Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CMPK1	51727	broad.mit.edu	37	1	47838725	47838725	+	Silent	SNP	C	T	T			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47838725C>T	uc001cri.2	+	3	566	c.417C>T	c.(415-417)ACC>ACT	p.T139T	CMPK1_uc010omp.1_Silent_p.T90T|CMPK1_uc010omq.1_RNA	NM_016308	NP_057392	P30085	KCY_HUMAN	UMP-CMP kinase 1 isoform a	107					nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity			ovary(1)	1					Gemcitabine(DB00441)	GGAACAAGACCATGGATGGGA	0.388													8	118	---	---	---	---	capture	Silent	SNP	47838725	47838725	CMPK1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3545	116
DDAH1	23576	broad.mit.edu	37	1	85790448	85790448	+	Missense_Mutation	SNP	G	A	A			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85790448G>A	uc001dlb.2	-	5	877	c.716C>T	c.(715-717)CCG>CTG	p.P239L	DDAH1_uc001dlc.2_Missense_Mutation_p.P136L|uc001dla.1_Intron|DDAH1_uc010osb.1_Missense_Mutation_p.P139L|DDAH1_uc009wco.2_Missense_Mutation_p.P136L	NM_012137	NP_036269	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1	239					arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	ATACTCTTCCGGGGTTCGGTG	0.473													31	176	---	---	---	---	capture	Missense_Mutation	SNP	85790448	85790448	DDAH1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4280	116
PKN2	5586	broad.mit.edu	37	1	89294277	89294277	+	Missense_Mutation	SNP	G	A	A			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89294277G>A	uc001dmn.2	+	19	2875	c.2533G>A	c.(2533-2535)GTG>ATG	p.V845M	PKN2_uc010osp.1_Missense_Mutation_p.V829M|PKN2_uc010osq.1_Missense_Mutation_p.V688M|PKN2_uc009wcv.2_Missense_Mutation_p.V797M|PKN2_uc010osr.1_Missense_Mutation_p.V510M	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2	845	Protein kinase.				signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		GGGCCTTGGCGTGCTTATATA	0.383													7	87	---	---	---	---	capture	Missense_Mutation	SNP	89294277	89294277	PKN2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11883	116
OR14C36	127066	broad.mit.edu	37	1	248512862	248512862	+	Silent	SNP	G	A	A	rs143199703		TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248512862G>A	uc010pzl.1	+	1	786	c.786G>A	c.(784-786)GCG>GCA	p.A262A		NM_001001918	NP_001001918	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C,	262	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.A262A(1)		ovary(1)|central_nervous_system(1)|skin(1)	3						GGCCACCTGCGATACCTGCAG	0.463													35	159	---	---	---	---	capture	Silent	SNP	248512862	248512862	OR14C36	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	10850	116
CRY2	1408	broad.mit.edu	37	11	45891983	45891983	+	Silent	SNP	G	A	A			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45891983G>A	uc010rgn.1	+	9	1534	c.1512G>A	c.(1510-1512)GTG>GTA	p.V504V	CRY2_uc009ykw.2_Silent_p.V422V|CRY2_uc010rgo.1_Silent_p.V226V	NM_021117	NP_066940	Q49AN0	CRY2_HUMAN	cryptochrome 2 (photolyase-like) isoform 1	483	FAD-binding.|Required for inhibition of CLOCK-ARNTL- mediated transcription (By similarity).				DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding			central_nervous_system(1)	1						TCATTGGTGTGGACTACCCAC	0.532													9	49	---	---	---	---	capture	Silent	SNP	45891983	45891983	CRY2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	3869	116
RIPK3	11035	broad.mit.edu	37	14	24808471	24808471	+	Missense_Mutation	SNP	C	T	T			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24808471C>T	uc001wpb.2	-	3	431	c.221G>A	c.(220-222)CGC>CAC	p.R74H	RIPK3_uc001wpa.2_5'Flank|RIPK3_uc010alq.2_RNA|RIPK3_uc010toi.1_5'UTR|RIPK3_uc010toj.1_Missense_Mutation_p.R74H	NM_006871	NP_006862	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	74	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals	cytoplasm	ATP binding|protein binding|transcription coactivator activity			central_nervous_system(2)|ovary(1)|lung(1)	4				GBM - Glioblastoma multiforme(265;0.0181)		CCCTTCTAGGCGCAGCACGAA	0.577													11	100	---	---	---	---	capture	Missense_Mutation	SNP	24808471	24808471	RIPK3	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13274	116
MYH1	4619	broad.mit.edu	37	17	10404048	10404048	+	Missense_Mutation	SNP	G	A	A			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10404048G>A	uc002gmo.2	-	28	3854	c.3760C>T	c.(3760-3762)CGC>TGC	p.R1254C	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1254	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TCTAGAGCGCGGCACATCTTT	0.448													16	114	---	---	---	---	capture	Missense_Mutation	SNP	10404048	10404048	MYH1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9939	116
ACTN4	81	broad.mit.edu	37	19	39205183	39205183	+	Silent	SNP	C	T	T			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39205183C>T	uc002oja.1	+	9	953	c.894C>T	c.(892-894)TAC>TAT	p.Y298Y	ACTN4_uc010egc.1_Silent_p.Y298Y	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	298	Spectrin 1.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGAGGACTACGAGAAGCTGG	0.582													9	68	---	---	---	---	capture	Silent	SNP	39205183	39205183	ACTN4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	207	116
SPHK2	56848	broad.mit.edu	37	19	49132916	49132916	+	Silent	SNP	C	T	T			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49132916C>T	uc002pjr.2	+	7	2217	c.1851C>T	c.(1849-1851)GGC>GGT	p.G617G	SPHK2_uc010xzt.1_Silent_p.G558G|SPHK2_uc002pjs.2_Silent_p.G617G|SPHK2_uc002pjt.2_Silent_p.G411G|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.2_Silent_p.G581G|SPHK2_uc002pjw.2_Silent_p.G679G	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	617					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CACCACGCGGCGTGCTCACAG	0.682													4	16	---	---	---	---	capture	Silent	SNP	49132916	49132916	SPHK2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14939	116
NLRP5	126206	broad.mit.edu	37	19	56539737	56539737	+	Missense_Mutation	SNP	C	T	T			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56539737C>T	uc002qmj.2	+	7	2138	c.2138C>T	c.(2137-2139)CCG>CTG	p.P713L	NLRP5_uc002qmi.2_Missense_Mutation_p.P694L	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	713	LRR 1.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GTGTGGCTTCCGATTAACCAG	0.493													12	224	---	---	---	---	capture	Missense_Mutation	SNP	56539737	56539737	NLRP5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10387	116
MZF1	7593	broad.mit.edu	37	19	59081801	59081801	+	Missense_Mutation	SNP	C	G	G			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:59081801C>G	uc002qto.2	-	3	1051	c.490G>C	c.(490-492)GAG>CAG	p.E164Q	LOC100131691_uc002qtm.2_RNA|MZF1_uc002qtn.2_Missense_Mutation_p.E164Q|MZF1_uc010euu.1_Missense_Mutation_p.E205Q	NM_198055	NP_932172	P28698	MZF1_HUMAN	zinc finger protein 42 isoform 2	164					viral reproduction	nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		GGCCCAGGCTCTGGAGTTGGA	0.582													32	98	---	---	---	---	capture	Missense_Mutation	SNP	59081801	59081801	MZF1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	10018	116
MX1	4599	broad.mit.edu	37	21	42812934	42812934	+	Missense_Mutation	SNP	G	A	A			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:42812934G>A	uc002yzh.2	+	11	1659	c.712G>A	c.(712-714)GAG>AAG	p.E238K	MX1_uc002yzi.2_Missense_Mutation_p.E238K|MX1_uc010goq.2_Missense_Mutation_p.E238K	NM_001144925	NP_001138397	P20591	MX1_HUMAN	myxovirus resistance protein 1	238					induction of apoptosis|response to virus|type I interferon-mediated signaling pathway	cytosol	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GGTGGACCCCGAGGGAGACAG	0.632													13	165	---	---	---	---	capture	Missense_Mutation	SNP	42812934	42812934	MX1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9907	116
PLCD1	5333	broad.mit.edu	37	3	38051499	38051499	+	Missense_Mutation	SNP	G	C	C			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38051499G>C	uc003chn.2	-	8	1307	c.1183C>G	c.(1183-1185)CTG>GTG	p.L395V	PLCD1_uc003chm.2_Missense_Mutation_p.L416V	NM_006225	NP_006216	P51178	PLCD1_HUMAN	phospholipase C, delta 1 isoform 2	395	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process|phospholipid metabolic process	cytoplasm	calcium ion binding|GTPase activating protein binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TGCTGCTCCAGTGTGCAGTGG	0.647													4	60	---	---	---	---	capture	Missense_Mutation	SNP	38051499	38051499	PLCD1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	11934	116
MTMR12	54545	broad.mit.edu	37	5	32230234	32230234	+	Missense_Mutation	SNP	C	T	T			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32230234C>T	uc003jhq.2	-	16	2064	c.1894G>A	c.(1894-1896)GAG>AAG	p.E632K	MTMR12_uc010iuk.2_Missense_Mutation_p.E578K|MTMR12_uc010iul.2_Missense_Mutation_p.E522K	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	632	Myotubularin phosphatase.					cytoplasm	phosphatase activity			ovary(1)	1						TCGGGCCCCTCGATATGCGGT	0.493													34	169	---	---	---	---	capture	Missense_Mutation	SNP	32230234	32230234	MTMR12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9851	116
PHF1	5252	broad.mit.edu	37	6	33380059	33380059	+	Silent	SNP	C	T	T			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33380059C>T	uc003oeh.2	+	2	255	c.19C>T	c.(19-21)CTG>TTG	p.L7L	PHF1_uc011drh.1_RNA|PHF1_uc003oei.2_Silent_p.L7L|PHF1_uc010jux.2_5'UTR	NM_024165	NP_077084	O43189	PHF1_HUMAN	PHD finger protein 1 isoform b	7					chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(999;0.0443)				GCCCCCCCGGCTGAGCCGCTC	0.592													7	80	---	---	---	---	capture	Silent	SNP	33380059	33380059	PHF1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	11723	116
COL21A1	81578	broad.mit.edu	37	6	56044496	56044496	+	Missense_Mutation	SNP	T	C	C			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56044496T>C	uc003pcs.2	-	3	752	c.520A>G	c.(520-522)ACA>GCA	p.T174A	COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Missense_Mutation_p.T174A|COL21A1_uc003pcu.1_Missense_Mutation_p.T174A	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	174	VWFA.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			GCATCTTCTGTTTCTGAACCA	0.398													5	65	---	---	---	---	capture	Missense_Mutation	SNP	56044496	56044496	COL21A1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	3645	116
P2RX2	22953	broad.mit.edu	37	12	133197851	133197853	+	In_Frame_Del	DEL	TAC	-	-			TCGA-08-0386-01	TCGA-08-0386-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133197851_133197853delTAC	uc001ukj.1	+	9	916_918	c.916_918delTAC	c.(916-918)TACdel	p.Y307del	P2RX2_uc001uki.1_In_Frame_Del_p.Y307del|P2RX2_uc001ukk.1_In_Frame_Del_p.Y307del|P2RX2_uc001ukl.1_In_Frame_Del_p.Y283del|P2RX2_uc001ukm.1_In_Frame_Del_p.Y235del|P2RX2_uc001ukn.1_In_Frame_Del_p.Y215del|P2RX2_uc009zyt.1_In_Frame_Del_p.Y307del|P2RX2_uc001uko.1_In_Frame_Del_p.Y273del	NM_170682	NP_733782	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X2 isoform A	307	Extracellular (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		GTTTGCCAAATACTACAAGATCA	0.606													7	323	---	---	---	---	capture_indel	In_Frame_Del	DEL	133197851	133197853	P2RX2	12	TAC	-	-	-	1	0	1	0	1	0	0	0	0	637	49	5	5	11244	116
