Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CDCP2	200008	broad.mit.edu	37	1	54605749	54605749	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:54605749C>A	uc001cwv.1	-	4	1642	c.794G>T	c.(793-795)CGG>CTG	p.R265L		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	265	CUB 3.					extracellular region				ovary(1)	1						GAAGTTGCCCCGCATGGCCAT	0.602													3	54	---	---	---	---	capture	Missense_Mutation	SNP	54605749	54605749	CDCP2	1	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	3065	113
NBPF10	100132406	broad.mit.edu	37	1	145324371	145324371	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145324371T>C	uc001end.3	+	30	3826	c.3791T>C	c.(3790-3792)GTA>GCA	p.V1264A	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_RNA	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	1189											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTGCTGGAGGTAGTAGCGCCT	0.498													3	7	---	---	---	---	capture	Missense_Mutation	SNP	145324371	145324371	NBPF10	1	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10100	113
GPR137B	7107	broad.mit.edu	37	1	236343286	236343286	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236343286C>T	uc001hxq.2	+	4	886	c.795C>T	c.(793-795)AGC>AGT	p.S265S	GPR137B_uc001hxr.1_Silent_p.S47S|GPR137B_uc009xge.2_RNA	NM_003272	NP_003263	O60478	G137B_HUMAN	G protein-coupled receptor 137B	265	Extracellular (Potential).					integral to plasma membrane|membrane fraction					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			AGAACAAGAGCGTCCATTCCT	0.473													79	62	---	---	---	---	capture	Silent	SNP	236343286	236343286	GPR137B	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	6580	113
DTX4	23220	broad.mit.edu	37	11	58949764	58949764	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58949764C>T	uc001nns.2	+	2	1021	c.764C>T	c.(763-765)TCG>TTG	p.S255L	DTX4_uc001nnr.2_Missense_Mutation_p.S149L	NM_015177	NP_055992	Q9Y2E6	DTX4_HUMAN	deltex 4 homolog	255					Notch signaling pathway	cytoplasm	zinc ion binding			lung(2)|central_nervous_system(1)	3		all_epithelial(135;0.125)				ACCGCCCCATCGCAGGTGATC	0.657													15	25	---	---	---	---	capture	Missense_Mutation	SNP	58949764	58949764	DTX4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4752	113
MMP13	4322	broad.mit.edu	37	11	102826186	102826186	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102826186C>T	uc001phl.2	-	2	185	c.157G>A	c.(157-159)GCG>ACG	p.A53T		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	53					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		AGGATTCCCGCGAGATTTGTA	0.458													63	92	---	---	---	---	capture	Missense_Mutation	SNP	102826186	102826186	MMP13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9564	113
IL23A	51561	broad.mit.edu	37	12	56733735	56733735	+	Silent	SNP	T	C	C			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56733735T>C	uc001sla.2	+	4	583	c.417T>C	c.(415-417)GGT>GGC	p.G139G		NM_016584	NP_057668	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19 precursor	139					defense response to Gram-negative bacterium|inflammatory response|innate immune response|negative regulation of interleukin-10 production|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to virus|tissue remodeling	interleukin-23 complex	cytokine activity				0						AGCCTGAGGGTCACCACTGGG	0.572													63	80	---	---	---	---	capture	Silent	SNP	56733735	56733735	IL23A	12	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	7598	113
CUX2	23316	broad.mit.edu	37	12	111785603	111785603	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111785603G>A	uc001tsa.1	+	22	4088	c.3935G>A	c.(3934-3936)GGC>GAC	p.G1312D		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	1312						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						GAAGAGGCAGGCAGCCAGCCC	0.612													34	33	---	---	---	---	capture	Missense_Mutation	SNP	111785603	111785603	CUX2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4025	113
FAM124A	220108	broad.mit.edu	37	13	51825704	51825704	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:51825704C>T	uc001vfg.1	+	3	332	c.201C>T	c.(199-201)AAC>AAT	p.N67N	FAM124A_uc001vfe.2_Silent_p.N67N|FAM124A_uc001vff.1_Silent_p.N103N	NM_145019	NP_659456	Q86V42	F124A_HUMAN	hypothetical protein LOC220108	67										central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		CCATCGACAACGTCCTGGCGT	0.687													12	26	---	---	---	---	capture	Silent	SNP	51825704	51825704	FAM124A	13	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5379	113
MAX	4149	broad.mit.edu	37	14	65569050	65569050	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65569050T>A	uc001xif.1	-	1	178	c.8A>T	c.(7-9)GAT>GTT	p.D3V	MAX_uc001xic.1_Missense_Mutation_p.D3V|MAX_uc001xie.1_Missense_Mutation_p.D3V|MAX_uc010aql.1_Missense_Mutation_p.D3V|MAX_uc001xig.1_Missense_Mutation_p.D3V|MAX_uc001xih.1_RNA|MAX_uc001xii.1_Missense_Mutation_p.D3V|MAX_uc001xij.1_Missense_Mutation_p.D3V|MAX_uc001xik.2_Missense_Mutation_p.D3V	NM_002382	NP_002373	P61244	MAX_HUMAN	MAX protein isoform a	3					transcription from RNA polymerase II promoter	cytoplasm|MLL1 complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(1)	1				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)		GTCATCGTTATCGCTCATTTC	0.552													20	4	---	---	---	---	capture	Missense_Mutation	SNP	65569050	65569050	MAX	14	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	9252	113
ISM2	145501	broad.mit.edu	37	14	77942269	77942269	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:77942269C>T	uc001xtz.2	-	7	1459	c.1385G>A	c.(1384-1386)CGC>CAC	p.R462H	ISM2_uc001xua.2_3'UTR|ISM2_uc001xty.2_Missense_Mutation_p.R374H|ISM2_uc010tvl.1_Missense_Mutation_p.R381H	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1	462	AMOP.					extracellular region				skin(1)	1						CAGGCGCTCGCGAGGGCCACT	0.672													22	4	---	---	---	---	capture	Missense_Mutation	SNP	77942269	77942269	ISM2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7784	113
ATG2B	55102	broad.mit.edu	37	14	96752258	96752258	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96752258A>C	uc001yfi.2	-	42	6436	c.6071T>G	c.(6070-6072)GTG>GGG	p.V2024G		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	2024										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GGCACCAGTCACCCCTCTGCT	0.582													6	27	---	---	---	---	capture	Missense_Mutation	SNP	96752258	96752258	ATG2B	14	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	1085	113
C15orf2	23742	broad.mit.edu	37	15	24921107	24921107	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24921107C>T	uc001ywo.2	+	1	567	c.93C>T	c.(91-93)GAC>GAT	p.D31D		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	31					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		TGTCCCGGGACGCCTCCCCGC	0.697													10	9	---	---	---	---	capture	Silent	SNP	24921107	24921107	C15orf2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1770	113
OCA2	4948	broad.mit.edu	37	15	28273201	28273201	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28273201G>A	uc001zbh.3	-	4	441	c.331C>T	c.(331-333)CGG>TGG	p.R111W	OCA2_uc010ayv.2_Missense_Mutation_p.R111W	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	111	Cytoplasmic (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GGTATGCACCGTGACCTGGAA	0.488									Oculocutaneous_Albinism				42	37	---	---	---	---	capture	Missense_Mutation	SNP	28273201	28273201	OCA2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	10720	113
WDR76	79968	broad.mit.edu	37	15	44150913	44150913	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44150913G>A	uc001zti.1	+	11	1477	c.1454G>A	c.(1453-1455)AGT>AAT	p.S485N		NM_024908	NP_079184	Q9H967	WDR76_HUMAN	WD repeat domain 76	485	WD 4.										0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		TCCAGGAGAAGTCAGCCTTTG	0.403													31	42	---	---	---	---	capture	Missense_Mutation	SNP	44150913	44150913	WDR76	15	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	17207	113
ADAMTS7	11173	broad.mit.edu	37	15	79067005	79067005	+	Missense_Mutation	SNP	T	C	C	rs151217691		TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79067005T>C	uc002bej.3	-	12	2048	c.1837A>G	c.(1837-1839)AAG>GAG	p.K613E	ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Missense_Mutation_p.K613E	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	613	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						AGCTGGCCCTTGTAGAGCATA	0.642													3	52	---	---	---	---	capture	Missense_Mutation	SNP	79067005	79067005	ADAMTS7	15	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	271	113
SSTR5	6755	broad.mit.edu	37	16	1129345	1129345	+	Silent	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1129345G>A	uc002ckq.2	+	1	565	c.477G>A	c.(475-477)GCG>GCA	p.A159A	LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	NM_001053	NP_001044	P35346	SSR5_HUMAN	somatostatin receptor 5	159	Helical; Name=4; (Potential).				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			lung(1)	1		Hepatocellular(780;0.00369)			Octreotide(DB00104)	CCAAGCTGGCGAGCGCCGCGG	0.706													8	19	---	---	---	---	capture	Silent	SNP	1129345	1129345	SSTR5	16	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	15093	113
MAPK8IP3	23162	broad.mit.edu	37	16	1814345	1814345	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1814345A>G	uc002cmk.2	+	19	2282	c.2162A>G	c.(2161-2163)AAT>AGT	p.N721S	MAPK8IP3_uc002cml.2_Missense_Mutation_p.N715S|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.N722S	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	721					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						TGGAGGCCCAATGAGGACGAC	0.706													7	5	---	---	---	---	capture	Missense_Mutation	SNP	1814345	1814345	MAPK8IP3	16	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9199	113
ADAMTS18	170692	broad.mit.edu	37	16	77356301	77356301	+	Missense_Mutation	SNP	C	T	T	rs142855321		TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:77356301C>T	uc002ffc.3	-	14	2514	c.2095G>A	c.(2095-2097)GGC>AGC	p.G699S	ADAMTS18_uc010chc.1_Missense_Mutation_p.G287S|ADAMTS18_uc002ffe.1_Missense_Mutation_p.G395S	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	699	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						TTCACTTTGCCGGACATTGCA	0.403													48	67	---	---	---	---	capture	Missense_Mutation	SNP	77356301	77356301	ADAMTS18	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	263	113
MYO15A	51168	broad.mit.edu	37	17	18022706	18022706	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18022706G>A	uc010vxh.1	+	2	930	c.592G>A	c.(592-594)GCG>ACG	p.A198T		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	198	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					CAGCATCTACGCGTCAGGCGA	0.701													21	24	---	---	---	---	capture	Missense_Mutation	SNP	18022706	18022706	MYO15A	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9973	113
FAM83G	644815	broad.mit.edu	37	17	18891569	18891569	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18891569C>T	uc002guw.2	-	3	848	c.681G>A	c.(679-681)GGG>GGA	p.G227G	SLC5A10_uc002gur.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN	hypothetical protein LOC644815	227										ovary(1)|central_nervous_system(1)	2						CCTTGAGGTGCCCCAGGTGCA	0.463													33	48	---	---	---	---	capture	Silent	SNP	18891569	18891569	FAM83G	17	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	5585	113
ACE	1636	broad.mit.edu	37	17	61560507	61560507	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61560507G>A	uc002jau.1	+	9	1482	c.1460G>A	c.(1459-1461)CGC>CAC	p.R487H	ACE_uc010wpi.1_Intron|ACE_uc010ddu.1_Missense_Mutation_p.R304H|ACE_uc002jav.1_5'Flank|ACE_uc010ddv.1_5'Flank|ACE_uc010wpj.1_5'Flank|ACE_uc002jaw.1_5'Flank|ACE_uc010wpk.1_5'Flank	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	487	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CCCCCTTCCCGCTACAACTTC	0.587													96	119	---	---	---	---	capture	Missense_Mutation	SNP	61560507	61560507	ACE	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	136	113
SOX9	6662	broad.mit.edu	37	17	70117873	70117873	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:70117873T>C	uc002jiw.2	+	1	713	c.341T>C	c.(340-342)GTG>GCG	p.V114A	uc002jiv.2_5'Flank	NM_000346	NP_000337	P48436	SOX9_HUMAN	transcription factor SOX9	114	HMG box.				cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription				0		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GCCTTCATGGTGTGGGCGCAG	0.657													4	3	---	---	---	---	capture	Missense_Mutation	SNP	70117873	70117873	SOX9	17	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	14850	113
CSNK1D	1453	broad.mit.edu	37	17	80213441	80213441	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80213441G>A	uc002kej.2	-	3	516	c.200C>T	c.(199-201)ACC>ATC	p.T67I	SLC16A3_uc002kee.2_Intron|CSNK1D_uc002kef.2_Missense_Mutation_p.T67I|CSNK1D_uc002kei.2_Missense_Mutation_p.T67I|CSNK1D_uc010wvj.1_5'UTR|CSNK1D_uc002keh.2_5'Flank|CSNK1D_uc010dim.1_5'Flank	NM_001893	NP_001884	P48730	KC1D_HUMAN	casein kinase 1, delta isoform 1	67	Protein kinase.				circadian regulation of gene expression|DNA repair|G2/M transition of mitotic cell cycle|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|regulation of circadian rhythm|Wnt receptor signaling pathway	centrosome|cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			breast(2)	2	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			CCATCTGATGGTGGGGATGCC	0.572													28	69	---	---	---	---	capture	Missense_Mutation	SNP	80213441	80213441	CSNK1D	17	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	3917	113
ANKRD30B	374860	broad.mit.edu	37	18	14803789	14803789	+	Silent	SNP	A	G	G			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14803789A>G	uc010dlo.2	+	24	2430	c.2250A>G	c.(2248-2250)CAA>CAG	p.Q750Q	ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	835										ovary(1)|skin(1)	2						CTACACATCAAAAAGAATTCG	0.323													4	43	---	---	---	---	capture	Silent	SNP	14803789	14803789	ANKRD30B	18	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	655	113
PIGN	23556	broad.mit.edu	37	18	59757728	59757728	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:59757728C>T	uc002lii.3	-	25	2712	c.2264G>A	c.(2263-2265)GGT>GAT	p.G755D	PIGN_uc002lij.3_Missense_Mutation_p.G755D	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	755	Lumenal (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				ACAGCAAACACCAGATTGTTG	0.343													9	32	---	---	---	---	capture	Missense_Mutation	SNP	59757728	59757728	PIGN	18	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	11796	113
KCNG2	26251	broad.mit.edu	37	18	77623839	77623839	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77623839G>A	uc010xfl.1	+	1	172	c.172G>A	c.(172-174)GTG>ATG	p.V58M		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	58	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCTGCTGCGCGTGTGTGACGA	0.741													5	4	---	---	---	---	capture	Missense_Mutation	SNP	77623839	77623839	KCNG2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7950	113
C19orf35	374872	broad.mit.edu	37	19	2278816	2278816	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2278816C>A	uc002lvn.2	-	3	479	c.379G>T	c.(379-381)GAT>TAT	p.D127Y	SPPL2B_uc010dsw.1_Intron	NM_198532	NP_940934	Q6ZS72	CS035_HUMAN	hypothetical protein LOC374872	127										pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTGCAGATCGCGGAGGGAG	0.692													5	8	---	---	---	---	capture	Missense_Mutation	SNP	2278816	2278816	C19orf35	19	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	1903	113
CLEC4M	10332	broad.mit.edu	37	19	7833851	7833851	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7833851G>A	uc002mih.2	+	8	1226	c.1108G>A	c.(1108-1110)GCA>ACA	p.A370T	CLEC4M_uc010xjw.1_Missense_Mutation_p.A326T|CLEC4M_uc010dvt.2_Missense_Mutation_p.A347T|CLEC4M_uc010dvs.2_Missense_Mutation_p.A369T|CLEC4M_uc010xjx.1_Missense_Mutation_p.A342T|CLEC4M_uc002mhz.2_3'UTR|CLEC4M_uc002mic.2_3'UTR|CLEC4M_uc002mia.2_Missense_Mutation_p.A257T	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	393	Extracellular (Probable).				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						CAAAAAGCCCGCAGCCTGCTT	0.498													40	78	---	---	---	---	capture	Missense_Mutation	SNP	7833851	7833851	CLEC4M	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3483	113
FBN3	84467	broad.mit.edu	37	19	8148157	8148157	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8148157G>T	uc002mjf.2	-	56	7208	c.7187C>A	c.(7186-7188)CCG>CAG	p.P2396Q	FBN3_uc002mje.2_Missense_Mutation_p.P235Q	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2396	EGF-like 38; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						AGTAGCATCCGGTGTGTACCC	0.602													42	94	---	---	---	---	capture	Missense_Mutation	SNP	8148157	8148157	FBN3	19	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	5650	113
MUC16	94025	broad.mit.edu	37	19	9056233	9056233	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9056233C>T	uc002mkp.2	-	3	31417	c.31213G>A	c.(31213-31215)GTT>ATT	p.V10405I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10407	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCCAGCTCAACGCTCTCTGTC	0.483													98	332	---	---	---	---	capture	Missense_Mutation	SNP	9056233	9056233	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9883	113
OLFM2	93145	broad.mit.edu	37	19	9965148	9965148	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9965148G>A	uc002mmp.2	-	6	1107	c.1079C>T	c.(1078-1080)TCC>TTC	p.S360F	OLFM2_uc002mmo.2_Missense_Mutation_p.S282F	NM_058164	NP_477512	O95897	NOE2_HUMAN	olfactomedin 2 precursor	360	Olfactomedin-like.					extracellular region				large_intestine(1)|skin(1)	2						GGTGTCCCAGGACCGCATGAC	0.657													53	93	---	---	---	---	capture	Missense_Mutation	SNP	9965148	9965148	OLFM2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10758	113
CYP4F11	57834	broad.mit.edu	37	19	16025652	16025652	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16025652C>T	uc002nbu.2	-	10	1205	c.1169G>A	c.(1168-1170)CGG>CAG	p.R390Q	CYP4F11_uc010eab.1_Missense_Mutation_p.R390Q|CYP4F11_uc002nbt.2_Missense_Mutation_p.R390Q	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	390					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						GGGATGCAACCGCAGGCTCTC	0.592													62	142	---	---	---	---	capture	Missense_Mutation	SNP	16025652	16025652	CYP4F11	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4146	113
ZNF302	55900	broad.mit.edu	37	19	35175342	35175342	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35175342C>G	uc002nvr.1	+	6	795	c.532C>G	c.(532-534)CTT>GTT	p.L178V	ZNF302_uc002nvp.1_Missense_Mutation_p.L134V|ZNF302_uc002nvq.1_Missense_Mutation_p.L134V|ZNF302_uc002nvs.1_Missense_Mutation_p.L134V	NM_018443	NP_060913	Q9NR11	ZN302_HUMAN	zinc finger protein 302	213					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_lung(56;6.16e-07)|Lung NSC(56;9.71e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			AAAGTCTACTCTTTCTGAACC	0.274													21	34	---	---	---	---	capture	Missense_Mutation	SNP	35175342	35175342	ZNF302	19	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	17712	113
SHKBP1	92799	broad.mit.edu	37	19	41083170	41083170	+	Silent	SNP	C	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41083170C>A	uc002oob.2	+	2	169	c.120C>A	c.(118-120)ATC>ATA	p.I40I	SHKBP1_uc002ooc.2_Silent_p.I40I|SHKBP1_uc002ood.2_Silent_p.I40I|SHKBP1_uc010xvl.1_5'UTR|SHKBP1_uc002ooe.2_5'UTR|SHKBP1_uc002oof.2_5'Flank|SHKBP1_uc010xvm.1_5'Flank|SHKBP1_uc010xvn.1_5'Flank	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	40	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCACCTGGATCCCAGACTCCT	0.617													33	33	---	---	---	---	capture	Silent	SNP	41083170	41083170	SHKBP1	19	C	A	A	A	1	0	0	0	0	0	0	0	1	382	30	4	4	14177	113
LILRB2	10288	broad.mit.edu	37	19	54782692	54782692	+	Silent	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54782692G>A	uc002qfb.2	-	6	1196	c.930C>T	c.(928-930)AGC>AGT	p.S310S	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.S310S|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.S310S|LILRB2_uc010yet.1_Silent_p.S194S|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	310	Extracellular (Potential).|Ig-like C2-type 3.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCAGGGGGTCGCTGGGGGCCG	0.642													5	25	---	---	---	---	capture	Silent	SNP	54782692	54782692	LILRB2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	8711	113
SBK2	646643	broad.mit.edu	37	19	56047476	56047476	+	Silent	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56047476G>A	uc010ygc.1	-	1	186	c.186C>T	c.(184-186)TAC>TAT	p.Y62Y		NM_001101401	NP_001094871	P0C263	SBK2_HUMAN	SH3-binding domain kinase family, member 2	62	Protein kinase.						ATP binding|protein serine/threonine kinase activity				0						GCACTTCCTCGTAGAGCTCGT	0.652													19	26	---	---	---	---	capture	Silent	SNP	56047476	56047476	SBK2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13753	113
IHH	3549	broad.mit.edu	37	2	219920384	219920384	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219920384C>T	uc002vjo.1	-	3	781	c.781G>A	c.(781-783)GAG>AAG	p.E261K		NM_002181	NP_002172	Q14623	IHH_HUMAN	Indian hedgehog homolog precursor	261					cell-cell signaling|intein-mediated protein splicing|proteolysis	extracellular space|plasma membrane	cholesterol binding|patched binding|peptidase activity			breast(1)	1		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCTGAGTCTCGATGACCTGG	0.647													25	20	---	---	---	---	capture	Missense_Mutation	SNP	219920384	219920384	IHH	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7531	113
ADAM33	80332	broad.mit.edu	37	20	3655285	3655285	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3655285G>A	uc002wit.2	-	6	553	c.466C>T	c.(466-468)CGG>TGG	p.R156W	ADAM33_uc002wir.1_Missense_Mutation_p.R156W|ADAM33_uc002wis.2_5'Flank|ADAM33_uc002wiu.2_Missense_Mutation_p.R156W|ADAM33_uc002wiw.1_Intron|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Intron|ADAM33_uc002wix.1_Intron|ADAM33_uc010zqg.1_Missense_Mutation_p.R168W|ADAM33_uc010zqh.1_Missense_Mutation_p.R156W	NM_025220	NP_079496	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33 isoform alpha	156	Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|ovary(1)|skin(1)	4						TTGGAGCCCCGGGGTGGCCAG	0.607													10	144	---	---	---	---	capture	Missense_Mutation	SNP	3655285	3655285	ADAM33	20	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	250	113
CHGB	1114	broad.mit.edu	37	20	5904558	5904558	+	Missense_Mutation	SNP	G	A	A	rs148235020		TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5904558G>A	uc002wmg.2	+	4	2074	c.1768G>A	c.(1768-1770)GCC>ACC	p.A590T	CHGB_uc010zqz.1_Missense_Mutation_p.A273T	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	590						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GAGAAACCTCGCCAGGGTCCC	0.498													20	37	---	---	---	---	capture	Missense_Mutation	SNP	5904558	5904558	CHGB	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3305	113
PAK7	57144	broad.mit.edu	37	20	9543605	9543605	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:9543605C>T	uc002wnl.2	-	7	2094	c.1549G>A	c.(1549-1551)GAT>AAT	p.D517N	PAK7_uc002wnk.2_Missense_Mutation_p.D517N|PAK7_uc002wnj.2_Missense_Mutation_p.D517N|PAK7_uc010gby.1_Missense_Mutation_p.D517N	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	517	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			CAGAGCTCATCGCCGACAAGG	0.478													71	104	---	---	---	---	capture	Missense_Mutation	SNP	9543605	9543605	PAK7	20	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11309	113
COL20A1	57642	broad.mit.edu	37	20	61959711	61959711	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61959711C>T	uc011aau.1	+	34	3742	c.3642C>T	c.(3640-3642)CAC>CAT	p.H1214H	COL20A1_uc011aav.1_Silent_p.H1041H	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	1214					cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					ACTCCTTCCACGAGAACACCA	0.672													7	13	---	---	---	---	capture	Silent	SNP	61959711	61959711	COL20A1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3644	113
CLDN14	23562	broad.mit.edu	37	21	37833779	37833779	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:37833779G>A	uc002yvk.1	-	2	357	c.215C>T	c.(214-216)GCG>GTG	p.A72V	CLDN14_uc002yvn.1_Missense_Mutation_p.A72V|CLDN14_uc002yvo.1_Missense_Mutation_p.A72V|CLDN14_uc002yvl.1_Missense_Mutation_p.A72V|CLDN14_uc002yvm.1_Missense_Mutation_p.A72V	NM_012130	NP_036262	O95500	CLD14_HUMAN	claudin 14	72	Extracellular (Potential).				calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0						TTGGGGCAGCGCCAGCAGGGA	0.632													16	23	---	---	---	---	capture	Missense_Mutation	SNP	37833779	37833779	CLDN14	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3440	113
YWHAH	7533	broad.mit.edu	37	22	32352631	32352631	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32352631A>G	uc003alz.2	+	2	834	c.593A>G	c.(592-594)AAA>AGA	p.K198R	YWHAH_uc010gwl.2_Missense_Mutation_p.K128R|YWHAH_uc003ama.2_Missense_Mutation_p.K128R|YWHAH_uc010gwm.2_Missense_Mutation_p.K185R	NM_003405	NP_003396	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan	198					glucocorticoid catabolic process|glucocorticoid receptor signaling pathway|intracellular protein transport|negative regulation of dendrite morphogenesis|positive regulation of transcription, DNA-dependent|regulation of synaptic plasticity	cytoplasm	enzyme binding|glucocorticoid receptor binding|insulin-like growth factor receptor binding|protein domain specific binding			central_nervous_system(1)	1						CTCTTAGCCAAACAAGCCTTC	0.537													21	22	---	---	---	---	capture	Missense_Mutation	SNP	32352631	32352631	YWHAH	22	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	17385	113
PCYT1A	5130	broad.mit.edu	37	3	195965686	195965686	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195965686C>T	uc003fwg.2	-	10	1150	c.977G>A	c.(976-978)CGC>CAC	p.R326H	uc003fwf.1_5'Flank|PCYT1A_uc003fwh.2_Missense_Mutation_p.R326H	NM_005017	NP_005008	P49585	PCY1A_HUMAN	choline phosphate cytidylyltransferase 1 alpha	326	3 X repeats.					cytosol|soluble fraction	choline-phosphate cytidylyltransferase activity				0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)	GGAGCGCTCGCGAGTAGGGCT	0.607													24	31	---	---	---	---	capture	Missense_Mutation	SNP	195965686	195965686	PCYT1A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11513	113
TLR10	81793	broad.mit.edu	37	4	38777038	38777038	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38777038G>T	uc003gti.2	-	2	553	c.174C>A	c.(172-174)AAC>AAA	p.N58K	TLR10_uc003gtj.2_Missense_Mutation_p.N58K|TLR10_uc003gtk.2_Missense_Mutation_p.N58K	NM_030956	NP_112218	Q9BXR5	TLR10_HUMAN	toll-like receptor 10 precursor	58	Extracellular (Potential).|LRR 2.				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity			lung(1)|breast(1)	2						GAAAAAGGAGGTTATAGGATA	0.428													23	36	---	---	---	---	capture	Missense_Mutation	SNP	38777038	38777038	TLR10	4	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	15835	113
PDS5A	23244	broad.mit.edu	37	4	39839671	39839671	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39839671C>T	uc003guv.3	-	32	4355	c.3815G>A	c.(3814-3816)CGT>CAT	p.R1272H	PDS5A_uc010ifo.2_Missense_Mutation_p.R1232H	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	1272					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						CTTGGGTCGACGTCCTCTCCT	0.473													32	28	---	---	---	---	capture	Missense_Mutation	SNP	39839671	39839671	PDS5A	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11594	113
DCHS2	54798	broad.mit.edu	37	4	155157533	155157533	+	Silent	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155157533G>A	uc003inw.2	-	25	6906	c.6906C>T	c.(6904-6906)GTC>GTT	p.V2302V		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2302	Cadherin 20.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CCAGGACACTGACAAACACAA	0.373													32	30	---	---	---	---	capture	Silent	SNP	155157533	155157533	DCHS2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	4247	113
ANP32C	23520	broad.mit.edu	37	4	165118560	165118560	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:165118560T>C	uc011cjk.1	-	1	304	c.304A>G	c.(304-306)ATA>GTA	p.I102V	MARCH1_uc003iqs.1_Intron	NM_012403	NP_036535	O43423	AN32C_HUMAN	acidic nuclear phosphoprotein 32C	102	LRR 3.										0	all_hematologic(180;0.203)	Prostate(90;0.0138)|Melanoma(52;0.18)|all_neural(102;0.223)		KIRC - Kidney renal clear cell carcinoma(143;0.242)		AGTGGCTCTATTGTGCTGAGG	0.428													5	188	---	---	---	---	capture	Missense_Mutation	SNP	165118560	165118560	ANP32C	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	701	113
PLEKHG4B	153478	broad.mit.edu	37	5	162950	162950	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:162950C>T	uc003jak.2	+	11	1745	c.1695C>T	c.(1693-1695)CCC>CCT	p.P565P		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	565					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGGCCTTCCCCGGGGCAGGTG	0.667													3	3	---	---	---	---	capture	Silent	SNP	162950	162950	PLEKHG4B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11975	113
KLHL3	26249	broad.mit.edu	37	5	137045486	137045486	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137045486C>T	uc010jek.2	-	3	638	c.194G>A	c.(193-195)CGT>CAT	p.R65H	MYOT_uc011cye.1_Intron|KLHL3_uc010jem.1_Missense_Mutation_p.R25H	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3	65	BTB.					cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		CAGGACCACACGGTGGGCTTC	0.547													45	62	---	---	---	---	capture	Missense_Mutation	SNP	137045486	137045486	KLHL3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8303	113
PCDHA4	56144	broad.mit.edu	37	5	140188686	140188686	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140188686C>T	uc003lhi.2	+	1	2015	c.1914C>T	c.(1912-1914)GAC>GAT	p.D638D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.D638D|PCDHA4_uc011daa.1_Silent_p.D638D	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	638	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCCTGGACGAAACGGACG	0.677													53	74	---	---	---	---	capture	Silent	SNP	140188686	140188686	PCDHA4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11429	113
PCDHGA4	56111	broad.mit.edu	37	5	140736994	140736994	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140736994G>A	uc003ljq.1	+	1	2227	c.2227G>A	c.(2227-2229)GTG>ATG	p.V743M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGB2_uc003ljs.1_5'Flank|PCDHGA4_uc003ljp.1_Missense_Mutation_p.V743M|PCDHGB2_uc011dar.1_5'Flank	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	743	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGTGGGCGTGGACGGGGT	0.617													41	53	---	---	---	---	capture	Missense_Mutation	SNP	140736994	140736994	PCDHGA4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11459	113
SYNGAP1	8831	broad.mit.edu	37	6	33405652	33405652	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33405652C>T	uc011dri.1	+	8	1165	c.970C>T	c.(970-972)CGG>TGG	p.R324W	SYNGAP1_uc003oeo.1_Missense_Mutation_p.R309W|SYNGAP1_uc010juy.2_Missense_Mutation_p.R309W|SYNGAP1_uc010juz.2_Missense_Mutation_p.R36W	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	324	C2.				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						CCGTGCCCTGCGGCTGCATCT	0.627													4	86	---	---	---	---	capture	Missense_Mutation	SNP	33405652	33405652	SYNGAP1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15335	113
ABCC10	89845	broad.mit.edu	37	6	43403588	43403588	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43403588C>T	uc003ouy.1	+	5	1923	c.1708C>T	c.(1708-1710)CGG>TGG	p.R570W	ABCC10_uc003ouz.1_Missense_Mutation_p.R527W|ABCC10_uc010jyo.1_5'UTR	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	570						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GTCCTTGGACCGGATCCAGCT	0.567													30	44	---	---	---	---	capture	Missense_Mutation	SNP	43403588	43403588	ABCC10	6	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	50	113
TFAP2D	83741	broad.mit.edu	37	6	50696975	50696975	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:50696975C>T	uc003paf.2	+	5	1345	c.833C>T	c.(832-834)GCA>GTA	p.A278V	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	278							DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					AACTTACCAGCAGGAAGACGG	0.423													24	153	---	---	---	---	capture	Missense_Mutation	SNP	50696975	50696975	TFAP2D	6	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	15675	113
SIM1	6492	broad.mit.edu	37	6	100901684	100901684	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100901684C>T	uc003pqj.3	-	2	419	c.212G>A	c.(211-213)AGC>AAC	p.S71N	SIM1_uc010kcu.2_Missense_Mutation_p.S71N	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	71					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GTCCAGGGGGCTGGTCCGACT	0.612													4	85	---	---	---	---	capture	Missense_Mutation	SNP	100901684	100901684	SIM1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	14216	113
ZBTB24	9841	broad.mit.edu	37	6	109787239	109787239	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109787239C>T	uc003ptl.1	-	7	2077	c.1909G>A	c.(1909-1911)GTG>ATG	p.V637M	MICAL1_uc011eaq.1_5'Flank|ZBTB24_uc011ear.1_RNA|ZBTB24_uc010kds.1_Missense_Mutation_p.V581M|ZBTB24_uc010kdt.1_RNA	NM_014797	NP_055612	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24 isoform	637					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		AGAGTGATCACGTGCACTGGC	0.458													45	46	---	---	---	---	capture	Missense_Mutation	SNP	109787239	109787239	ZBTB24	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17411	113
PARK2	5071	broad.mit.edu	37	6	161771139	161771139	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161771139C>T	uc003qtx.3	-	12	1524	c.1390G>A	c.(1390-1392)GAC>AAC	p.D464N	PARK2_uc003qtv.3_RNA|PARK2_uc010kkd.2_Missense_Mutation_p.D273N|PARK2_uc003qtw.3_3'UTR|PARK2_uc003qty.3_Missense_Mutation_p.D436N|PARK2_uc003qtz.3_Missense_Mutation_p.D315N|PARK2_uc011egf.1_Missense_Mutation_p.D138N	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	464					aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GGCTACACGTCGAACCAGTGG	0.567													8	9	---	---	---	---	capture	Missense_Mutation	SNP	161771139	161771139	PARK2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11352	113
PMS2	5395	broad.mit.edu	37	7	6027045	6027045	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6027045T>C	uc003spl.2	-	11	1438	c.1351A>G	c.(1351-1353)AGG>GGG	p.R451G	PMS2_uc003spj.2_Missense_Mutation_p.R345G|PMS2_uc003spk.2_Missense_Mutation_p.R316G|PMS2_uc011jwl.1_Missense_Mutation_p.R316G|PMS2_uc010ktg.2_Missense_Mutation_p.R140G|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Missense_Mutation_p.R451G	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	451					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AGCATACCCCTTTTCTGTCCT	0.532			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	81	---	---	---	---	capture	Missense_Mutation	SNP	6027045	6027045	PMS2	7	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	12046	113
MLXIPL	51085	broad.mit.edu	37	7	73010591	73010591	+	Silent	SNP	C	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73010591C>A	uc003tyn.1	-	13	1998	c.1950G>T	c.(1948-1950)CGG>CGT	p.R650R	MLXIPL_uc003tyj.1_Silent_p.R29R|MLXIPL_uc003tyk.1_Silent_p.R648R|MLXIPL_uc003tyl.1_Silent_p.R648R|MLXIPL_uc003tym.1_Silent_p.R650R|MLXIPL_uc003tyo.1_RNA|MLXIPL_uc003typ.1_Silent_p.R556R	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14	650	Basic motif.				anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				GTGTGATACGCCGGTTCTCGG	0.627													47	152	---	---	---	---	capture	Silent	SNP	73010591	73010591	MLXIPL	7	C	A	A	A	1	0	0	0	0	0	0	0	1	327	26	4	4	9549	113
SEMA3E	9723	broad.mit.edu	37	7	83047753	83047753	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:83047753C>T	uc003uhy.1	-	5	969	c.503G>A	c.(502-504)GGC>GAC	p.G168D		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	168	Sema.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				AGGACATCTGCCCCTTCCTCT	0.403													3	31	---	---	---	---	capture	Missense_Mutation	SNP	83047753	83047753	SEMA3E	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13921	113
SLC26A5	375611	broad.mit.edu	37	7	103032068	103032068	+	Splice_Site	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103032068C>T	uc003vbz.2	-	11	1469	c.1233_splice	c.e11+1	p.Q411_splice	SLC26A5_uc003vbt.1_Splice_Site_p.Q411_splice|SLC26A5_uc003vbu.1_Splice_Site_p.Q411_splice|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Splice_Site|SLC26A5_uc003vbx.2_Splice_Site_p.Q411_splice|SLC26A5_uc003vby.2_Splice_Site|SLC26A5_uc010liy.2_Splice_Site	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						TATGTACATACCTGTGTCTTC	0.438													18	51	---	---	---	---	capture	Splice_Site	SNP	103032068	103032068	SLC26A5	7	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	14412	113
C7orf66	154907	broad.mit.edu	37	7	108524200	108524200	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:108524200C>T	uc003vfo.2	-	2	260	c.212G>A	c.(211-213)CGT>CAT	p.R71H		NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907	71						integral to membrane				ovary(2)	2						CATCATGTGACGATATTGAGC	0.418													46	120	---	---	---	---	capture	Missense_Mutation	SNP	108524200	108524200	C7orf66	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2389	113
LMBR1	64327	broad.mit.edu	37	7	156518202	156518202	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156518202G>T	uc003wmw.3	-	14	1300	c.1085C>A	c.(1084-1086)TCT>TAT	p.S362Y	LMBR1_uc003wmv.3_Missense_Mutation_p.S210Y|LMBR1_uc003wmx.3_Missense_Mutation_p.S210Y|LMBR1_uc010lqn.2_Missense_Mutation_p.S403Y|LMBR1_uc011kvx.1_Missense_Mutation_p.S341Y	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein	362	Cytoplasmic (Potential).					integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		GCCGACAACAGAGGACACCAT	0.413													31	74	---	---	---	---	capture	Missense_Mutation	SNP	156518202	156518202	LMBR1	7	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	8760	113
PTPRN2	5799	broad.mit.edu	37	7	157475460	157475460	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:157475460C>T	uc003wno.2	-	13	2079	c.1958G>A	c.(1957-1959)GGA>GAA	p.G653E	PTPRN2_uc003wnp.2_Missense_Mutation_p.G636E|PTPRN2_uc003wnq.2_Missense_Mutation_p.G624E|PTPRN2_uc003wnr.2_Missense_Mutation_p.G615E|PTPRN2_uc011kwa.1_Missense_Mutation_p.G676E	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	653	Cytoplasmic (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GCCCCCTAGTCCCGAGAGCTT	0.567													54	171	---	---	---	---	capture	Missense_Mutation	SNP	157475460	157475460	PTPRN2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	12703	113
PRSS55	203074	broad.mit.edu	37	8	10396129	10396129	+	Silent	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10396129C>T	uc003wta.2	+	5	900	c.885C>T	c.(883-885)ATC>ATT	p.I295I	uc010lru.2_Intron|PRSS55_uc003wtb.2_Intron	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	295	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						ACCTCTGGATCGAGAAAGTGA	0.532													50	64	---	---	---	---	capture	Silent	SNP	10396129	10396129	PRSS55	8	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	12529	113
CPA6	57094	broad.mit.edu	37	8	68396059	68396059	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:68396059G>A	uc003xxq.3	-	8	1038	c.782C>T	c.(781-783)TCA>TTA	p.S261L	CPA6_uc003xxr.3_Missense_Mutation_p.S113L|CPA6_uc003xxs.2_Missense_Mutation_p.S261L	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor	261					proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			GCGAAACCTTGAGTTCCTTGA	0.408													54	95	---	---	---	---	capture	Missense_Mutation	SNP	68396059	68396059	CPA6	8	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	3759	113
FER1L6	654463	broad.mit.edu	37	8	125131850	125131850	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:125131850G>A	uc003yqw.2	+	41	5599	c.5393G>A	c.(5392-5394)CGC>CAC	p.R1798H	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1798	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CCCCTCAGCCGCCCAGACACC	0.433													55	68	---	---	---	---	capture	Missense_Mutation	SNP	125131850	125131850	FER1L6	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5761	113
TG	7038	broad.mit.edu	37	8	133879248	133879248	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133879248G>A	uc003ytw.2	+	1	44	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	1					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCAGGAAAATGGCCCTGGTCC	0.592													6	9	---	---	---	---	capture	Missense_Mutation	SNP	133879248	133879248	TG	8	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	15698	113
PTPDC1	138639	broad.mit.edu	37	9	96860365	96860365	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96860365C>A	uc004auf.1	+	7	1695	c.1355C>A	c.(1354-1356)ACA>AAA	p.T452K	PTPDC1_uc004aug.1_Missense_Mutation_p.T452K|PTPDC1_uc004auh.1_Missense_Mutation_p.T504K|PTPDC1_uc010mrj.1_Missense_Mutation_p.T506K|PTPDC1_uc010mri.1_Missense_Mutation_p.T504K	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	452							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						GTTCGCAGCACACTTTCTTTC	0.483													27	45	---	---	---	---	capture	Missense_Mutation	SNP	96860365	96860365	PTPDC1	9	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12668	113
CIZ1	25792	broad.mit.edu	37	9	130952718	130952718	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130952718A>G	uc004btt.2	-	3	339	c.176T>C	c.(175-177)CTC>CCC	p.L59P	CIZ1_uc004btr.2_Missense_Mutation_p.L59P|CIZ1_uc004bts.2_Missense_Mutation_p.L59P|CIZ1_uc011maq.1_Missense_Mutation_p.L59P|CIZ1_uc004btu.2_Missense_Mutation_p.L59P|CIZ1_uc011mar.1_Intron|CIZ1_uc011mas.1_Missense_Mutation_p.L89P|CIZ1_uc004btw.2_Missense_Mutation_p.L59P|CIZ1_uc004btv.2_Missense_Mutation_p.L59P|CIZ1_uc004btx.2_Missense_Mutation_p.L59P	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform	59						nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						CTGCGGGGGGAGCCCCCTGTG	0.582													5	14	---	---	---	---	capture	Missense_Mutation	SNP	130952718	130952718	CIZ1	9	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	3406	113
FRMPD4	9758	broad.mit.edu	37	X	12516825	12516825	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12516825C>T	uc004cuz.1	+	2	574	c.68C>T	c.(67-69)CCG>CTG	p.P23L	FRMPD4_uc011mij.1_Missense_Mutation_p.P15L	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	23					positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						TCAGGCTGGCCGCCTCCCTCG	0.512													24	50	---	---	---	---	capture	Missense_Mutation	SNP	12516825	12516825	FRMPD4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6002	113
CDKL5	6792	broad.mit.edu	37	X	18622187	18622187	+	Silent	SNP	C	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18622187C>A	uc004cym.2	+	12	1396	c.1143C>A	c.(1141-1143)ACC>ACA	p.T381T	CDKL5_uc004cyn.2_Silent_p.T381T	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	381					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					CACTGCACACCAAAACCTACC	0.507													70	126	---	---	---	---	capture	Silent	SNP	18622187	18622187	CDKL5	23	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	3127	113
SYP	6855	broad.mit.edu	37	X	49048188	49048188	+	Silent	SNP	G	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49048188G>A	uc004dmz.1	-	6	664	c.648C>T	c.(646-648)GTC>GTT	p.V216V	SYP_uc011mmz.1_Silent_p.V98V|SYP_uc004dna.1_Silent_p.V210V	NM_003179	NP_003170	P08247	SYPH_HUMAN	synaptophysin	216	Helical; (Potential).|MARVEL.				regulation of long-term neuronal synaptic plasticity|regulation of short-term neuronal synaptic plasticity|synaptic vesicle maturation|synaptic vesicle membrane organization	cell junction|integral to synaptic vesicle membrane|synaptosome	calcium ion binding|cholesterol binding|transporter activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(315;0.00016)				ACAGGTTGCCGACCCAGAGCA	0.677													8	7	---	---	---	---	capture	Silent	SNP	49048188	49048188	SYP	23	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	15349	113
FOXP3	50943	broad.mit.edu	37	X	49112252	49112252	+	Missense_Mutation	SNP	G	A	A	rs2232369		TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49112252G>A	uc004dnf.3	-	7	847	c.659C>T	c.(658-660)GCG>GTG	p.A220V	FOXP3_uc011mnb.1_Missense_Mutation_p.A243V|FOXP3_uc011mnc.1_Missense_Mutation_p.A220V|FOXP3_uc004dne.3_Missense_Mutation_p.A185V|FOXP3_uc010niq.1_Missense_Mutation_p.A185V	NM_014009	NP_054728	Q9BZS1	FOXP3_HUMAN	forkhead box P3 isoform a	220	C2H2-type.				B cell homeostasis|cerebellum development|chromatin remodeling|embryo development|myeloid cell homeostasis|negative regulation of activated T cell proliferation|negative regulation of chronic inflammatory response|negative regulation of CREB transcription factor activity|negative regulation of cytokine secretion|negative regulation of histone acetylation|negative regulation of histone deacetylation|negative regulation of interferon-gamma biosynthetic process|negative regulation of interferon-gamma production|negative regulation of interleukin-10 production|negative regulation of interleukin-2 biosynthetic process|negative regulation of interleukin-2 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of interleukin-6 production|negative regulation of isotype switching to IgE isotypes|negative regulation of NF-kappaB transcription factor activity|negative regulation of T cell cytokine production|negative regulation of tumor necrosis factor production|pattern specification process|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation|positive regulation of histone acetylation|positive regulation of immature T cell proliferation in thymus|positive regulation of peripheral T cell tolerance induction|positive regulation of T cell anergy|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transforming growth factor-beta1 production|post-embryonic development|regulation of isotype switching to IgG isotypes|response to virus|T cell homeostasis|T cell receptor signaling pathway|tolerance induction to self antigen	cytoplasm|cytoplasm|nucleus|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|histone acetyltransferase binding|histone deacetylase binding|NF-kappaB binding|NFAT protein binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription corepressor activity|zinc ion binding				0	Ovarian(276;0.236)					AAGATGGTCCGCCTGGCAGTG	0.587													9	11	---	---	---	---	capture	Missense_Mutation	SNP	49112252	49112252	FOXP3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5972	113
ITIH5L	347365	broad.mit.edu	37	X	54777784	54777784	+	Missense_Mutation	SNP	C	T	T	rs146825535		TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54777784C>T	uc004dtj.2	-	12	3412	c.3382G>A	c.(3382-3384)GCA>ACA	p.A1128T		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	1128					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						CTTGGTGGTGCGCCAAGCAGC	0.592													36	43	---	---	---	---	capture	Missense_Mutation	SNP	54777784	54777784	ITIH5L	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7831	113
TEX11	56159	broad.mit.edu	37	X	69825267	69825267	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69825267G>T	uc004dyl.2	-	25	2258	c.2096C>A	c.(2095-2097)TCA>TAA	p.S699*	TEX11_uc004dyk.2_Nonsense_Mutation_p.S374*|TEX11_uc004dym.2_Nonsense_Mutation_p.S684*	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	699							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					AAAAGCTGTTGAAGCTTTTCT	0.388													42	46	---	---	---	---	capture	Nonsense_Mutation	SNP	69825267	69825267	TEX11	23	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	15659	113
IL9R	3581	broad.mit.edu	37	X	155239824	155239824	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:155239824A>G	uc004fnv.1	+	9	1495	c.1316A>G	c.(1315-1317)AAC>AGC	p.N439S	IL9R_uc004fnu.1_3'UTR	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor	439	Poly-Asn.|Cytoplasmic (Potential).				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					agcagcagcaacaacaacaAC	0.517													2	8	---	---	---	---	capture	Missense_Mutation	SNP	155239824	155239824	IL9R	23	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	7631	113
STAT5B	6777	broad.mit.edu	37	17	40370236	40370236	+	Frame_Shift_Del	DEL	G	-	-	rs144993426		TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40370236delG	uc002hzh.2	-	9	1271	c.1102delC	c.(1102-1104)CAGfs	p.Q368fs	STAT5B_uc002hzi.3_Frame_Shift_Del_p.Q368fs	NM_012448	NP_036580	P51692	STA5B_HUMAN	signal transducer and activator of transcription	368					2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|skin(1)	6		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	GCCTTCACCTGGGGGGGGTTC	0.577													9	57	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	40370236	40370236	STAT5B	17	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	15159	113
RBBP8	5932	broad.mit.edu	37	18	20572852	20572853	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:20572852_20572853insA	uc002ktw.2	+	11	1393_1394	c.1062_1063insA	c.(1060-1065)GGGAAAfs	p.G354fs	RBBP8_uc002kty.2_Frame_Shift_Ins_p.G354fs|RBBP8_uc002ktz.2_Frame_Shift_Ins_p.G354fs|RBBP8_uc002kua.2_Frame_Shift_Ins_p.G354fs|RBBP8_uc002ktx.1_Frame_Shift_Ins_p.G354fs	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a	354_355					cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			TACAGCCTGGGAAAAAAAAACA	0.361								Direct_reversal_of_damage|Homologous_recombination					8	143	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	20572852	20572853	RBBP8	18	-	A	A	A	1	0	1	1	0	0	0	0	0	522	41	5	5	13000	113
PCLO	27445	broad.mit.edu	37	7	82595385	82595385	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-6699-01	TCGA-06-6699-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82595385delT	uc003uhx.2	-	4	4008	c.3719delA	c.(3718-3720)AAGfs	p.K1240fs	PCLO_uc003uhv.2_Frame_Shift_Del_p.K1240fs	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1179					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AGGGGTTGGCTTTTTTTCTTC	0.383													7	850	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	82595385	82595385	PCLO	7	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	11486	113
