328	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCAAGGAGCCCATCTACATCA	0.587													31	62	---	---	---	---	capture	Silent	SNP	30674579	30674579	HCK	20	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	6920	110
PLUNC	51297	broad.mit.edu	37	20	31829275	31829275	+	Silent	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31829275C>T	uc002wyv.2	+	6	736	c.666C>T	c.(664-666)AAC>AAT	p.N222N	PLUNC_uc002wyt.3_Silent_p.N222N|PLUNC_uc002wyu.3_Silent_p.N222N	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated	222					innate immune response	extracellular region	lipid binding				0						TTCAGGGCAACGTAAGTAGGC	0.502													26	219	---	---	---	---	capture	Silent	SNP	31829275	31829275	PLUNC	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12018	110
DUSP18	150290	broad.mit.edu	37	22	31059768	31059768	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31059768G>A	uc003aiu.2	-	2	724	c.223C>T	c.(223-225)CCT>TCT	p.P75S	SLC35E4_uc003ait.2_Intron|DUSP18_uc010gwa.1_Intron|DUSP18_uc003aiw.1_Missense_Mutation_p.P75S	NM_152511	NP_689724	Q8NEJ0	DUS18_HUMAN	dual specificity phosphatase 18	75						cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0						CGTGAGTTAGGGGAGTCAGCC	0.507													52	69	---	---	---	---	capture	Missense_Mutation	SNP	31059768	31059768	DUSP18	22	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4772	110
CYP2D6	1565	broad.mit.edu	37	22	42525154	42525154	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42525154C>T	uc003bce.2	-	3	476	c.386G>A	c.(385-387)CGC>CAC	p.R129H	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Intron|CYP2D6_uc003bcf.2_Intron	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	129							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						CCTCTGCTCGCGCCACGCGGG	0.687													3	34	---	---	---	---	capture	Missense_Mutation	SNP	42525154	42525154	CYP2D6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4129	110
MOV10L1	54456	broad.mit.edu	37	22	50581577	50581577	+	Missense_Mutation	SNP	G	A	A	rs140536899		TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50581577G>A	uc003bjj.2	+	17	2368	c.2285G>A	c.(2284-2286)CGT>CAT	p.R762H	MOV10L1_uc003bjk.3_Missense_Mutation_p.R762H|MOV10L1_uc011arp.1_Missense_Mutation_p.R742H|MOV10L1_uc011arq.1_Missense_Mutation_p.R523H	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	762					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GGTGACTGCCGTCCCCTCCCG	0.468													5	152	---	---	---	---	capture	Missense_Mutation	SNP	50581577	50581577	MOV10L1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9631	110
GRIP2	80852	broad.mit.edu	37	3	14555293	14555293	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14555293G>A	uc011avi.1	-	14	1813	c.1813C>T	c.(1813-1815)CGT>TGT	p.R605C	GRIP2_uc010heh.2_RNA|GRIP2_uc011avh.1_Missense_Mutation_p.R136C	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	507	PDZ 4.				synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						GACAGGACACGGTCCCCCACC	0.647													4	11	---	---	---	---	capture	Missense_Mutation	SNP	14555293	14555293	GRIP2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6721	110
SCN5A	6331	broad.mit.edu	37	3	38645338	38645338	+	Silent	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38645338G>A	uc003cio.2	-	12	1949	c.1755C>T	c.(1753-1755)CAC>CAT	p.H585H	SCN5A_uc003cin.2_Silent_p.H585H|SCN5A_uc003cil.3_Silent_p.H585H|SCN5A_uc010hhi.2_Silent_p.H585H|SCN5A_uc010hhk.2_Silent_p.H585H|SCN5A_uc011ayr.1_Silent_p.H585H|SCN5A_uc010hhj.1_Silent_p.H196H	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	585					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	CATGGAGGGCGTGGCCAGGAG	0.662													52	83	---	---	---	---	capture	Silent	SNP	38645338	38645338	SCN5A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13815	110
CADPS	8618	broad.mit.edu	37	3	62423805	62423805	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:62423805C>T	uc003dll.2	-	28	4111	c.3751G>A	c.(3751-3753)GAG>AAG	p.E1251K	CADPS_uc003dlj.1_Missense_Mutation_p.E206K|CADPS_uc003dlk.1_Missense_Mutation_p.E699K|CADPS_uc003dlm.2_Missense_Mutation_p.E1212K|CADPS_uc003dln.2_Missense_Mutation_p.E1172K	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1251	Mediates targeting and association with DCVs (By similarity).				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ATGTACATCTCCTCATTGACC	0.458													22	46	---	---	---	---	capture	Missense_Mutation	SNP	62423805	62423805	CADPS	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2546	110
ADCY5	111	broad.mit.edu	37	3	123008753	123008753	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123008753C>T	uc003egh.1	-	19	3376	c.3376G>A	c.(3376-3378)GGC>AGC	p.G1126S	ADCY5_uc003egg.1_Missense_Mutation_p.G784S	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	1126	Cytoplasmic (Potential).|Guanylate cyclase 2.				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		TAGGTGCTGCCGATGGTCTTG	0.592													22	26	---	---	---	---	capture	Missense_Mutation	SNP	123008753	123008753	ADCY5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	297	110
LRPAP1	4043	broad.mit.edu	37	4	3534104	3534104	+	Silent	SNP	C	G	G			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3534104C>G	uc003ghi.2	-	1	121	c.36G>C	c.(34-36)GGG>GGC	p.G12G		NM_002337	NP_002328	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein	12					negative regulation of protein binding|negative regulation of very-low-density lipoprotein particle clearance|protein folding|vesicle-mediated transport	cell surface|integral to membrane|plasma membrane	asialoglycoprotein receptor activity|heparin binding|low-density lipoprotein particle receptor binding|receptor antagonist activity|unfolded protein binding|very-low-density lipoprotein particle receptor binding			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		GCGCCGGGAGCCCGCGCAGAA	0.706													3	8	---	---	---	---	capture	Silent	SNP	3534104	3534104	LRPAP1	4	C	G	G	G	1	0	0	0	0	0	0	0	1	327	26	4	4	8880	110
OTOP1	133060	broad.mit.edu	37	4	4190625	4190625	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:4190625G>T	uc003ghp.1	-	6	1774	c.1744C>A	c.(1744-1746)CCC>ACC	p.P582T		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	582	Helical; (Potential).				biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATTATCCAGGGTTCAAAGCCA	0.463													11	81	---	---	---	---	capture	Missense_Mutation	SNP	4190625	4190625	OTOP1	4	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11209	110
ARHGAP10	79658	broad.mit.edu	37	4	148944421	148944421	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:148944421G>A	uc003ilf.2	+	19	1724	c.1724G>A	c.(1723-1725)CGG>CAG	p.R575Q	ARHGAP10_uc003ilg.2_Missense_Mutation_p.R224Q|ARHGAP10_uc003ilh.2_Missense_Mutation_p.R156Q|ARHGAP10_uc003ili.2_Missense_Mutation_p.R8Q	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10	575					apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		AAGATTTTTCGGACGCCGCCC	0.488													32	51	---	---	---	---	capture	Missense_Mutation	SNP	148944421	148944421	ARHGAP10	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	855	110
PRR16	51334	broad.mit.edu	37	5	120021674	120021674	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:120021674C>A	uc003ksq.2	+	2	348	c.185C>A	c.(184-186)ACC>AAC	p.T62N	PRR16_uc003ksp.2_Missense_Mutation_p.T39N|PRR16_uc003ksr.2_5'UTR	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	62	Potential.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		GACACCCTGACCTCTGACCTA	0.443													37	42	---	---	---	---	capture	Missense_Mutation	SNP	120021674	120021674	PRR16	5	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	12485	110
MATR3	9782	broad.mit.edu	37	5	138658286	138658286	+	Splice_Site	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:138658286G>A	uc003ldu.2	+	15	2206	c.1779_splice	c.e15-1	p.R593_splice	MATR3_uc010jfb.2_Splice_Site_p.R593_splice|MATR3_uc003ldt.2_Splice_Site_p.R255_splice|MATR3_uc003ldw.2_Splice_Site_p.R593_splice|MATR3_uc003ldx.2_Splice_Site_p.R593_splice|MATR3_uc010jfc.2_Splice_Site_p.R593_splice|MATR3_uc003ldy.2_Splice_Site_p.R270_splice|MATR3_uc011czb.1_Splice_Site_p.R305_splice|MATR3_uc003ldz.2_Splice_Site_p.R593_splice|MATR3_uc003lea.2_Splice_Site_p.R593_splice|MATR3_uc003leb.2_Splice_Site_p.R255_splice|MATR3_uc003lec.2_Splice_Site_p.R270_splice	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTTGATTTCAGAAAAAGATCT	0.338													17	15	---	---	---	---	capture	Splice_Site	SNP	138658286	138658286	MATR3	5	G	A	A	A	1	0	0	0	0	0	0	1	0	429	33	5	2	9250	110
ARSI	340075	broad.mit.edu	37	5	149677472	149677472	+	Missense_Mutation	SNP	G	A	A	rs149628658	byFrequency	TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149677472G>A	uc003lrv.2	-	2	1604	c.1015C>T	c.(1015-1017)CGG>TGG	p.R339W		NM_001012301	NP_001012301	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I precursor	339						endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGGCTTGTCCGTTGCTTTCGC	0.627													24	30	---	---	---	---	capture	Missense_Mutation	SNP	149677472	149677472	ARSI	5	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	987	110
FLT4	2324	broad.mit.edu	37	5	180041121	180041121	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180041121G>A	uc003mma.3	-	24	3357	c.3278C>T	c.(3277-3279)ACG>ATG	p.T1093M	FLT4_uc003mlz.3_Missense_Mutation_p.T1093M	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	1093	Cytoplasmic (Potential).|Protein kinase.				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	GTCACTCTGCGTGGTGTACAC	0.622									Congenital_Hereditary_Lymphedema				32	70	---	---	---	---	capture	Missense_Mutation	SNP	180041121	180041121	FLT4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5888	110
DNAH8	1769	broad.mit.edu	37	6	38704949	38704949	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38704949G>T	uc003ooe.1	+	4	818	c.218G>T	c.(217-219)GGT>GTT	p.G73V		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AACAACTGGGGTGCTTTAAAC	0.353													31	40	---	---	---	---	capture	Missense_Mutation	SNP	38704949	38704949	DNAH8	6	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	4563	110
PKHD1	5314	broad.mit.edu	37	6	51900449	51900449	+	Silent	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51900449C>T	uc003pah.1	-	28	3444	c.3168G>A	c.(3166-3168)TCG>TCA	p.S1056S	PKHD1_uc003pai.2_Silent_p.S1056S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1056	IPT/TIG 5.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGATGGCACACGAGTAAGATC	0.453													56	99	---	---	---	---	capture	Silent	SNP	51900449	51900449	PKHD1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11874	110
KHDRBS2	202559	broad.mit.edu	37	6	62604661	62604661	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:62604661C>T	uc003peg.2	-	6	936	c.689G>A	c.(688-690)CGT>CAT	p.R230H		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	230	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		AAGCGCTCCACGGGTTACAGT	0.627													24	31	---	---	---	---	capture	Missense_Mutation	SNP	62604661	62604661	KHDRBS2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8069	110
BCKDHB	594	broad.mit.edu	37	6	80881059	80881059	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:80881059A>G	uc003pjd.2	+	6	761	c.694A>G	c.(694-696)AAA>GAA	p.K232E	BCKDHB_uc003pje.2_Missense_Mutation_p.K232E	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta	232					branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		CATAGAGGATAAAAATCCTTG	0.294													24	29	---	---	---	---	capture	Missense_Mutation	SNP	80881059	80881059	BCKDHB	6	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	1349	110
AIM1	202	broad.mit.edu	37	6	106999811	106999811	+	Silent	SNP	A	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:106999811A>T	uc003prh.2	+	12	4660	c.4173A>T	c.(4171-4173)GGA>GGT	p.G1391G	AIM1_uc003pri.2_Silent_p.G195G	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1391	Beta/gamma crystallin 'Greek key' 8.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AGGACTGGGGAGGCAAAAATT	0.338													62	91	---	---	---	---	capture	Silent	SNP	106999811	106999811	AIM1	6	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	430	110
C7orf36	57002	broad.mit.edu	37	7	39612016	39612016	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:39612016T>C	uc003thc.3	+	3	401	c.392T>C	c.(391-393)GTA>GCA	p.V131A		NM_020192	NP_064577	Q9NRH1	CG036_HUMAN	hypothetical protein LOC57002	131											0						TCCCATGTTGTAGATTTATTG	0.373													52	84	---	---	---	---	capture	Missense_Mutation	SNP	39612016	39612016	C7orf36	7	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	2367	110
SPDYE1	285955	broad.mit.edu	37	7	44046879	44046879	+	Silent	SNP	T	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44046879T>C	uc003tjf.2	+	5	781	c.645T>C	c.(643-645)AAT>AAC	p.N215N	POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron|POLR2J4_uc010kxw.2_Intron|POLR2J4_uc003tje.3_Intron|uc003tjg.1_RNA	NM_175064	NP_778234	Q8NFV5	SPDE1_HUMAN	Williams Beuren syndrome chromosome region 19	215										ovary(1)	1						ACCTGGCCAATGACATGGAGG	0.567													79	201	---	---	---	---	capture	Silent	SNP	44046879	44046879	SPDYE1	7	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	14921	110
CLDN4	1364	broad.mit.edu	37	7	73245947	73245947	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73245947C>T	uc003tzi.3	+	1	755	c.416C>T	c.(415-417)ACG>ATG	p.T139M	RFC2_uc011kfa.1_Intron|CLDN4_uc003tzh.1_RNA	NM_001305	NP_001296	O14493	CLD4_HUMAN	claudin 4	139	Extracellular (Potential).				calcium-independent cell-cell adhesion	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity|transmembrane receptor activity				0		Lung NSC(55;0.159)				GTGTCCTGGACGGCCCACAAC	0.632													20	42	---	---	---	---	capture	Missense_Mutation	SNP	73245947	73245947	CLDN4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3452	110
SAMD9	54809	broad.mit.edu	37	7	92733004	92733004	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92733004C>T	uc003umf.2	-	3	2663	c.2407G>A	c.(2407-2409)GAA>AAA	p.E803K	SAMD9_uc003umg.2_Missense_Mutation_p.E803K	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	803						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TTATCTTGTTCTTCAAAATCA	0.353													38	86	---	---	---	---	capture	Missense_Mutation	SNP	92733004	92733004	SAMD9	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	13718	110
GIMAP4	55303	broad.mit.edu	37	7	150269429	150269429	+	Missense_Mutation	SNP	G	A	A	rs137872040		TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150269429G>A	uc003whl.2	+	3	353	c.271G>A	c.(271-273)GAC>AAC	p.D91N	GIMAP4_uc011kuu.1_Intron|GIMAP4_uc011kuv.1_Missense_Mutation_p.D105N	NM_018326	NP_060796	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	91							GTP binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGGCATTTTCGACACAGAGGT	0.507													19	65	---	---	---	---	capture	Missense_Mutation	SNP	150269429	150269429	GIMAP4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6320	110
EPPK1	83481	broad.mit.edu	37	8	144940800	144940800	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144940800G>C	uc003zaa.1	-	1	6635	c.6622C>G	c.(6622-6624)CAA>GAA	p.Q2208E		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	2208						cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ATGAGCTCTTGCGTCGTGCTC	0.622													46	86	---	---	---	---	capture	Missense_Mutation	SNP	144940800	144940800	EPPK1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	5145	110
FAM75C1	441452	broad.mit.edu	37	9	90536103	90536103	+	Silent	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90536103C>T	uc010mqi.2	+	4	1310	c.1281C>T	c.(1279-1281)GAC>GAT	p.D427D	FAM75C1_uc004apq.3_Silent_p.D410D	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						AATCTCAGGACGTCTTTAGTG	0.493													8	180	---	---	---	---	capture	Silent	SNP	90536103	90536103	FAM75C1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5569	110
GFI1B	8328	broad.mit.edu	37	9	135866288	135866288	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135866288G>A	uc004ccg.2	+	7	995	c.844G>A	c.(844-846)GGA>AGA	p.G282R	GFI1B_uc010mzy.2_Missense_Mutation_p.G236R	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	282	C2H2-type 5.|Mediates interaction with GATA1.|Interaction with ARIH2.				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		CCAGGTGTGCGGAAAGGCCTT	0.647													11	32	---	---	---	---	capture	Missense_Mutation	SNP	135866288	135866288	GFI1B	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6280	110
COL5A1	1289	broad.mit.edu	37	9	137623480	137623480	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137623480C>T	uc004cfe.2	+	8	1685	c.1303C>T	c.(1303-1305)CCG>TCG	p.P435S		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	435	Nonhelical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GCCGGGAATGCCGGCGAACCA	0.572													4	128	---	---	---	---	capture	Missense_Mutation	SNP	137623480	137623480	COL5A1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3661	110
IL13RA2	3598	broad.mit.edu	37	X	114249014	114249014	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:114249014C>T	uc004epx.2	-	4	495	c.370G>A	c.(370-372)GCA>ACA	p.A124T	IL13RA2_uc010nqd.1_Missense_Mutation_p.A124T	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor	124	Extracellular (Potential).|Fibronectin type-III 1.					extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						GTAGTTTCTGCCCAGGAACTT	0.363													46	11	---	---	---	---	capture	Missense_Mutation	SNP	114249014	114249014	IL13RA2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7553	110
WNT1	7471	broad.mit.edu	37	12	49374347	49374348	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49374347_49374348insG	uc001rsu.2	+	3	697_698	c.499_500insG	c.(499-501)TGGfs	p.W167fs		NM_005430	NP_005421	P04628	WNT1_HUMAN	wingless-type MMTV integration site family,	167					brain segmentation|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|central nervous system morphogenesis|cerebellum formation|dermatome development|diencephalon development|embryonic axis specification|forebrain anterior/posterior pattern formation|fourth ventricle development|hemopoietic stem cell proliferation|hepatocyte differentiation|inner ear morphogenesis|mesoderm morphogenesis|midbrain development|midbrain-hindbrain boundary maturation during brain development|negative regulation of cell-cell adhesion|negative regulation of cell-substrate adhesion|negative regulation of DNA damage checkpoint|negative regulation of fat cell differentiation|neuron fate determination|positive regulation of fibroblast proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of lamellipodium assembly|positive regulation of Notch signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to wounding|signal transduction in response to DNA damage|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled-2 binding|transcription regulatory region DNA binding			kidney(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.244)		cgACTGGCACTGGGGGGGCTGC	0.554													9	16	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	49374347	49374348	WNT1	12	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	17262	110
SLC24A1	9187	broad.mit.edu	37	15	65918177	65918179	+	In_Frame_Del	DEL	CTG	-	-			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65918177_65918179delCTG	uc010ujf.1	+	2	2046_2048	c.1759_1761delCTG	c.(1759-1761)CTGdel	p.L591del	SLC24A1_uc010ujd.1_In_Frame_Del_p.L591del|SLC24A1_uc010uje.1_In_Frame_Del_p.L591del|SLC24A1_uc010ujg.1_In_Frame_Del_p.L591del|SLC24A1_uc010ujh.1_In_Frame_Del_p.L591del	NM_004727	NP_004718	O60721	NCKX1_HUMAN	solute carrier family 24	591	Helical; (Potential).				response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0						GTGGGAGAGCCTGCTGCTGCTGC	0.547													8	139	---	---	---	---	capture_indel	In_Frame_Del	DEL	65918177	65918179	SLC24A1	15	CTG	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	14357	110
LRRK1	79705	broad.mit.edu	37	15	101464858	101464859	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101464858_101464859insC	uc002bwr.2	+	2	340_341	c.21_22insC	c.(19-24)AGACCCfs	p.R7fs	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bwq.1_Frame_Shift_Ins_p.R7fs	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	7_8					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGTCGCAAAGACCCCCCAGCAT	0.594													33	32	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	101464858	101464859	LRRK1	15	-	C	C	C	1	0	1	1	0	0	0	0	0	128	10	5	5	8947	110
PIK3R1	5295	broad.mit.edu	37	5	67589149	67589151	+	In_Frame_Del	DEL	ATT	-	-			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589149_67589151delATT	uc003jva.2	+	10	1697_1699	c.1137_1139delATT	c.(1135-1140)AAATTA>AAA	p.L380del	PIK3R1_uc003jvb.2_In_Frame_Del_p.L380del|PIK3R1_uc003jvc.2_In_Frame_Del_p.L80del|PIK3R1_uc003jvd.2_In_Frame_Del_p.L110del|PIK3R1_uc003jve.2_In_Frame_Del_p.L59del|PIK3R1_uc011crb.1_In_Frame_Del_p.L50del	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	380	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.L380del(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GAAATAACAAATTAATCAAAATA	0.305			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			35	58	---	---	---	---	capture_indel	In_Frame_Del	DEL	67589149	67589151	PIK3R1	5	ATT	-	-	-	1	0	1	0	1	0	0	0	0	50	4	5	5	11821	110
EGFR	1956	broad.mit.edu	37	7	55249017	55249018	+	In_Frame_Ins	INS	-	CCACGT	CCACGT			TCGA-06-6695-01	TCGA-06-6695-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55249017_55249018insCCACGT	uc003tqk.2	+	20	2561_2562	c.2315_2316insCCACGT	c.(2314-2316)CCC>CCCCACGTC	p.774_775insHV	EGFR_uc010kzg.1_In_Frame_Ins_p.729_730insHV|EGFR_uc011kco.1_In_Frame_Ins_p.721_722insHV|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	774_775	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.H773_V774insNPH(12)|p.V774_C775insHV(4)|p.H773_V774insPH(3)|p.H773_V774insH(3)|p.V774M(3)|p.P772_H773insX(2)|p.N771_P772>SVDNR(1)|p.P772_H773insTHP(1)|p.H773_V774insGH(1)|p.H773_V774insG(1)|p.H773_V774insGNPH(1)|p.H773>NPY(1)|p.H773_V774>LM(1)|p.V774L(1)|p.P772P(1)|p.V774del(1)|p.D770_P772>ASVDNR(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGGACAACCCCCACGTGTGCC	0.644		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			15	153	---	---	---	---	capture_indel	In_Frame_Ins	INS	55249017	55249018	EGFR	7	-	CCACGT	CCACGT	CCACGT	1	0	1	1	0	0	0	0	0	286	22	5	5	4922	110
