Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHA10	284656	broad.mit.edu	37	1	38197144	38197144	+	Silent	SNP	C	T	T	rs77925917	by1000genomes	TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38197144C>T	uc009vvi.2	-	7	1688	c.1602G>A	c.(1600-1602)CCG>CCA	p.P534P	EPHA10_uc009vvh.1_RNA|EPHA10_uc001cbu.2_RNA|EPHA10_uc001cbv.1_RNA	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	534	Fibronectin type-III 2.|Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGGATGGCCCCGGGGAAGCGG	0.597													4	134	---	---	---	---	capture	Silent	SNP	38197144	38197144	EPHA10	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5121	115
TMEM69	51249	broad.mit.edu	37	1	46159245	46159245	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46159245T>C	uc001cor.1	+	3	608	c.412T>C	c.(412-414)TCT>CCT	p.S138P		NM_016486	NP_057570	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	138	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CAGTTTCCTATCTTTCTTGGG	0.443													19	130	---	---	---	---	capture	Missense_Mutation	SNP	46159245	46159245	TMEM69	1	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	16081	115
KIAA1324	57535	broad.mit.edu	37	1	109737164	109737164	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109737164C>T	uc001dwq.2	+	16	2205	c.2069C>T	c.(2068-2070)TCC>TTC	p.S690F	KIAA1324_uc009wex.1_Missense_Mutation_p.S640F|KIAA1324_uc009wey.2_Missense_Mutation_p.S603F|KIAA1324_uc010ovg.1_Missense_Mutation_p.S588F|KIAA1324_uc001dwr.2_Missense_Mutation_p.S340F|KIAA1324_uc001dws.1_5'Flank|KIAA1324_uc009wez.1_5'Flank	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor	690	Extracellular (Potential).				macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		AGCTTCACTTCCAAAGGGCTG	0.493													40	51	---	---	---	---	capture	Missense_Mutation	SNP	109737164	109737164	KIAA1324	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8145	115
CEP170	9859	broad.mit.edu	37	1	243332957	243332957	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:243332957A>G	uc001hzs.2	-	12	2224	c.1816T>C	c.(1816-1818)TTT>CTT	p.F606L	CEP170_uc001hzt.2_Missense_Mutation_p.F508L|CEP170_uc001hzu.2_Missense_Mutation_p.F508L	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	606						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GGTGCAGAAAATTCCATTATC	0.294													9	17	---	---	---	---	capture	Missense_Mutation	SNP	243332957	243332957	CEP170	1	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	3218	115
OGDHL	55753	broad.mit.edu	37	10	50955213	50955213	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50955213C>G	uc001jie.2	-	9	1171	c.1029G>C	c.(1027-1029)GAG>GAC	p.E343D	OGDHL_uc009xog.2_Missense_Mutation_p.E370D|OGDHL_uc010qgt.1_Missense_Mutation_p.E286D|OGDHL_uc010qgu.1_Missense_Mutation_p.E134D|OGDHL_uc009xoh.2_Missense_Mutation_p.E134D	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	343					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						GGTTGATCCTCTCATGGTACA	0.587													48	51	---	---	---	---	capture	Missense_Mutation	SNP	50955213	50955213	OGDHL	10	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	10745	115
ENTPD1	953	broad.mit.edu	37	10	97607463	97607463	+	Silent	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:97607463G>A	uc001klh.3	+	7	1398	c.1074G>A	c.(1072-1074)GGG>GGA	p.G358G	ENTPD1_uc001kli.3_Silent_p.G365G|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Silent_p.G370G|ENTPD1_uc010qok.1_Silent_p.G250G|ENTPD1_uc010qol.1_Silent_p.G250G|ENTPD1_uc010qom.1_Silent_p.G317G|ENTPD1_uc010qon.1_Silent_p.G220G|ENTPD1_uc009xva.2_Silent_p.G220G|ENTPD1_uc009xuz.2_RNA	NM_001776	NP_001767	P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	358	Extracellular (Potential).				cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		GGGATTTTGGGGTAAGTTTGT	0.303													10	144	---	---	---	---	capture	Silent	SNP	97607463	97607463	ENTPD1	10	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	5093	115
ACADSB	36	broad.mit.edu	37	10	124813243	124813243	+	Silent	SNP	T	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124813243T>C	uc001lhb.2	+	11	1378	c.1261T>C	c.(1261-1263)TTG>CTG	p.L421L	ACADSB_uc010qub.1_Silent_p.L319L	NM_001609	NP_001600	P45954	ACDSB_HUMAN	acyl-Coenzyme A dehydrogenase, short/branched	421					branched chain family amino acid catabolic process|fatty acid metabolic process	mitochondrial matrix	flavin adenine dinucleotide binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)	CAACATCCAGTTGAACACCAT	0.393													44	68	---	---	---	---	capture	Silent	SNP	124813243	124813243	ACADSB	10	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	115	115
MMP26	56547	broad.mit.edu	37	11	5012728	5012728	+	Splice_Site	SNP	T	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5012728T>C	uc001lzv.2	+	4	613	c.595_splice	c.e4+2	p.G199_splice		NM_021801	NP_068573	Q9NRE1	MMP26_HUMAN	matrix metalloproteinase 26 preproprotein						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)		CAGACACTGGTAAATGCCTTG	0.483													3	141	---	---	---	---	capture	Splice_Site	SNP	5012728	5012728	MMP26	11	T	C	C	C	1	0	0	0	0	0	0	1	0	741	57	5	3	9575	115
DDN	23109	broad.mit.edu	37	12	49391285	49391285	+	Silent	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49391285C>T	uc001rsv.1	-	2	1392	c.1374G>A	c.(1372-1374)ACG>ACA	p.T458T	uc001rsw.2_5'Flank	NM_015086	NP_055901	O94850	DEND_HUMAN	dendrin	458	Interaction with CD2AP and NPHS1 (By similarity).					dendritic spine membrane|endoplasmic reticulum membrane|nucleus|perikaryon				large_intestine(1)	1						TCACTACGCACGTGGCGTCAA	0.642													19	77	---	---	---	---	capture	Silent	SNP	49391285	49391285	DDN	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4292	115
TSPAN19	144448	broad.mit.edu	37	12	85411285	85411285	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85411285T>A	uc009zsj.2	-	7	645	c.544A>T	c.(544-546)ACT>TCT	p.T182S		NM_001100917	NP_001094387	P0C672	TSN19_HUMAN	tetraspanin 19	182						integral to membrane				ovary(1)	1						TTTCTTAAAGTTGACTTTGTG	0.343													10	14	---	---	---	---	capture	Missense_Mutation	SNP	85411285	85411285	TSPAN19	12	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	16526	115
GPR109B	8843	broad.mit.edu	37	12	123200903	123200903	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123200903G>A	uc001ucy.3	-	1	537	c.382C>T	c.(382-384)CGG>TGG	p.R128W	GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B	128	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	TGGACCACCCGGAAATACCTG	0.562													4	85	---	---	---	---	capture	Missense_Mutation	SNP	123200903	123200903	GPR109B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	6560	115
TRPC4	7223	broad.mit.edu	37	13	38320377	38320377	+	Silent	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:38320377G>A	uc001uws.2	-	3	829	c.594C>T	c.(592-594)AAC>AAT	p.N198N	TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Silent_p.N198N|TRPC4_uc010tey.1_Silent_p.N198N|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Silent_p.N198N|TRPC4_uc010aby.2_Silent_p.N198N	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	198	Cytoplasmic (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CCTTGTAGATGTTGAGTCTGG	0.532													11	46	---	---	---	---	capture	Silent	SNP	38320377	38320377	TRPC4	13	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	16463	115
CDH24	64403	broad.mit.edu	37	14	23524268	23524268	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23524268C>T	uc001wil.2	-	3	756	c.496G>A	c.(496-498)GGG>AGG	p.G166R	CDH24_uc010akf.2_Missense_Mutation_p.G166R|CDH24_uc001win.3_Missense_Mutation_p.G166R	NM_022478	NP_071923	Q86UP0	CAD24_HUMAN	cadherin-like 24 isoform 1	166	Cadherin 2.|Extracellular (Potential).				adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding			central_nervous_system(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		GGGTGCTCACCGACATTGGAC	0.552											OREG0022594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	59	86	---	---	---	---	capture	Missense_Mutation	SNP	23524268	23524268	CDH24	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3080	115
ZNF710	374655	broad.mit.edu	37	15	90610834	90610834	+	Silent	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90610834C>T	uc002bov.1	+	2	588	c.465C>T	c.(463-465)GCC>GCT	p.A155A		NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	155					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			AGAGCAGCGCCGTCAAGATGA	0.687													8	14	---	---	---	---	capture	Silent	SNP	90610834	90610834	ZNF710	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17991	115
WDR90	197335	broad.mit.edu	37	16	703624	703624	+	Missense_Mutation	SNP	T	G	G			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:703624T>G	uc002cii.1	+	12	1387	c.1333T>G	c.(1333-1335)TGC>GGC	p.C445G	WDR90_uc002cig.1_Missense_Mutation_p.C445G|WDR90_uc002cih.1_Missense_Mutation_p.C446G|WDR90_uc002cij.1_RNA|WDR90_uc002cik.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	445	WD 1.									ovary(1)	1		Hepatocellular(780;0.0218)				GACCGGGCGGTGCTTGTGCCT	0.657													5	52	---	---	---	---	capture	Missense_Mutation	SNP	703624	703624	WDR90	16	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	17218	115
IGFALS	3483	broad.mit.edu	37	16	1842222	1842222	+	Missense_Mutation	SNP	G	A	A	rs145465654		TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1842222G>A	uc002cmy.2	-	2	278	c.197C>T	c.(196-198)ACG>ATG	p.T66M	IGFALS_uc010uvn.1_Missense_Mutation_p.T104M|IGFALS_uc010uvo.1_Translation_Start_Site	NM_004970	NP_004961	P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid	66	LRRNT.				cell adhesion|signal transduction	soluble fraction	insulin-like growth factor binding				0						AGGCAGGCGCGTGAGGTTCCT	0.692													5	41	---	---	---	---	capture	Missense_Mutation	SNP	1842222	1842222	IGFALS	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7502	115
TP53	7157	broad.mit.edu	37	17	7577096	7577097	+	Missense_Mutation	DNP	TC	GG	GG			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577096_7577097TC>GG	uc002gim.2	-	8	1035_1036	c.841_842GA>CC	c.(841-843)GAC>CCC	p.D281P	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.D281P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D149P|TP53_uc010cng.1_Missense_Mutation_p.D149P|TP53_uc002gii.1_Missense_Mutation_p.D149P|TP53_uc010cnh.1_Missense_Mutation_p.D281P|TP53_uc010cni.1_Missense_Mutation_p.D281P|TP53_uc002gij.2_Missense_Mutation_p.D281P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	281	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> A (in sporadic cancers; somatic mutation).|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.D281E(25)|p.D281H(19)|p.D281N(18)|p.D281G(10)|p.0?(7)|p.D281Y(6)|p.D281D(5)|p.D281V(3)|p.D281fs*63(2)|p.?(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.D281R(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGTGCGCCGGTCTCTCCCAGGA	0.550		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			33	5	---	---	---	---	capture	Missense_Mutation	DNP	7577096	7577097	TP53	17	TC	GG	GG	GG	1	0	0	0	0	1	0	0	0	754	58	4	4	16264	115
FOXN1	8456	broad.mit.edu	37	17	26851529	26851529	+	Silent	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26851529C>T	uc010crm.2	+	3	330	c.132C>T	c.(130-132)GCC>GCT	p.A44A	FOXN1_uc002hbj.2_Silent_p.A44A	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	44					defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					AGAAGCATGCCGGCTTCAGCT	0.637													11	94	---	---	---	---	capture	Silent	SNP	26851529	26851529	FOXN1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5963	115
ANKRD13B	124930	broad.mit.edu	37	17	27939701	27939701	+	Silent	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27939701G>A	uc002hei.2	+	13	1556	c.1443G>A	c.(1441-1443)GCG>GCA	p.A481A	ANKRD13B_uc002heh.2_Silent_p.A349A|ANKRD13B_uc002hej.2_RNA|ANKRD13B_uc002hek.2_5'UTR	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	481											0						TCTCCCCAGCGTTGTTCGAGG	0.751													7	16	---	---	---	---	capture	Silent	SNP	27939701	27939701	ANKRD13B	17	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	639	115
C18orf22	79863	broad.mit.edu	37	18	77794598	77794598	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77794598C>T	uc002lns.2	+	1	241	c.103C>T	c.(103-105)CAC>TAC	p.H35Y	TXNL4A_uc010drg.2_5'Flank|C18orf22_uc010drh.2_Missense_Mutation_p.H35Y|C18orf22_uc010dri.1_RNA	NM_024805	NP_079081	Q8N0V3	RBFA_HUMAN	hypothetical protein LOC79863 precursor	35					rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)		GCGGGGACTTCACTGCTCTGC	0.662													25	45	---	---	---	---	capture	Missense_Mutation	SNP	77794598	77794598	C18orf22	18	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	1882	115
MAST1	22983	broad.mit.edu	37	19	12977473	12977473	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12977473C>T	uc002mvm.2	+	18	2164	c.2036C>T	c.(2035-2037)TCA>TTA	p.S679L		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	679	AGC-kinase C-terminal.				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						CCAGCCCGCTCAGACAGGTAT	0.597													4	25	---	---	---	---	capture	Missense_Mutation	SNP	12977473	12977473	MAST1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	9237	115
CYP4F8	11283	broad.mit.edu	37	19	15734860	15734860	+	Silent	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15734860G>A	uc002nbi.2	+	11	1135	c.1071G>A	c.(1069-1071)GAG>GAA	p.E357E	CYP4F8_uc010xoj.1_Silent_p.E169E	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,	357					prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						GCCGGCAGGAGGTGCAAGAGC	0.582													21	76	---	---	---	---	capture	Silent	SNP	15734860	15734860	CYP4F8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	4151	115
PSG6	5675	broad.mit.edu	37	19	43420415	43420415	+	Nonsense_Mutation	SNP	G	A	A	rs112289603	byFrequency	TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43420415G>A	uc002ovj.1	-	2	341	c.289C>T	c.(289-291)CGA>TGA	p.R97*	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ovf.1_Nonsense_Mutation_p.R97*|PSG6_uc002ovg.1_Nonsense_Mutation_p.R97*	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	97	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				ACTGTTTCTCGTCCACTGTAG	0.458													133	322	---	---	---	---	capture	Nonsense_Mutation	SNP	43420415	43420415	PSG6	19	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	12554	115
DKKL1	27120	broad.mit.edu	37	19	49867855	49867855	+	Silent	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49867855C>T	uc002pnk.2	+	2	241	c.27C>T	c.(25-27)CCC>CCT	p.P9P	TEAD2_uc002pni.2_5'Flank|TEAD2_uc002pnj.2_5'Flank|TEAD2_uc010yao.1_5'Flank|TEAD2_uc010emw.2_5'Flank	NM_014419	NP_055234	Q9UK85	DKKL1_HUMAN	dickkopf-like 1 precursor	9					anatomical structure morphogenesis	extracellular space	protein binding|signal transducer activity				0		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		CACCTGCCCCCGCAAGGCGGC	0.677													12	33	---	---	---	---	capture	Silent	SNP	49867855	49867855	DKKL1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4506	115
SERTAD2	9792	broad.mit.edu	37	2	64863336	64863336	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:64863336A>T	uc002sde.1	-	2	967	c.670T>A	c.(670-672)TCT>ACT	p.S224T		NM_014755	NP_055570	Q14140	SRTD2_HUMAN	SERTA domain containing 2	224					negative regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleus					0						CCAGGCAGAGAGTCCATCAGT	0.527													34	55	---	---	---	---	capture	Missense_Mutation	SNP	64863336	64863336	SERTAD2	2	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	14014	115
TTC31	64427	broad.mit.edu	37	2	74718780	74718780	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74718780A>T	uc002slt.2	+	8	880	c.857A>T	c.(856-858)CAG>CTG	p.Q286L	TTC31_uc002sls.2_Missense_Mutation_p.Q215L|TTC31_uc010yrv.1_Intron|TTC31_uc002slu.2_Missense_Mutation_p.Q142L	NM_022492	NP_071937	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	286							binding				0						GAGAGGCCCCAGCAGAGTCCA	0.597													18	37	---	---	---	---	capture	Missense_Mutation	SNP	74718780	74718780	TTC31	2	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	16582	115
IL18RAP	8807	broad.mit.edu	37	2	103067331	103067331	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103067331G>A	uc002tbx.2	+	11	1718	c.1234G>A	c.(1234-1236)GTA>ATA	p.V412I	IL18RAP_uc010fiz.2_Missense_Mutation_p.V270I	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	412	TIR.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						TGATGCTTTCGTATCCTATGC	0.338													6	122	---	---	---	---	capture	Missense_Mutation	SNP	103067331	103067331	IL18RAP	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7571	115
ZNF385B	151126	broad.mit.edu	37	2	180634432	180634432	+	Silent	SNP	G	A	A	rs61747266	byFrequency;by1000genomes	TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:180634432G>A	uc002unn.3	-	3	655	c.51C>T	c.(49-51)AAC>AAT	p.N17N		NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1	17						nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CAGGCCTGTCGTTCTTTATCC	0.463													6	113	---	---	---	---	capture	Silent	SNP	180634432	180634432	ZNF385B	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	17757	115
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma 								30	39	---	---	---	---	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	115
IRS1	3667	broad.mit.edu	37	2	227661259	227661259	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227661259G>C	uc002voh.3	-	1	2248	c.2196C>G	c.(2194-2196)TAC>TAG	p.Y732*		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	732	YXXM motif 6.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		ACATGTTCATGTAGTCACCTG	0.597											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	186	---	---	---	---	capture	Nonsense_Mutation	SNP	227661259	227661259	IRS1	2	G	C	C	C	1	0	0	0	0	0	1	0	0	620	48	5	4	7763	115
APOBEC3G	60489	broad.mit.edu	37	22	39479797	39479797	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39479797C>T	uc003awx.2	+	5	985	c.643C>T	c.(643-645)CGG>TGG	p.R215W	APOBEC3G_uc003awy.2_Missense_Mutation_p.R148W	NM_021822	NP_068594	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	215					base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2	Melanoma(58;0.04)					GGTCAGAGGACGGCATGAGAC	0.522													58	55	---	---	---	---	capture	Missense_Mutation	SNP	39479797	39479797	APOBEC3G	22	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	787	115
RNF123	63891	broad.mit.edu	37	3	49735348	49735348	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49735348C>T	uc003cxh.2	+	6	459	c.373C>T	c.(373-375)CGC>TGC	p.R125C	RNF123_uc010hky.1_5'Flank|RNF123_uc003cxi.2_5'Flank	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	125	B30.2/SPRY.					cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TGGCACCATCCGCTCTACCAC	0.557													123	170	---	---	---	---	capture	Missense_Mutation	SNP	49735348	49735348	RNF123	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13325	115
EPHA3	2042	broad.mit.edu	37	3	89462354	89462354	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:89462354T>C	uc003dqy.2	+	10	2051	c.1826T>C	c.(1825-1827)GTT>GCT	p.V609A	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	609	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		ACCCAAGCTGTTCATGAGTTT	0.423										TSP Lung(6;0.00050)			53	69	---	---	---	---	capture	Missense_Mutation	SNP	89462354	89462354	EPHA3	3	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	5123	115
FRAS1	80144	broad.mit.edu	37	4	79429983	79429983	+	Silent	SNP	C	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79429983C>A	uc003hlb.2	+	63	10043	c.9603C>A	c.(9601-9603)CCC>CCA	p.P3201P	FRAS1_uc003hlc.1_Silent_p.P203P	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3196	Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GTGTCACCCCCTGCGACCCTC	0.567													9	27	---	---	---	---	capture	Silent	SNP	79429983	79429983	FRAS1	4	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	5986	115
COPS4	51138	broad.mit.edu	37	4	83970319	83970319	+	Missense_Mutation	SNP	T	G	G			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:83970319T>G	uc003hoa.2	+	3	294	c.155T>G	c.(154-156)ATG>AGG	p.M52R	COPS4_uc003hob.2_Missense_Mutation_p.M52R|COPS4_uc010ijw.2_Missense_Mutation_p.M52R|COPS4_uc010ijx.2_Missense_Mutation_p.M52R	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	52					cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				TTTAAACAAGTGGTAAATGAG	0.318													6	69	---	---	---	---	capture	Missense_Mutation	SNP	83970319	83970319	COPS4	4	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	3700	115
RGNEF	64283	broad.mit.edu	37	5	73128199	73128199	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73128199C>T	uc011csq.1	+	9	1072	c.1061C>T	c.(1060-1062)CCC>CTC	p.P354L	RGNEF_uc003kcx.2_Missense_Mutation_p.P354L|RGNEF_uc003kcy.1_Missense_Mutation_p.P354L|RGNEF_uc010izf.2_Missense_Mutation_p.P354L|RGNEF_uc011csr.1_Missense_Mutation_p.P41L	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	354					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		TCCAAGCCGCCCTCGACATTG	0.448													9	20	---	---	---	---	capture	Missense_Mutation	SNP	73128199	73128199	RGNEF	5	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	13178	115
ENC1	8507	broad.mit.edu	37	5	73931841	73931841	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73931841T>C	uc003kdc.3	-	2	1601	c.470A>G	c.(469-471)GAT>GGT	p.D157G	ENC1_uc011css.1_Missense_Mutation_p.D84G	NM_003633	NP_003624	O14682	ENC1_HUMAN	ectodermal-neural cortex (with BTB-like domain)	157					nervous system development	cytoplasm|cytoskeleton|nuclear matrix	actin binding			ovary(1)|pancreas(1)|skin(1)	3		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		CTGGTGTGCATCAGACAGCAG	0.517													46	77	---	---	---	---	capture	Missense_Mutation	SNP	73931841	73931841	ENC1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	5068	115
PCDHGB4	8641	broad.mit.edu	37	5	140769114	140769114	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140769114G>A	uc003lkc.1	+	1	1663	c.1663G>A	c.(1663-1665)GAC>AAC	p.D555N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.D555N	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	555	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACCGCAACGACAATGCGCC	0.672													13	39	---	---	---	---	capture	Missense_Mutation	SNP	140769114	140769114	PCDHGB4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11468	115
ELOVL2	54898	broad.mit.edu	37	6	10995345	10995345	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:10995345C>T	uc003mzp.3	-	5	561	c.400G>A	c.(400-402)GTT>ATT	p.V134I		NM_017770	NP_060240	Q9NXB9	ELOV2_HUMAN	elongation of very long chain fatty acids-like	134					fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			TTCCGCAAAACGAAGAAAATT	0.393													23	74	---	---	---	---	capture	Missense_Mutation	SNP	10995345	10995345	ELOVL2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5029	115
ITPR3	3710	broad.mit.edu	37	6	33654271	33654271	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33654271G>A	uc011drk.1	+	43	6173	c.5954G>A	c.(5953-5955)CGC>CAC	p.R1985H	ITPR3_uc003oey.2_Missense_Mutation_p.R72H	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	1985	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						TGCAAGTACCGCATGGATCTG	0.547													4	81	---	---	---	---	capture	Missense_Mutation	SNP	33654271	33654271	ITPR3	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7845	115
SNAI2	6591	broad.mit.edu	37	8	49832679	49832679	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:49832679T>C	uc003xqp.2	-	2	565	c.401A>G	c.(400-402)AAT>AGT	p.N134S		NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2	134	C2H2-type 1.				canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	p.N134D(1)		ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				ATAGGTCTTATTGCATAAATT	0.438													57	76	---	---	---	---	capture	Missense_Mutation	SNP	49832679	49832679	SNAI2	8	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	14719	115
ZFHX4	79776	broad.mit.edu	37	8	77617855	77617855	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:77617855C>T	uc003yav.2	+	2	1919	c.1532C>T	c.(1531-1533)TCA>TTA	p.S511L	ZFHX4_uc003yat.1_Missense_Mutation_p.S511L|ZFHX4_uc003yau.1_Missense_Mutation_p.S511L|ZFHX4_uc003yaw.1_Missense_Mutation_p.S511L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	511						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCTCCTTTATCATCCAGTGTG	0.413										HNSCC(33;0.089)			17	55	---	---	---	---	capture	Missense_Mutation	SNP	77617855	77617855	ZFHX4	8	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	17515	115
ZFHX4	79776	broad.mit.edu	37	8	77617897	77617897	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:77617897C>T	uc003yav.2	+	2	1961	c.1574C>T	c.(1573-1575)TCC>TTC	p.S525F	ZFHX4_uc003yat.1_Missense_Mutation_p.S525F|ZFHX4_uc003yau.1_Missense_Mutation_p.S525F|ZFHX4_uc003yaw.1_Missense_Mutation_p.S525F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	525	Poly-Ser.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACCTCGTCCTCCTCGGCGACT	0.433										HNSCC(33;0.089)			15	48	---	---	---	---	capture	Missense_Mutation	SNP	77617897	77617897	ZFHX4	8	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	17515	115
NPDC1	56654	broad.mit.edu	37	9	139934426	139934426	+	Silent	SNP	G	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139934426G>C	uc004ckt.2	-	8	1117	c.882C>G	c.(880-882)GCC>GCG	p.A294A	NPDC1_uc004ckr.2_Silent_p.A294A|NPDC1_uc004cks.2_Silent_p.A372A|NPDC1_uc004cku.2_Silent_p.A294A	NM_015392	NP_056207	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and	294						integral to membrane					0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		CACTCACCGGGGCCAGGCCCG	0.657													21	38	---	---	---	---	capture	Silent	SNP	139934426	139934426	NPDC1	9	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	10480	115
CSF2RA	1438	broad.mit.edu	37	X	1413266	1413266	+	Missense_Mutation	SNP	C	T	T	rs149974131	byFrequency	TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1413266C>T	uc010nct.2	+	9	1014	c.692C>T	c.(691-693)ACG>ATG	p.T231M	CSF2RA_uc011mhb.1_Missense_Mutation_p.T231M|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Missense_Mutation_p.T231M|CSF2RA_uc004cpo.2_Missense_Mutation_p.T231M|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Missense_Mutation_p.T98M|CSF2RA_uc004cpp.2_Missense_Mutation_p.T231M|CSF2RA_uc010ncv.2_Missense_Mutation_p.T231M|CSF2RA_uc004cpr.2_Missense_Mutation_p.T231M	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	231	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGCAACACGACGCACTGCCTC	0.572													72	162	---	---	---	---	capture	Missense_Mutation	SNP	1413266	1413266	CSF2RA	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3899	115
GTF2H1	2965	broad.mit.edu	37	11	18369162	18369162	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18369162delG	uc001moi.2	+	9	1559	c.865delG	c.(865-867)GCTfs	p.A289fs	GTF2H1_uc001moh.2_Frame_Shift_Del_p.A289fs|GTF2H1_uc009yhm.2_Frame_Shift_Del_p.A173fs|GTF2H1_uc001moj.2_5'UTR	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,	289					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0						TGTGCCATCTGCTTCCAATTC	0.368								NER					21	45	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	18369162	18369162	GTF2H1	11	G	-	-	-	1	0	1	0	1	0	0	0	0	598	46	5	5	6790	115
TMBIM4	51643	broad.mit.edu	37	12	66531936	66531937	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66531936_66531937insA	uc001stc.2	-	7	596_597	c.520_521insT	c.(520-522)TATfs	p.Y174fs	LLPH_uc010ssx.1_Intron|TMBIM4_uc001std.2_Frame_Shift_Ins_p.Y143fs|TMBIM4_uc009zqr.2_Frame_Shift_Ins_p.Y221fs|TMBIM4_uc001ste.2_RNA|TMBIM4_uc001stf.2_Frame_Shift_Ins_p.L162fs|TMBIM4_uc009zqs.2_Frame_Shift_Ins_p.F158fs	NM_016056	NP_057140	Q9HC24	TMBI4_HUMAN	transmembrane BAX inhibitor motif containing 4	174						integral to membrane	protein binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(28;0.0745)		TATCTCACTATAAAAAAAAAAC	0.351													7	47	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	66531936	66531937	TMBIM4	12	-	A	A	A	1	0	1	1	0	0	0	0	0	637	49	5	5	15867	115
A2BP1	54715	broad.mit.edu	37	16	7568147	7568148	+	Splice_Site	INS	-	G	G			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:7568147_7568148insG	uc002cys.2	+	5	1016	c.28_splice	c.e5-1	p.G10_splice	A2BP1_uc010buf.1_Splice_Site_p.G10_splice|A2BP1_uc002cyr.1_Splice_Site_p.G10_splice|A2BP1_uc002cyt.2_Splice_Site_p.G10_splice|A2BP1_uc010uxz.1_Splice_Site_p.G53_splice|A2BP1_uc010uya.1_Splice_Site_p.G46_splice|A2BP1_uc002cyv.1_Splice_Site_p.G10_splice|A2BP1_uc010uyb.1_Splice_Site_p.G10_splice|A2BP1_uc002cyw.2_Splice_Site_p.G30_splice|A2BP1_uc002cyy.2_Splice_Site_p.G30_splice|A2BP1_uc002cyx.2_Splice_Site_p.G30_splice|A2BP1_uc010uyc.1_Splice_Site_p.G30_splice	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TTGATTTTTCAGGGTAATCAGG	0.574													13	315	---	---	---	---	capture_indel	Splice_Site	INS	7568147	7568148	A2BP1	16	-	G	G	G	1	0	1	1	0	0	0	1	0	91	7	5	5	3	115
DHRS7B	25979	broad.mit.edu	37	17	21094331	21094333	+	In_Frame_Del	DEL	GAA	-	-			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21094331_21094333delGAA	uc002gyo.2	+	7	870_872	c.843_845delGAA	c.(841-846)GGGAAG>GGG	p.K285del		NM_015510	NP_056325	Q6IAN0	DRS7B_HUMAN	dehydrogenase/reductase (SDR family) member 7B	285	Peroxisomal (Potential).					integral to membrane|peroxisomal membrane	binding|oxidoreductase activity			pancreas(1)	1						CTGCTGTGGGGAAGAAGAAGAAA	0.507													7	291	---	---	---	---	capture_indel	In_Frame_Del	DEL	21094331	21094333	DHRS7B	17	GAA	-	-	-	1	0	1	0	1	0	0	0	0	522	41	5	5	4454	115
TAS2R1	50834	broad.mit.edu	37	5	9629276	9629276	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:9629276delT	uc003jem.1	-	1	1188	c.869delA	c.(868-870)AAGfs	p.K290fs		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	290	Cytoplasmic (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						GAGGAGGAACTTTTTTGCATT	0.393													12	110	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	9629276	9629276	TAS2R1	5	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	15453	115
CEL	1056	broad.mit.edu	37	9	135946657	135946658	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135946657_135946658insC	uc010naa.1	+	11	1793_1794	c.1777_1778insC	c.(1777-1779)GCCfs	p.A593fs		NM_001807	NP_001798	P19835	CEL_HUMAN	carboxyl ester lipase precursor	590	3.|17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification	cytosol|extracellular space	acylglycerol lipase activity|carboxylesterase activity|heparin binding|sterol esterase activity|triglyceride lipase activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TGACTCCGGGGCCCCCCCCGTG	0.817													2	4	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	135946657	135946658	CEL	9	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	3177	115
ATRX	546	broad.mit.edu	37	X	76888787	76888792	+	In_Frame_Del	DEL	ATGATC	-	-			TCGA-06-6701-01	TCGA-06-6701-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76888787_76888792delATGATC	uc004ecp.3	-	19	5269_5274	c.5037_5042delGATCAT	c.(5035-5043)ATGATCATA>ATA	p.MI1679del	ATRX_uc004ecq.3_In_Frame_Del_p.MI1641del|ATRX_uc004eco.3_In_Frame_Del_p.MI1464del	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1679_1680	Helicase ATP-binding.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	CTCATAGCCTATGATCATAACACCAC	0.398			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						183	77	---	---	---	---	capture_indel	In_Frame_Del	DEL	76888787	76888792	ATRX	23	ATGATC	-	-	-	1	0	1	0	1	0	0	0	0	208	16	5	5	1199	115
