Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ZBTB17	7709	broad.mit.edu	37	1	16268633	16268633	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16268633T>C	uc001axl.3	-	16	2482	c.2243A>G	c.(2242-2244)CAG>CGG	p.Q748R	ZBTB17_uc010obq.1_Missense_Mutation_p.Q665R|ZBTB17_uc010obr.1_Missense_Mutation_p.Q755R|ZBTB17_uc010obs.1_Missense_Mutation_p.Q672R	NM_003443	NP_003434	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	748	Interaction with HCFC1.				negative regulation of cell cycle	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		CGCGTCTGTCTGGAACATGAC	0.627													17	70	---	---	---	---	capture	Missense_Mutation	SNP	16268633	16268633	ZBTB17	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	17407	114
WDR63	126820	broad.mit.edu	37	1	85595746	85595746	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85595746G>A	uc001dkt.2	+	22	2674	c.2483G>A	c.(2482-2484)CGT>CAT	p.R828H	WDR63_uc009wcl.2_Missense_Mutation_p.R789H	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	828	Potential.									upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		AAAAAAATTCGTGAGCAAGAA	0.363													34	137	---	---	---	---	capture	Missense_Mutation	SNP	85595746	85595746	WDR63	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17195	114
NUP210L	91181	broad.mit.edu	37	1	154062057	154062057	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154062057C>T	uc001fdw.2	-	16	2273	c.2201G>A	c.(2200-2202)CGA>CAA	p.R734Q	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Missense_Mutation_p.R734Q	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	734						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ATTTCCAATTCGGAATGTGAG	0.423													19	63	---	---	---	---	capture	Missense_Mutation	SNP	154062057	154062057	NUP210L	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10668	114
TAGLN2	8407	broad.mit.edu	37	1	159889092	159889092	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159889092A>G	uc001fum.1	-	3	480	c.430T>C	c.(430-432)TTC>CTC	p.F144L	CCDC19_uc001ful.2_Intron|TAGLN2_uc001fun.1_Missense_Mutation_p.F144L|TAGLN2_uc001fuo.1_Missense_Mutation_p.F144L	NM_003564	NP_003555	P37802	TAGL2_HUMAN	transgelin 2	144					muscle organ development	nuclear membrane|plasma membrane	protein binding				0	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCCCCAGAGAAGAGCCCATCA	0.547													18	65	---	---	---	---	capture	Missense_Mutation	SNP	159889092	159889092	TAGLN2	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	15427	114
CD244	51744	broad.mit.edu	37	1	160811483	160811483	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160811483C>G	uc009wtq.2	-	2	448	c.270G>C	c.(268-270)TTG>TTC	p.L90F	CD244_uc001fxa.2_Missense_Mutation_p.L90F|CD244_uc009wtp.2_RNA|CD244_uc009wtr.2_Missense_Mutation_p.L90F|CD244_uc010pjt.1_RNA	NM_016382	NP_057466	Q9BZW8	CD244_HUMAN	CD244 natural killer cell receptor 2B4	90	Extracellular (Potential).|Ig-like 1.				blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TGAGAAGACTCAAGTTCTTGA	0.448													25	36	---	---	---	---	capture	Missense_Mutation	SNP	160811483	160811483	CD244	1	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	2958	114
HMCN1	83872	broad.mit.edu	37	1	186106708	186106708	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186106708G>A	uc001grq.1	+	88	13890	c.13661G>A	c.(13660-13662)CGT>CAT	p.R4554H	HMCN1_uc001grs.1_Missense_Mutation_p.R123H	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4554	TSP type-1 1.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAGAGGAGTCGTCTGTGCAAC	0.488													5	37	---	---	---	---	capture	Missense_Mutation	SNP	186106708	186106708	HMCN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7145	114
C1orf150	148823	broad.mit.edu	37	1	247712512	247712512	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247712512C>T	uc001idf.2	+	1	64	c.19C>T	c.(19-21)CGA>TGA	p.R7*	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_RNA|C1orf150_uc001idb.3_RNA|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823	7											0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			TTATCTCCTGCGAAAACTCAG	0.468													9	28	---	---	---	---	capture	Nonsense_Mutation	SNP	247712512	247712512	C1orf150	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	1986	114
OR2T12	127064	broad.mit.edu	37	1	248458330	248458330	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248458330C>T	uc010pzj.1	-	1	551	c.551G>A	c.(550-552)CGT>CAT	p.R184H		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			ACAAGCCAAACGCACCAACAC	0.552													25	92	---	---	---	---	capture	Missense_Mutation	SNP	248458330	248458330	OR2T12	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10923	114
OR10A6	390093	broad.mit.edu	37	11	7949287	7949287	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7949287C>T	uc010rbh.1	-	1	923	c.923G>A	c.(922-924)CGA>CAA	p.R308Q		NM_001004461	NP_001004461	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TAAAACCACTCGCCTTCGCCA	0.363													14	50	---	---	---	---	capture	Missense_Mutation	SNP	7949287	7949287	OR10A6	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10798	114
OR5A1	219982	broad.mit.edu	37	11	59211010	59211010	+	Silent	SNP	C	T	T	rs139346783	byFrequency	TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59211010C>T	uc001nnx.1	+	1	369	c.369C>T	c.(367-369)TAC>TAT	p.Y123Y		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	123	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						CTATGGCATACGACCGATATG	0.542													56	174	---	---	---	---	capture	Silent	SNP	59211010	59211010	OR5A1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11043	114
STX3	6809	broad.mit.edu	37	11	59564776	59564776	+	Silent	SNP	G	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59564776G>T	uc001nog.2	+	10	997	c.807G>T	c.(805-807)GTG>GTT	p.V269V	STX3_uc010rkx.1_Intron|STX3_uc010rky.1_Intron|STX3_uc009ymt.1_Silent_p.V135V	NM_004177	NP_004168	Q13277	STX3_HUMAN	syntaxin 3	269	Helical; Anchor for type IV membrane protein; (Potential).				cellular response to oxidative stress|intracellular protein transport|neuron projection development|neurotransmitter transport	apical plasma membrane|azurophil granule|cell-cell junction|growth cone|integral to membrane|plasma membrane enriched fraction|SNARE complex|specific granule	arachidonic acid binding|SNAP receptor activity			ovary(2)	2						TTATCATTGTGCTAGTAGTTG	0.363													11	69	---	---	---	---	capture	Silent	SNP	59564776	59564776	STX3	11	G	T	T	T	1	0	0	0	0	0	0	0	1	587	46	4	4	15236	114
SLC3A2	6520	broad.mit.edu	37	11	62652817	62652817	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62652817G>T	uc001nwd.2	+	9	1514	c.1290G>T	c.(1288-1290)TGG>TGT	p.W430C	SLC3A2_uc001nwb.2_Missense_Mutation_p.W461C|SLC3A2_uc001nwc.2_Missense_Mutation_p.W431C|SLC3A2_uc001nwe.2_Missense_Mutation_p.W399C|SLC3A2_uc001nwf.2_Missense_Mutation_p.W368C|SLC3A2_uc001nwg.2_Missense_Mutation_p.W329C	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c	430	Extracellular (Potential).				blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						GCAATCGCTGGTGCAGCTGGA	0.517													22	64	---	---	---	---	capture	Missense_Mutation	SNP	62652817	62652817	SLC3A2	11	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	14519	114
MFAP5	8076	broad.mit.edu	37	12	8813465	8813465	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8813465G>A	uc001qut.1	-	3	301	c.88C>T	c.(88-90)CGA>TGA	p.R30*	MFAP5_uc001qus.2_Nonsense_Mutation_p.R30*|MFAP5_uc009zge.1_Nonsense_Mutation_p.R30*	NM_003480	NP_003471	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5 precursor	30	Cell attachment site (Potential).					microfibril	extracellular matrix structural constituent			breast(1)	1	Lung SC(5;0.184)					CTACCTCCTCGTTGACTATTG	0.438													17	51	---	---	---	---	capture	Nonsense_Mutation	SNP	8813465	8813465	MFAP5	12	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	9430	114
CD63	967	broad.mit.edu	37	12	56120552	56120552	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56120552G>A	uc001shm.2	-	4	454	c.358C>T	c.(358-360)CGG>TGG	p.R120W	CD63_uc009znz.2_Missense_Mutation_p.R97W|CD63_uc001shn.2_Missense_Mutation_p.R120W|CD63_uc001sho.2_Missense_Mutation_p.R120W|CD63_uc001shp.2_Missense_Mutation_p.R120W	NM_001780	NP_001771	P08962	CD63_HUMAN	CD63 antigen isoform A	120	Extracellular (Potential).				platelet activation|platelet degranulation	integral to plasma membrane|late endosome membrane|lysosomal membrane|platelet dense granule membrane					0						ATCTGCTGCCGGAAGTTGTTA	0.557													25	91	---	---	---	---	capture	Missense_Mutation	SNP	56120552	56120552	CD63	12	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	3000	114
TMEM132B	114795	broad.mit.edu	37	12	126138636	126138636	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:126138636C>T	uc001uhe.1	+	9	2625	c.2617C>T	c.(2617-2619)CCC>TCC	p.P873S	TMEM132B_uc001uhf.1_Missense_Mutation_p.P385S	NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	873	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TACAAGCTTCCCCACTCAAGG	0.507													16	41	---	---	---	---	capture	Missense_Mutation	SNP	126138636	126138636	TMEM132B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15930	114
EP400	57634	broad.mit.edu	37	12	132514624	132514624	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132514624A>G	uc001ujn.2	+	28	5710	c.5675A>G	c.(5674-5676)GAC>GGC	p.D1892G	EP400_uc001ujl.2_Missense_Mutation_p.D1891G|EP400_uc001ujm.2_Missense_Mutation_p.D1811G|SNORA49_uc001ujo.2_5'Flank	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1928	Helicase C-terminal.				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CTTATGTTGGACATTTTAGAG	0.413													25	91	---	---	---	---	capture	Missense_Mutation	SNP	132514624	132514624	EP400	12	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	5104	114
FLT1	2321	broad.mit.edu	37	13	28896953	28896953	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28896953C>T	uc001usb.3	-	21	3212	c.2927G>A	c.(2926-2928)AGT>AAT	p.S976N	FLT1_uc010aap.2_5'Flank|FLT1_uc010aaq.2_Missense_Mutation_p.S101N|FLT1_uc001usa.3_Missense_Mutation_p.S194N	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	976	Cytoplasmic (Potential).|Protein kinase.				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	ATCACTCAGACTTTTATCTTC	0.438													5	174	---	---	---	---	capture	Missense_Mutation	SNP	28896953	28896953	FLT1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	5885	114
PCCA	5095	broad.mit.edu	37	13	100915068	100915068	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:100915068C>T	uc001voo.2	+	10	840	c.802C>T	c.(802-804)CGT>TGT	p.R268C	PCCA_uc010aga.2_Missense_Mutation_p.R242C|PCCA_uc010tiz.1_Missense_Mutation_p.R268C	NM_000282	NP_000273	P05165	PCCA_HUMAN	propionyl-Coenzyme A carboxylase, alpha	268	ATP-grasp.|Biotin carboxylation.				fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TGATAATCCTCGTCATATAGA	0.274													38	157	---	---	---	---	capture	Missense_Mutation	SNP	100915068	100915068	PCCA	13	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11407	114
GRTP1	79774	broad.mit.edu	37	13	114009782	114009782	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114009782G>A	uc001vtn.2	-	3	293	c.196C>T	c.(196-198)CGG>TGG	p.R66W	GRTP1_uc010tkb.1_5'UTR|GRTP1_uc010tkc.1_Missense_Mutation_p.R66W|GRTP1_uc010agv.1_RNA	NM_024719	NP_078995	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	66						intracellular	Rab GTPase activator activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			ACCCCTTTCCGGACATAGCGC	0.657													5	32	---	---	---	---	capture	Missense_Mutation	SNP	114009782	114009782	GRTP1	13	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	6743	114
CMA1	1215	broad.mit.edu	37	14	24976583	24976583	+	Missense_Mutation	SNP	G	A	A	rs13306251	by1000genomes	TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24976583G>A	uc001wpp.1	-	2	218	c.188C>T	c.(187-189)ACG>ATG	p.T63M	CMA1_uc010alx.1_Intron	NM_001836	NP_001827	P23946	CMA1_HUMAN	chymase 1, mast cell preproprotein	63	Peptidase S1.				interleukin-1 beta biosynthetic process|proteolysis	extracellular region	serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.0271)		ATGAGCAGCCGTCAGCACAAA	0.488													33	111	---	---	---	---	capture	Missense_Mutation	SNP	24976583	24976583	CMA1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3539	114
KIAA1409	57578	broad.mit.edu	37	14	94103593	94103593	+	Silent	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94103593C>T	uc001ybv.1	+	31	5483	c.5400C>T	c.(5398-5400)AAC>AAT	p.N1800N	KIAA1409_uc001ybs.1_Silent_p.N1778N	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1955						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		gccagtgtaacgtgccaacgt	0.005													7	82	---	---	---	---	capture	Silent	SNP	94103593	94103593	KIAA1409	14	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8152	114
GABRA5	2558	broad.mit.edu	37	15	27193304	27193304	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:27193304G>A	uc001zbd.1	+	12	1652	c.1313G>A	c.(1312-1314)GGC>GAC	p.G438D	GABRA5_uc001zbe.1_RNA	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	438	Helical; (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GTCTTGTTCGGCACTTTCAAC	0.438													8	23	---	---	---	---	capture	Missense_Mutation	SNP	27193304	27193304	GABRA5	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6106	114
PCSK6	5046	broad.mit.edu	37	15	101971636	101971636	+	Silent	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101971636C>T	uc002bwy.2	-	5	860	c.546G>A	c.(544-546)TCG>TCA	p.S182S	PCSK6_uc010bpd.2_Silent_p.S52S|PCSK6_uc010bpe.2_Silent_p.S182S|PCSK6_uc002bxa.2_Silent_p.S182S|PCSK6_uc002bxb.2_Silent_p.S182S|PCSK6_uc002bxc.1_Silent_p.S182S|PCSK6_uc002bxd.1_Silent_p.S182S|PCSK6_uc002bxe.2_Silent_p.S182S|PCSK6_uc002bxg.1_Silent_p.S182S	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	182	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CATTCATTTCCGACCGGCAGC	0.532													6	22	---	---	---	---	capture	Silent	SNP	101971636	101971636	PCSK6	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11507	114
EDC4	23644	broad.mit.edu	37	16	67917522	67917522	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67917522G>A	uc002eur.2	+	28	4067	c.3901G>A	c.(3901-3903)GAC>AAC	p.D1301N	EDC4_uc010cer.2_Missense_Mutation_p.D920N|EDC4_uc002eus.2_Missense_Mutation_p.D1031N|EDC4_uc002eut.1_3'UTR|NRN1L_uc002euu.2_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	1301					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TGAAACTGTGGACCCAGCCCA	0.547											OREG0023890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	41	184	---	---	---	---	capture	Missense_Mutation	SNP	67917522	67917522	EDC4	16	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4863	114
PDPR	55066	broad.mit.edu	37	16	70172800	70172800	+	Splice_Site	SNP	A	G	G			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70172800A>G	uc002eyf.1	+	11	2148	c.1191_splice	c.e11-2	p.K397_splice	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Splice_Site_p.K297_splice|PDPR_uc002eyg.1_Splice_Site_p.K125_splice	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CTGTCTATATAGGTACCTTGC	0.443													5	113	---	---	---	---	capture	Splice_Site	SNP	70172800	70172800	PDPR	16	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	11592	114
PIK3R5	23533	broad.mit.edu	37	17	8784974	8784974	+	Silent	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8784974G>A	uc002glt.2	-	17	2422	c.2355C>T	c.(2353-2355)AAC>AAT	p.N785N	PIK3R5_uc010vuz.1_Silent_p.N785N|PIK3R5_uc002glu.3_Silent_p.N399N	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	785					platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						TGGATTTGGAGTTCTGCCTTT	0.493													3	23	---	---	---	---	capture	Silent	SNP	8784974	8784974	PIK3R5	17	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	11825	114
SPACA3	124912	broad.mit.edu	37	17	31322667	31322667	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:31322667G>A	uc002hhs.1	+	2	350	c.275G>A	c.(274-276)CGT>CAT	p.R92H	SPACA3_uc010cte.1_RNA	NM_173847	NP_776246	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	92	Extracellular (Potential).				cell wall macromolecule catabolic process|defense response to Gram-positive bacterium|monocyte activation|peptidoglycan catabolic process|positive regulation of macrophage activation|positive regulation of phagocytosis|response to virus	acrosomal membrane|extracellular region|integral to membrane|lysosome	bacterial cell surface binding|lysozyme activity|protein binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.193)			CTCTACGGTCGTTGTGAACTG	0.617													6	46	---	---	---	---	capture	Missense_Mutation	SNP	31322667	31322667	SPACA3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14865	114
KRTAP1-1	81851	broad.mit.edu	37	17	39197393	39197393	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39197393T>C	uc002hvw.1	-	1	321	c.257A>G	c.(256-258)TAC>TGC	p.Y86C		NM_030967	NP_112229	Q07627	KRA11_HUMAN	keratin associated protein 1-1	86			Missing (in allele KAP1.7).			extracellular region|keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTGGTCTGGTAGCAGCTTGG	0.587													3	76	---	---	---	---	capture	Missense_Mutation	SNP	39197393	39197393	KRTAP1-1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	8422	114
C17orf57	124989	broad.mit.edu	37	17	45490276	45490276	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45490276G>A	uc002iln.2	+	22	2827	c.2416G>A	c.(2416-2418)GTC>ATC	p.V806I	C17orf57_uc002ilm.2_Missense_Mutation_p.V710I	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989	806	EF-hand 5.						calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						CTGTTGTAACGTCAGTGGTGA	0.353													9	67	---	---	---	---	capture	Missense_Mutation	SNP	45490276	45490276	C17orf57	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1850	114
SPAG9	9043	broad.mit.edu	37	17	49071128	49071128	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:49071128G>A	uc002itc.2	-	19	2604	c.2395C>T	c.(2395-2397)CCA>TCA	p.P799S	SPAG9_uc002itb.2_Missense_Mutation_p.P785S|SPAG9_uc002itd.2_Missense_Mutation_p.P789S|SPAG9_uc002itf.2_Missense_Mutation_p.P620S|SPAG9_uc002ita.2_Missense_Mutation_p.P642S|SPAG9_uc002ite.2_Missense_Mutation_p.P629S	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	799					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CTCTTACCTGGCACACTTGCA	0.328													3	41	---	---	---	---	capture	Missense_Mutation	SNP	49071128	49071128	SPAG9	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14877	114
C18orf34	374864	broad.mit.edu	37	18	30825371	30825371	+	Silent	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:30825371G>A	uc002kxn.2	-	14	1573	c.1431C>T	c.(1429-1431)TAC>TAT	p.Y477Y	C18orf34_uc010dme.1_Translation_Start_Site|C18orf34_uc010xbr.1_Silent_p.Y477Y|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Silent_p.Y477Y|C18orf34_uc002kxp.2_Silent_p.Y477Y	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	477										ovary(1)	1						TTTCAGATTCGTATTTTGATT	0.259													3	13	---	---	---	---	capture	Silent	SNP	30825371	30825371	C18orf34	18	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1886	114
CELF4	56853	broad.mit.edu	37	18	35145598	35145598	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:35145598T>A	uc002lae.2	-	1	403	c.7A>T	c.(7-9)ATA>TTA	p.I3L	CELF4_uc010dnd.1_Missense_Mutation_p.I3L|CELF4_uc002lag.2_Missense_Mutation_p.I3L|CELF4_uc002laf.2_5'UTR|CELF4_uc002lai.2_5'UTR	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	3	Sufficient for RNA-binding and MSE- dependent splicing activity.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						GCCATCTTTATATACATAGAG	0.537													8	40	---	---	---	---	capture	Missense_Mutation	SNP	35145598	35145598	CELF4	18	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	3186	114
SERPINB4	6318	broad.mit.edu	37	18	61306946	61306946	+	Silent	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61306946G>A	uc002ljf.2	-	6	620	c.534C>T	c.(532-534)AAC>AAT	p.N178N	SERPINB4_uc002lje.2_Silent_p.N178N|SERPINB4_uc002ljg.2_Intron	NM_002974	NP_002965	P48594	SPB4_HUMAN	serine (or cysteine) proteinase inhibitor, clade	178					immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|lung(1)	3						AATAGATTGCGTTCACAAGAA	0.318													14	64	---	---	---	---	capture	Silent	SNP	61306946	61306946	SERPINB4	18	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13996	114
CYP2F1	1572	broad.mit.edu	37	19	41630793	41630793	+	Silent	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41630793C>T	uc002opu.1	+	8	1190	c.1134C>T	c.(1132-1134)CGC>CGT	p.R378R	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_3'UTR|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	378					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						CGGCCTTTCGCGGCTTCCTGA	0.597													4	15	---	---	---	---	capture	Silent	SNP	41630793	41630793	CYP2F1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4131	114
ZNF813	126017	broad.mit.edu	37	19	53995185	53995185	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53995185G>T	uc002qbu.2	+	4	1827	c.1699G>T	c.(1699-1701)GCA>TCA	p.A567S	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	567	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		AGCACACCTTGCACGTCACCA	0.378													5	39	---	---	---	---	capture	Missense_Mutation	SNP	53995185	53995185	ZNF813	19	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	18051	114
NLRP5	126206	broad.mit.edu	37	19	56515184	56515184	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56515184C>A	uc002qmj.2	+	2	165	c.165C>A	c.(163-165)GAC>GAA	p.D55E	NLRP5_uc002qmi.2_Missense_Mutation_p.D55E	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	55						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGGAAGGAGACAAATCGCTCA	0.423													23	93	---	---	---	---	capture	Missense_Mutation	SNP	56515184	56515184	NLRP5	19	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	10387	114
LOC285033	285033	broad.mit.edu	37	2	96906137	96906137	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96906137C>T	uc002svp.1	+	1	161	c.76C>T	c.(76-78)CGA>TGA	p.R26*	LOC285033_uc002svn.2_RNA|LOC285033_uc002svo.2_Intron	NM_001037228	NP_001032305	Q3KRF4	Q3KRF4_HUMAN	hypothetical protein LOC285033	26											0						TAATTTCTTCCGAATTCAAAA	0.408													15	61	---	---	---	---	capture	Nonsense_Mutation	SNP	96906137	96906137	LOC285033	2	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	8792	114
CNTNAP5	129684	broad.mit.edu	37	2	125530374	125530374	+	Splice_Site	SNP	A	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125530374A>T	uc002tno.2	+	17	2895	c.2531_splice	c.e17-2	p.S844_splice	CNTNAP5_uc010flu.2_Splice_Site_p.S845_splice	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTCCGGTTTCAGCTCCTTCAG	0.458													3	72	---	---	---	---	capture	Splice_Site	SNP	125530374	125530374	CNTNAP5	2	A	T	T	T	1	0	0	0	0	0	0	1	0	91	7	5	4	3615	114
FAM128B	80097	broad.mit.edu	37	2	130948160	130948160	+	Silent	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:130948160G>A	uc002tqu.2	+	3	591	c.438G>A	c.(436-438)GGG>GGA	p.G146G		NM_025029	NP_079305	Q6NZ67	MZT2B_HUMAN	hypothetical protein LOC80097	146						centrosome|gamma-tubulin ring complex|spindle	protein binding				0	Colorectal(110;0.1)					TGCCCAAGGGGGGCGGGCCTG	0.647													11	48	---	---	---	---	capture	Silent	SNP	130948160	130948160	FAM128B	2	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	5389	114
PCK1	5105	broad.mit.edu	37	20	56139269	56139269	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56139269G>A	uc002xyn.3	+	7	1169	c.1006G>A	c.(1006-1008)GCT>ACT	p.A336T	PCK1_uc010zzm.1_Missense_Mutation_p.A19T	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	336					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TTTCGGTGTCGCTCCTGGGAC	0.493													11	40	---	---	---	---	capture	Missense_Mutation	SNP	56139269	56139269	PCK1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11484	114
SLC17A9	63910	broad.mit.edu	37	20	61588307	61588307	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61588307G>A	uc002yea.3	+	2	434	c.250G>A	c.(250-252)GGG>AGG	p.G84R	SLC17A9_uc002ydz.3_Missense_Mutation_p.G78R|SLC17A9_uc011aap.1_Missense_Mutation_p.G104R	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	84	Helical; (Potential).				exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2						CGGCCACCTCGGGGATCGGTA	0.662													11	43	---	---	---	---	capture	Missense_Mutation	SNP	61588307	61588307	SLC17A9	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14317	114
ANKRD28	23243	broad.mit.edu	37	3	15712040	15712040	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15712040C>T	uc003caj.1	-	28	3042	c.2899G>A	c.(2899-2901)GCT>ACT	p.A967T	ANKRD28_uc003cai.1_Missense_Mutation_p.A813T|ANKRD28_uc011avz.1_Missense_Mutation_p.A813T|ANKRD28_uc003cak.1_RNA|ANKRD28_uc011avy.1_Missense_Mutation_p.A47T	NM_015199	NP_056014	O15084	ANR28_HUMAN	ankyrin repeat domain 28	967						nucleoplasm	protein binding			breast(1)	1						TTATTGGGAGCACAGGCCAAA	0.398													10	52	---	---	---	---	capture	Missense_Mutation	SNP	15712040	15712040	ANKRD28	3	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	652	114
OXNAD1	92106	broad.mit.edu	37	3	16343240	16343240	+	Silent	SNP	A	G	G			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:16343240A>G	uc003caw.2	+	7	997	c.540A>G	c.(538-540)GGA>GGG	p.G180G	OXNAD1_uc010her.1_RNA|OXNAD1_uc003cax.2_Silent_p.G180G|OXNAD1_uc011awb.1_Silent_p.G198G	NM_138381	NP_612390	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	180	NAD (By similarity).|FAD-binding FR-type.						oxidoreductase activity			skin(1)	1						GAGGAGTCGGAATTAACCCTC	0.483													11	29	---	---	---	---	capture	Silent	SNP	16343240	16343240	OXNAD1	3	A	G	G	G	1	0	0	0	0	0	0	0	1	106	9	3	3	11237	114
ZNF619	285267	broad.mit.edu	37	3	40529457	40529457	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:40529457G>A	uc011azb.1	+	6	1854	c.1576G>A	c.(1576-1578)GGA>AGA	p.G526R	ZNF619_uc010hhz.2_Missense_Mutation_p.G477R|ZNF619_uc003ckj.2_Missense_Mutation_p.G470R|ZNF619_uc011azc.1_Missense_Mutation_p.G486R|ZNF619_uc011azd.1_Missense_Mutation_p.G442R|ZNF619_uc011aza.1_Missense_Mutation_p.G428R	NM_001145082	NP_001138554	E9PCD9	E9PCD9_HUMAN	zinc finger protein 619 isoform 1	526					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		ACTCATCAATGGAACAGGGCT	0.537													10	29	---	---	---	---	capture	Missense_Mutation	SNP	40529457	40529457	ZNF619	3	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	17921	114
RBM15B	29890	broad.mit.edu	37	3	51430156	51430156	+	Silent	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51430156G>A	uc003dbd.2	+	1	1426	c.1326G>A	c.(1324-1326)GGG>GGA	p.G442G		NM_013286	NP_037418	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	442	RRM 3.				interspecies interaction between organisms|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleoplasm	nucleotide binding|protein binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACCGCTTTGGGAGCATTCGGA	0.572													6	107	---	---	---	---	capture	Silent	SNP	51430156	51430156	RBM15B	3	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	13012	114
BOD1L	259282	broad.mit.edu	37	4	13603360	13603360	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13603360C>T	uc003gmz.1	-	10	5281	c.5164G>A	c.(5164-5166)GAA>AAA	p.E1722K	BOD1L_uc010idr.1_Missense_Mutation_p.E1059K	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1722							DNA binding			ovary(5)|breast(1)	6						CCCTCTGTTTCTTTTTTGGGA	0.493													29	124	---	---	---	---	capture	Missense_Mutation	SNP	13603360	13603360	BOD1L	4	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	1471	114
UGT8	7368	broad.mit.edu	37	4	115544445	115544445	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:115544445G>C	uc003ibs.2	+	2	931	c.409G>C	c.(409-411)GTG>CTG	p.V137L	UGT8_uc003ibt.2_Missense_Mutation_p.V137L|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	137					central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		CCTGCTGCTGGTGGACCCTAA	0.438													24	83	---	---	---	---	capture	Missense_Mutation	SNP	115544445	115544445	UGT8	4	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	16847	114
ODZ3	55714	broad.mit.edu	37	4	183714528	183714528	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183714528C>T	uc003ivd.1	+	25	6740	c.6703C>T	c.(6703-6705)CGT>TGT	p.R2235C		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	2235	YD 22.|Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CCTGGGAAGGCGTGTTTCTAG	0.453													12	47	---	---	---	---	capture	Missense_Mutation	SNP	183714528	183714528	ODZ3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10741	114
MARCH6	10299	broad.mit.edu	37	5	10394249	10394249	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:10394249G>A	uc003jet.1	+	8	1005	c.822G>A	c.(820-822)TGG>TGA	p.W274*	MARCH6_uc011cmu.1_Nonsense_Mutation_p.W226*|MARCH6_uc003jeu.1_5'UTR|MARCH6_uc011cmv.1_Nonsense_Mutation_p.W169*	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	274	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						AGCTTACATGGGAAAGAGTAA	0.303													5	23	---	---	---	---	capture	Nonsense_Mutation	SNP	10394249	10394249	MARCH6	5	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	9218	114
SLC26A2	1836	broad.mit.edu	37	5	149360771	149360771	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149360771A>G	uc003lrh.2	+	3	1883	c.1615A>G	c.(1615-1617)ATA>GTA	p.I539V		NM_000112	NP_000103	P50443	S26A2_HUMAN	solute carrier family 26 member 2	539	Helical; (Potential).					integral to plasma membrane|membrane fraction	secondary active sulfate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TTGTTTTTCTATATTTTGTGT	0.423													43	142	---	---	---	---	capture	Missense_Mutation	SNP	149360771	149360771	SLC26A2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	14409	114
VARS	7407	broad.mit.edu	37	6	31746760	31746760	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31746760T>C	uc003nxe.2	-	29	4133	c.3710A>G	c.(3709-3711)GAG>GGG	p.E1237G	C6orf27_uc011dog.1_5'Flank|C6orf27_uc003nxd.2_5'Flank|C6orf27_uc011doh.1_5'Flank|VARS_uc003nxf.1_Missense_Mutation_p.E174G	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase	1237					translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3					L-Valine(DB00161)	TTCATCTGCCTCCTGGACTTC	0.562													16	41	---	---	---	---	capture	Missense_Mutation	SNP	31746760	31746760	VARS	6	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17005	114
SLC22A7	10864	broad.mit.edu	37	6	43269393	43269393	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43269393C>T	uc003out.2	+	7	1123	c.1024C>T	c.(1024-1026)CGG>TGG	p.R342W	SLC22A7_uc010jyl.1_Missense_Mutation_p.R343W|SLC22A7_uc003ous.2_Missense_Mutation_p.R340W	NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	solute carrier family 22 member 7 isoform b	342						basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			CCGCACACCACGGCTCCGACA	0.617													6	35	---	---	---	---	capture	Missense_Mutation	SNP	43269393	43269393	SLC22A7	6	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	14351	114
GFRAL	389400	broad.mit.edu	37	6	55264168	55264168	+	Silent	SNP	A	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55264168A>T	uc003pcm.1	+	8	1136	c.1050A>T	c.(1048-1050)GGA>GGT	p.G350G		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	350	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTTTTCTAGGAGAAGTAATCT	0.313													13	51	---	---	---	---	capture	Silent	SNP	55264168	55264168	GFRAL	6	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	6290	114
IMPG1	3617	broad.mit.edu	37	6	76731930	76731930	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76731930G>A	uc003pik.1	-	6	699	c.569C>T	c.(568-570)GCC>GTC	p.A190V		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	190					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TGAGACGTTGGCAACATCTGT	0.378													12	49	---	---	---	---	capture	Missense_Mutation	SNP	76731930	76731930	IMPG1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7651	114
SLC22A3	6581	broad.mit.edu	37	6	160828117	160828117	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160828117G>A	uc003qti.2	+	3	605	c.578G>A	c.(577-579)GGC>GAC	p.G193D	SLC22A3_uc011efx.1_RNA	NM_021977	NP_068812	O75751	S22A3_HUMAN	solute carrier family 22 member 3	193	Helical; (Potential).					integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)		CTTGGTGTTGGCGTCACTGGG	0.473													24	98	---	---	---	---	capture	Missense_Mutation	SNP	160828117	160828117	SLC22A3	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14347	114
EGFR	1956	broad.mit.edu	37	7	55268881	55268881	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55268881G>A	uc003tqk.2	+	25	3193	c.2947G>A	c.(2947-2949)GGG>AGG	p.G983R	EGFR_uc010kzg.1_Missense_Mutation_p.G938R|EGFR_uc011kco.1_Missense_Mutation_p.G930R	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	983	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCTGCACCAGGGGGATGAAAG	0.512		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			9	896	---	---	---	---	capture	Missense_Mutation	SNP	55268881	55268881	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4922	114
PCLO	27445	broad.mit.edu	37	7	82595087	82595087	+	Silent	SNP	T	C	C			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82595087T>C	uc003uhx.2	-	4	4306	c.4017A>G	c.(4015-4017)ACA>ACG	p.T1339T	PCLO_uc003uhv.2_Silent_p.T1339T	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTTAACTTACTGTTTTTTCTT	0.338													23	89	---	---	---	---	capture	Silent	SNP	82595087	82595087	PCLO	7	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	11486	114
AKR1B10	57016	broad.mit.edu	37	7	134222353	134222353	+	Silent	SNP	C	G	G			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134222353C>G	uc003vrr.2	+	7	1001	c.681C>G	c.(679-681)TCC>TCG	p.S227S		NM_020299	NP_064695	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10	227					cellular aldehyde metabolic process|digestion|steroid metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|protein binding			skin(5)	5						AAGACCCTTCCCTGCTGGAGG	0.463													8	131	---	---	---	---	capture	Silent	SNP	134222353	134222353	AKR1B10	7	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	467	114
EPHA1	2041	broad.mit.edu	37	7	143097029	143097029	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143097029C>T	uc003wcz.2	-	4	637	c.550G>A	c.(550-552)GCT>ACT	p.A184T		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	184	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TTGTGGAAAGCGAGGTAGAGG	0.617													4	19	---	---	---	---	capture	Missense_Mutation	SNP	143097029	143097029	EPHA1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5120	114
NCAPG2	54892	broad.mit.edu	37	7	158447341	158447341	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:158447341C>A	uc003wnv.1	-	22	2837	c.2692G>T	c.(2692-2694)GAC>TAC	p.D898Y	NCAPG2_uc010lqu.1_Missense_Mutation_p.D690Y|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Missense_Mutation_p.D898Y|NCAPG2_uc011kwe.1_Missense_Mutation_p.D898Y|NCAPG2_uc011kwc.1_Missense_Mutation_p.D399Y|NCAPG2_uc011kwd.1_Missense_Mutation_p.D341Y	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	898					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		AACTGATGGTCACCAAGGCCT	0.428													30	175	---	---	---	---	capture	Missense_Mutation	SNP	158447341	158447341	NCAPG2	7	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	10115	114
FTHL17	53940	broad.mit.edu	37	X	31089936	31089936	+	Silent	SNP	G	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:31089936G>A	uc004dcl.1	-	1	238	c.135C>T	c.(133-135)GAC>GAT	p.D45D		NM_031894	NP_114100	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	45	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity				0						GGGCCACGTCGTCCCGGTTGA	0.582													26	35	---	---	---	---	capture	Silent	SNP	31089936	31089936	FTHL17	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6025	114
AMBRA1	55626	broad.mit.edu	37	11	46439460	46439461	+	Splice_Site	INS	-	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46439460_46439461insA	uc010rgu.1	-	15	3476	c.3116_splice	c.e15+1	p.E1039_splice	AMBRA1_uc010rgt.1_Splice_Site_p.E605_splice|AMBRA1_uc009ylc.1_Splice_Site_p.E1010_splice|AMBRA1_uc001ncu.1_Splice_Site_p.E949_splice|AMBRA1_uc001ncv.2_Splice_Site_p.E1042_splice|AMBRA1_uc001ncw.2_Splice_Site_p.E920_splice|AMBRA1_uc001ncx.2_Splice_Site_p.E979_splice	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TTAAGCCACTTACTCTGGTCGG	0.525													38	119	---	---	---	---	capture_indel	Splice_Site	INS	46439460	46439461	AMBRA1	11	-	A	A	A	1	0	1	1	0	0	0	1	0	781	61	5	5	565	114
CDKL3	51265	broad.mit.edu	37	5	133634348	133634349	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:133634348_133634349insA	uc003kzf.3	-	13	1891_1892	c.1772_1773insT	c.(1771-1773)TTCfs	p.F591fs	CDKL3_uc011cxm.1_Intron|CDKL3_uc011cxn.1_Intron|CDKL3_uc010jdw.2_Intron|CDKL3_uc011cxo.1_Intron|CDKL3_uc011cxp.1_Intron|CDKL3_uc011cxq.1_3'UTR	NM_001113575	NP_001107047	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3 isoform 1	591						cytoplasm	ATP binding|cyclin-dependent protein kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GACACTACCAGAAAAAAAACCT	0.356													8	175	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	133634348	133634349	CDKL3	5	-	A	A	A	1	0	1	1	0	0	0	0	0	425	33	5	5	3125	114
NKAIN3	286183	broad.mit.edu	37	8	63659690	63659691	+	Splice_Site	INS	-	A	A			TCGA-06-6700-01	TCGA-06-6700-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:63659690_63659691insA	uc010lyq.1	+	4	603	c.471_splice	c.e4+2	p.S157_splice		NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				CTACTCTCTGTAAGTGTCACTT	0.441													13	30	---	---	---	---	capture_indel	Splice_Site	INS	63659690	63659691	NKAIN3	8	-	A	A	A	1	0	1	1	0	0	0	1	0	741	57	5	5	10344	114
