Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HSPG2	3339	broad.mit.edu	37	1	22186712	22186712	+	Missense_Mutation	SNP	C	T	T	rs143523507		TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22186712C>T	uc001bfj.2	-	40	5012	c.4972G>A	c.(4972-4974)GTG>ATG	p.V1658M	HSPG2_uc009vqd.2_Missense_Mutation_p.V1659M	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	1658	Laminin EGF-like 11.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	GGGTTACCCACGTAACCTGGG	0.637													17	35	---	---	---	---	capture	Missense_Mutation	SNP	22186712	22186712	HSPG2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7355	118
C1orf130	400746	broad.mit.edu	37	1	24927454	24927454	+	Missense_Mutation	SNP	G	A	A	rs142867139	byFrequency	TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24927454G>A	uc001bjk.1	+	3	172	c.106G>A	c.(106-108)GTT>ATT	p.V36I		NM_001010980	NP_001010980	Q5T1S8	CA130_HUMAN	chromosome 1 open reading frame 130	36	Poly-Val.|Helical; (Potential).					integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.0119)|all_lung(284;0.0154)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0439)|OV - Ovarian serous cystadenocarcinoma(117;1.48e-24)|Colorectal(126;6.93e-08)|COAD - Colon adenocarcinoma(152;3.69e-06)|GBM - Glioblastoma multiforme(114;0.00036)|BRCA - Breast invasive adenocarcinoma(304;0.00189)|KIRC - Kidney renal clear cell carcinoma(1967;0.00382)|STAD - Stomach adenocarcinoma(196;0.00521)|READ - Rectum adenocarcinoma(331;0.0659)|Lung(427;0.144)		TGTTGCTGCCGTTGTGGTGGT	0.552													40	81	---	---	---	---	capture	Missense_Mutation	SNP	24927454	24927454	C1orf130	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1979	118
TTC39A	22996	broad.mit.edu	37	1	51768762	51768762	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:51768762C>T	uc001csl.2	-	9	970	c.865G>A	c.(865-867)GTG>ATG	p.V289M	TTC39A_uc001csk.2_Missense_Mutation_p.V254M|TTC39A_uc010ond.1_Missense_Mutation_p.V226M|TTC39A_uc010one.1_Missense_Mutation_p.V253M|TTC39A_uc010onf.1_Missense_Mutation_p.V257M|TTC39A_uc001csn.2_Missense_Mutation_p.V288M|TTC39A_uc001cso.1_Missense_Mutation_p.V285M|TTC39A_uc009vyy.1_Missense_Mutation_p.V226M	NM_001080494	NP_001073963	Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A isoform 2	289							binding			skin(1)	1						CTACCGAGCACGAAGGTGAGG	0.627													8	9	---	---	---	---	capture	Missense_Mutation	SNP	51768762	51768762	TTC39A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16589	118
DMRTB1	63948	broad.mit.edu	37	1	53932300	53932300	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53932300C>G	uc001cvq.1	+	4	1049	c.994C>G	c.(994-996)CCC>GCC	p.P332A		NM_033067	NP_149056	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal,	332					sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GTCGGGTGAGCCCAGCCAGCC	0.552													93	234	---	---	---	---	capture	Missense_Mutation	SNP	53932300	53932300	DMRTB1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	4548	118
SFRS11	9295	broad.mit.edu	37	1	70703140	70703140	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70703140C>G	uc001des.2	+	7	747	c.623C>G	c.(622-624)CCA>CGA	p.P208R	SFRS11_uc001det.2_Missense_Mutation_p.P208R|SFRS11_uc001deu.2_Missense_Mutation_p.P208R|SFRS11_uc001dev.2_Missense_Mutation_p.P18R|SFRS11_uc001dew.2_Missense_Mutation_p.P148R	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11	208					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						CTCGTTTCACCAAGTCTGAAA	0.378													43	75	---	---	---	---	capture	Missense_Mutation	SNP	70703140	70703140	SFRS11	1	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	14059	118
S100A7A	338324	broad.mit.edu	37	1	153391728	153391728	+	Silent	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153391728C>T	uc001fbt.1	+	3	306	c.249C>T	c.(247-249)GCC>GCT	p.A83A		NM_176823	NP_789793	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7-like 1	83	EF-hand 2.					cytoplasm	calcium ion binding			skin(1)	1	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGACATAGCCGCAGACTACC	0.522													48	57	---	---	---	---	capture	Silent	SNP	153391728	153391728	S100A7A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13676	118
FDPS	2224	broad.mit.edu	37	1	155287783	155287783	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155287783C>T	uc001fkc.2	+	5	751	c.532C>T	c.(532-534)CGC>TGC	p.R178C	RAG1AP1_uc010pey.1_Intron|FDPS_uc001fkd.2_Missense_Mutation_p.R112C|FDPS_uc001fke.2_Missense_Mutation_p.R178C|FDPS_uc001fkf.2_Missense_Mutation_p.R112C|C1orf104_uc001fkh.1_RNA|RUSC1_uc001fkj.2_5'Flank|RUSC1_uc001fkk.2_5'Flank	NM_002004	NP_001995	P14324	FPPS_HUMAN	farnesyl diphosphate synthase isoform a	178		Dimethylallyl diphosphate.			cholesterol biosynthetic process|interspecies interaction between organisms|isoprenoid biosynthetic process	cytosol|nucleus	dimethylallyltranstransferase activity|geranyltranstransferase activity|metal ion binding				0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	ATCCCTTACCCGCCGGGGACA	0.512													37	80	---	---	---	---	capture	Missense_Mutation	SNP	155287783	155287783	FDPS	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5749	118
ADCY10	55811	broad.mit.edu	37	1	167806486	167806486	+	Splice_Site	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167806486C>T	uc001ger.2	-	22	3375	c.3077_splice	c.e22+1	p.S1026_splice	ADCY10_uc009wvk.2_Splice_Site_p.S934_splice|ADCY10_uc010plj.1_Splice_Site_p.S873_splice	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10						intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding	p.?(1)		central_nervous_system(2)|ovary(1)	3						TATGCCTCTACCTGCGATTTT	0.348													38	68	---	---	---	---	capture	Splice_Site	SNP	167806486	167806486	ADCY10	1	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	293	118
TMEM63A	9725	broad.mit.edu	37	1	226040425	226040425	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226040425G>A	uc001hpm.1	-	20	2093	c.1843C>T	c.(1843-1845)CTG>TTG	p.L615L		NM_014698	NP_055513	O94886	TM63A_HUMAN	transmembrane protein 63A	615	Helical; (Potential).					integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)					AAGACACACAGCATCCATGCA	0.552													17	46	---	---	---	---	capture	Silent	SNP	226040425	226040425	TMEM63A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	16073	118
OR52M1	119772	broad.mit.edu	37	11	4566682	4566682	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4566682T>C	uc010qyf.1	+	1	262	c.262T>C	c.(262-264)TGG>CGG	p.W88R		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGGAATCTTCTGGTTCGGTGC	0.517													72	44	---	---	---	---	capture	Missense_Mutation	SNP	4566682	4566682	OR52M1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	11030	118
OR56A3	390083	broad.mit.edu	37	11	5968802	5968802	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5968802G>A	uc010qzt.1	+	1	226	c.226G>A	c.(226-228)GTG>ATG	p.V76M		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	76	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTGGACATCGTGCTCTGCCT	0.587													141	63	---	---	---	---	capture	Missense_Mutation	SNP	5968802	5968802	OR56A3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11038	118
OR8H2	390151	broad.mit.edu	37	11	55872670	55872670	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55872670G>A	uc010riy.1	+	1	152	c.152G>A	c.(151-153)CGC>CAC	p.R51H		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	51	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					TTGATAATCCGCCTGGACCTC	0.428										HNSCC(53;0.14)			72	367	---	---	---	---	capture	Missense_Mutation	SNP	55872670	55872670	OR8H2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11142	118
SF3B2	10992	broad.mit.edu	37	11	65830517	65830517	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65830517A>G	uc001ogy.1	+	17	2055	c.2015A>G	c.(2014-2016)AAA>AGA	p.K672R		NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2	672					interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						GGCTGGGGCAAACCTCCAGTG	0.498													24	21	---	---	---	---	capture	Missense_Mutation	SNP	65830517	65830517	SF3B2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	14044	118
MMP12	4321	broad.mit.edu	37	11	102743841	102743841	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102743841C>G	uc001phk.2	-	2	149	c.104G>C	c.(103-105)AGA>ACA	p.R35T		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	35					positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	TTCTAAGTATCTCTGGAAAAA	0.328													22	7	---	---	---	---	capture	Missense_Mutation	SNP	102743841	102743841	MMP12	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	9563	118
LPAR5	57121	broad.mit.edu	37	12	6729589	6729589	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6729589G>A	uc009zer.2	-	2	1107	c.826C>T	c.(826-828)CGC>TGC	p.R276C	LPAR5_uc001qps.2_Missense_Mutation_p.R276C|LPAR5_uc010sff.1_Missense_Mutation_p.R276C	NM_001142961	NP_001136433	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	276	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2						AGCACCCCGCGCACGCGATCG	0.682													8	4	---	---	---	---	capture	Missense_Mutation	SNP	6729589	6729589	LPAR5	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8824	118
PDE3A	5139	broad.mit.edu	37	12	20807040	20807040	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:20807040G>A	uc001reh.1	+	15	3107	c.3085G>A	c.(3085-3087)GAC>AAC	p.D1029N		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	1029	Catalytic (By similarity).				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	ATGGGTGGAAGACAGCGATGA	0.478													4	121	---	---	---	---	capture	Missense_Mutation	SNP	20807040	20807040	PDE3A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	11540	118
NOC4L	79050	broad.mit.edu	37	12	132635897	132635897	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132635897C>T	uc001ujz.1	+	11	1098	c.1057C>T	c.(1057-1059)CTC>TTC	p.L353F		NM_024078	NP_076983	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog	353	Helical; (Potential).				rRNA processing	integral to membrane|nuclear membrane|nucleolus	protein binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CCTGGCTGACCTCTTCCTGTC	0.652													8	185	---	---	---	---	capture	Missense_Mutation	SNP	132635897	132635897	NOC4L	12	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10422	118
PCCA	5095	broad.mit.edu	37	13	100809554	100809554	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:100809554A>G	uc001voo.2	+	6	466	c.428A>G	c.(427-429)TAT>TGT	p.Y143C	PCCA_uc010aga.2_Missense_Mutation_p.Y117C|PCCA_uc010tiz.1_Missense_Mutation_p.Y143C	NM_000282	NP_000273	P05165	PCCA_HUMAN	propionyl-Coenzyme A carboxylase, alpha	143	Biotin carboxylation.				fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	CATCCAGGTTATGGATTCCTT	0.318													34	36	---	---	---	---	capture	Missense_Mutation	SNP	100809554	100809554	PCCA	13	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11407	118
NPAS3	64067	broad.mit.edu	37	14	34270129	34270129	+	Silent	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:34270129C>T	uc001wru.2	+	12	2680	c.2616C>T	c.(2614-2616)CTC>CTT	p.L872L	NPAS3_uc001wrs.2_Silent_p.L859L|NPAS3_uc001wrt.2_Silent_p.L840L|NPAS3_uc001wrv.2_Silent_p.L842L	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3	872					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TGGAGATGCTCTACCACCACG	0.637													9	8	---	---	---	---	capture	Silent	SNP	34270129	34270129	NPAS3	14	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	10471	118
CACNG3	10368	broad.mit.edu	37	16	24366270	24366270	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24366270G>A	uc002dmf.2	+	3	1612	c.412G>A	c.(412-414)GCG>ACG	p.A138T		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	138	Helical; (Potential).				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		CATTCTCAGCGCGGGCATCTT	0.572													29	42	---	---	---	---	capture	Missense_Mutation	SNP	24366270	24366270	CACNG3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2534	118
GJC1	10052	broad.mit.edu	37	17	42882694	42882694	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42882694G>A	uc002ihj.2	-	2	1003	c.492C>T	c.(490-492)GGC>GGT	p.G164G	GJC1_uc002ihk.2_Silent_p.G164G|GJC1_uc002ihl.2_Silent_p.G164G|GJC1_uc010czx.2_Silent_p.G164G|GJC1_uc010czy.1_Silent_p.G25G	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	164	Cytoplasmic (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				TCCGTCGTCGGCCATCATGCT	0.468													5	301	---	---	---	---	capture	Silent	SNP	42882694	42882694	GJC1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	6351	118
DLX3	1747	broad.mit.edu	37	17	48072315	48072315	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48072315G>A	uc002ipy.2	-	1	274	c.48C>T	c.(46-48)ATC>ATT	p.I16I		NM_005220	NP_005211	O60479	DLX3_HUMAN	distal-less homeobox 3	16						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGGAGCTGGAGATGTCGGTGA	0.642													37	44	---	---	---	---	capture	Silent	SNP	48072315	48072315	DLX3	17	G	A	A	A	1	0	0	0	0	0	0	0	1	421	33	2	2	4530	118
ABCA6	23460	broad.mit.edu	37	17	67111007	67111007	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67111007C>T	uc002jhw.1	-	13	1853	c.1678G>A	c.(1678-1680)GTC>ATC	p.V560I	ABCA6_uc002jhx.1_Missense_Mutation_p.V13I	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	560	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TGAGGACAGACGCCAGTTATC	0.348													38	75	---	---	---	---	capture	Missense_Mutation	SNP	67111007	67111007	ABCA6	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	36	118
MAP1S	55201	broad.mit.edu	37	19	17837113	17837113	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17837113G>A	uc002nhe.1	+	5	929	c.920G>A	c.(919-921)CGC>CAC	p.R307H	MAP1S_uc010eaz.1_RNA|MAP1S_uc010eba.1_Missense_Mutation_p.R307H|MAP1S_uc002nhf.1_Intron|MAP1S_uc010xpv.1_Missense_Mutation_p.R281H	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	307	Necessary for the microtubule-organizing center localization.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						CTGCTGCGGCGCAAACTGGCG	0.687													3	25	---	---	---	---	capture	Missense_Mutation	SNP	17837113	17837113	MAP1S	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9148	118
TMEM161A	54929	broad.mit.edu	37	19	19243312	19243312	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19243312G>A	uc002nlg.2	-	5	322	c.292C>T	c.(292-294)CGC>TGC	p.R98C	TMEM161A_uc010eca.2_RNA|TMEM161A_uc002nlh.2_Intron|TMEM161A_uc002nli.2_Intron|TMEM161A_uc002nlj.2_5'UTR	NM_017814	NP_060284	Q9NX61	T161A_HUMAN	transmembrane protein 161A precursor	98	Extracellular (Potential).				cellular response to oxidative stress|cellular response to UV|negative regulation of apoptosis|positive regulation of DNA repair|response to retinoic acid	integral to membrane				breast(2)	2			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			AGGAAGAAGCGCAGGACTGTG	0.582													6	153	---	---	---	---	capture	Missense_Mutation	SNP	19243312	19243312	TMEM161A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15959	118
ZNF229	7772	broad.mit.edu	37	19	44934110	44934110	+	Silent	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44934110C>T	uc002oze.1	-	6	1280	c.846G>A	c.(844-846)CCG>CCA	p.P282P	ZNF229_uc010ejk.1_5'UTR|ZNF229_uc010ejl.1_Silent_p.P276P	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	282					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				CTCTTGGATGCGGGGGAAGGT	0.443													4	91	---	---	---	---	capture	Silent	SNP	44934110	44934110	ZNF229	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17662	118
JOSD2	126119	broad.mit.edu	37	19	51009714	51009714	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51009714G>A	uc002psn.1	-	4	419	c.388C>T	c.(388-390)CGC>TGC	p.R130C	JOSD2_uc002pso.1_Missense_Mutation_p.R130C|JOSD2_uc002psp.1_Missense_Mutation_p.R130C|JOSD2_uc002psq.1_Missense_Mutation_p.R88C	NM_138334	NP_612207	Q8TAC2	JOS2_HUMAN	Josephin domain containing 2	130	Josephin.				protein deubiquitination		ubiquitin-specific protease activity				0		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0364)		TCCACCTGGCGCAGGGCCACC	0.701													5	7	---	---	---	---	capture	Missense_Mutation	SNP	51009714	51009714	JOSD2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7882	118
VIT	5212	broad.mit.edu	37	2	37035618	37035618	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37035618G>A	uc002rpl.2	+	15	1614	c.1393G>A	c.(1393-1395)GTG>ATG	p.V465M	VIT_uc002rpm.2_Missense_Mutation_p.V443M|VIT_uc010ezv.2_Missense_Mutation_p.V421M|VIT_uc010ezw.2_Missense_Mutation_p.V422M	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN	vitrin	450	VWFA 1.					proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)				CTTCTAGGCCGTGTGCAGAAC	0.602													36	40	---	---	---	---	capture	Missense_Mutation	SNP	37035618	37035618	VIT	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17053	118
NCKAP5	344148	broad.mit.edu	37	2	133541700	133541700	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:133541700G>A	uc002ttp.2	-	14	3058	c.2684C>T	c.(2683-2685)TCA>TTA	p.S895L	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	895							protein binding				0						CCTTGACCGTGACCCTGGAGT	0.607													56	71	---	---	---	---	capture	Missense_Mutation	SNP	133541700	133541700	NCKAP5	2	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	10130	118
NEB	4703	broad.mit.edu	37	2	152477436	152477436	+	Silent	SNP	A	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152477436A>G	uc010fnx.2	-	68	10019	c.9828T>C	c.(9826-9828)AGT>AGC	p.S3276S		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3276	Nebulin 89.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTCTTACATCACTGGCAATAT	0.358													13	13	---	---	---	---	capture	Silent	SNP	152477436	152477436	NEB	2	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	10209	118
GAD1	2571	broad.mit.edu	37	2	171705817	171705817	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:171705817C>T	uc002ugi.2	+	12	1563	c.1141C>T	c.(1141-1143)CTC>TTC	p.L381F	GAD1_uc010fqc.2_5'UTR	NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67	381					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AGGTGGGCTGCTCATGTCCAG	0.532													24	35	---	---	---	---	capture	Missense_Mutation	SNP	171705817	171705817	GAD1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	6121	118
CELSR1	9620	broad.mit.edu	37	22	46793605	46793605	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46793605G>A	uc003bhw.1	-	12	5667	c.5667C>T	c.(5665-5667)GAC>GAT	p.D1889D	CELSR1_uc011arc.1_Silent_p.D210D	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1889	Extracellular (Potential).|EGF-like 5; calcium-binding.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CCTCCCAGGCGTCGTGGCAGC	0.617													5	8	---	---	---	---	capture	Silent	SNP	46793605	46793605	CELSR1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3189	118
CASR	846	broad.mit.edu	37	3	121980782	121980782	+	Silent	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121980782C>T	uc003eev.3	+	4	1272	c.900C>T	c.(898-900)GCC>GCT	p.A300A	CASR_uc003eew.3_Silent_p.A300A	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	300	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AGGCCTGGGCCAGCTCCTCCC	0.602													37	55	---	---	---	---	capture	Silent	SNP	121980782	121980782	CASR	3	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	2658	118
FRYL	285527	broad.mit.edu	37	4	48559631	48559631	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48559631T>G	uc003gyh.1	-	34	4569	c.3964A>C	c.(3964-3966)AAA>CAA	p.K1322Q	FRYL_uc003gyk.2_Missense_Mutation_p.K1322Q|FRYL_uc003gyg.1_Missense_Mutation_p.K18Q|FRYL_uc003gyi.1_Missense_Mutation_p.K211Q	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1322					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						GGGAGAGGTTTTAAGTCCACC	0.512													32	320	---	---	---	---	capture	Missense_Mutation	SNP	48559631	48559631	FRYL	4	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	6007	118
KIT	3815	broad.mit.edu	37	4	55592080	55592080	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55592080G>A	uc010igr.2	+	9	1491	c.1404G>A	c.(1402-1404)CCG>CCA	p.P468P	KIT_uc010igs.2_Silent_p.P468P|KIT_uc011bzw.1_5'Flank|KIT_uc010igt.1_5'Flank	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	468	Extracellular (Potential).|Ig-like C2-type 5.				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	p.P468P(1)		soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTGGGCCACCGTTTGGAAAGC	0.453		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				50	74	---	---	---	---	capture	Silent	SNP	55592080	55592080	KIT	4	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	8250	118
GPR98	84059	broad.mit.edu	37	5	90136528	90136528	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90136528C>T	uc003kju.2	+	78	16841	c.16745C>T	c.(16744-16746)ACG>ATG	p.T5582M	GPR98_uc003kjt.2_Missense_Mutation_p.T3288M|GPR98_uc003kjw.2_Missense_Mutation_p.T1243M	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	5582	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTCATCCTAACGCCAGAGACA	0.423													104	239	---	---	---	---	capture	Missense_Mutation	SNP	90136528	90136528	GPR98	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6654	118
OR2V2	285659	broad.mit.edu	37	5	180582407	180582407	+	Silent	SNP	C	T	T	rs149585637	byFrequency	TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180582407C>T	uc011dhj.1	+	1	465	c.465C>T	c.(463-465)ATC>ATT	p.I155I		NM_206880	NP_996763	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V,	155	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGGGATAATCGATGGCTTGA	0.493													108	146	---	---	---	---	capture	Silent	SNP	180582407	180582407	OR2V2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	10935	118
TNXB	7148	broad.mit.edu	37	6	32013041	32013041	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32013041G>T	uc003nzl.2	-	32	10865	c.10663C>A	c.(10663-10665)CCC>ACC	p.P3555T	TNXB_uc003nzg.1_5'UTR|TNXB_uc003nzh.1_Missense_Mutation_p.P24T	NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3602	Fibronectin type-III 28.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						CCTAGGCGGGGCTCTTCAGGA	0.642													6	30	---	---	---	---	capture	Missense_Mutation	SNP	32013041	32013041	TNXB	6	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	16229	118
UTRN	7402	broad.mit.edu	37	6	145115044	145115044	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:145115044A>G	uc003qkt.2	+	62	9087	c.8995A>G	c.(8995-8997)ATC>GTC	p.I2999V		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	2999	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TCATGATGCCATCCAGATCCC	0.498													7	118	---	---	---	---	capture	Missense_Mutation	SNP	145115044	145115044	UTRN	6	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	16985	118
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			254	577	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	118
PHTF2	57157	broad.mit.edu	37	7	77552026	77552026	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77552026G>A	uc003ugs.3	+	10	1176	c.1050G>A	c.(1048-1050)GTG>GTA	p.V350V	PHTF2_uc003ugo.3_Silent_p.V312V|PHTF2_uc003ugp.2_Silent_p.V312V|PHTF2_uc003ugq.3_Silent_p.V312V|PHTF2_uc010ldv.2_Silent_p.V312V|PHTF2_uc003ugr.3_Silent_p.V316V|PHTF2_uc003ugt.3_Silent_p.V316V|PHTF2_uc003ugu.3_Silent_p.V312V|PHTF2_uc003ugv.2_Silent_p.V175V|PHTF2_uc010ldw.1_Silent_p.V175V	NM_001127357	NP_001120829	Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	350					regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1						GTCGTCATGTGGACAGGACTT	0.398													21	26	---	---	---	---	capture	Silent	SNP	77552026	77552026	PHTF2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	11766	118
TRRAP	8295	broad.mit.edu	37	7	98522846	98522846	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98522846G>C	uc003upp.2	+	22	3144	c.2935G>C	c.(2935-2937)GAC>CAC	p.D979H	TRRAP_uc011kis.1_Missense_Mutation_p.D979H|TRRAP_uc003upr.2_Missense_Mutation_p.D671H	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	979					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GAGCCTGGAGGACAACAAGCA	0.567													27	230	---	---	---	---	capture	Missense_Mutation	SNP	98522846	98522846	TRRAP	7	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	16484	118
PMPCB	9512	broad.mit.edu	37	7	102949403	102949403	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102949403G>A	uc003vbl.2	+	8	888	c.854G>A	c.(853-855)CGT>CAT	p.R285H	PMPCB_uc010liu.1_Missense_Mutation_p.R285H|PMPCB_uc003vbk.1_Missense_Mutation_p.R285H|PMPCB_uc003vbm.2_Missense_Mutation_p.R194H|PMPCB_uc010liv.2_Missense_Mutation_p.R191H|PMPCB_uc010liw.2_Missense_Mutation_p.R194H|PMPCB_uc011kll.1_Missense_Mutation_p.R180H|PMPCB_uc011klm.1_Missense_Mutation_p.R160H	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit	285					proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						AACTAGATTCGTGTGAGGGAT	0.408													9	172	---	---	---	---	capture	Missense_Mutation	SNP	102949403	102949403	PMPCB	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12044	118
FLNC	2318	broad.mit.edu	37	7	128494166	128494166	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128494166A>G	uc003vnz.3	+	40	6832	c.6623A>G	c.(6622-6624)GAG>GGG	p.E2208G	FLNC_uc003voa.3_Missense_Mutation_p.E2175G	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2208	Intradomain insert.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GTGCGGGTGGAGGAGTCCACC	0.687													3	48	---	---	---	---	capture	Missense_Mutation	SNP	128494166	128494166	FLNC	7	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5879	118
FRMD3	257019	broad.mit.edu	37	9	85958187	85958187	+	Silent	SNP	A	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:85958187A>G	uc004ams.1	-	5	592	c.390T>C	c.(388-390)CTT>CTC	p.L130L	FRMD3_uc004amr.1_Silent_p.L116L	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	130	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						TTTTAATCTGAAGGTATAAAA	0.448													9	137	---	---	---	---	capture	Silent	SNP	85958187	85958187	FRMD3	9	A	G	G	G	1	0	0	0	0	0	0	0	1	106	9	3	3	5993	118
LAMC3	10319	broad.mit.edu	37	9	133942520	133942520	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133942520G>A	uc004caa.1	+	14	2619	c.2521G>A	c.(2521-2523)GAC>AAC	p.D841N		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	841	Laminin EGF-like 8.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CACCACGGGTGACCACTGTGA	0.642													9	122	---	---	---	---	capture	Missense_Mutation	SNP	133942520	133942520	LAMC3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	8536	118
SURF4	6836	broad.mit.edu	37	9	136230531	136230531	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136230531G>A	uc004cdj.2	-	6	778	c.648C>T	c.(646-648)AAC>AAT	p.N216N	SURF4_uc011mda.1_Silent_p.N207N|SURF4_uc010nal.2_3'UTR|SURF4_uc011mdb.1_Silent_p.N173N|SURF4_uc011mdc.1_Silent_p.N173N|SURF4_uc011mdd.1_3'UTR	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4	216	Helical; (Potential).					endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		TGAAATATACGTTGATGGCAA	0.478													35	63	---	---	---	---	capture	Silent	SNP	136230531	136230531	SURF4	9	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15293	118
USP11	8237	broad.mit.edu	37	X	47104414	47104414	+	Splice_Site	SNP	G	C	C			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47104414G>C	uc004dhp.2	+	16	2216	c.2216_splice	c.e16-1	p.A739_splice	USP11_uc004dhq.2_Splice_Site_p.A465_splice	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						CTCACCCCCAGCCCAGCCGTA	0.567													4	25	---	---	---	---	capture	Splice_Site	SNP	47104414	47104414	USP11	23	G	C	C	C	1	0	0	0	0	0	0	1	0	442	34	5	4	16924	118
HUWE1	10075	broad.mit.edu	37	X	53576344	53576344	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53576344C>T	uc004dsp.2	-	67	10013	c.9611G>A	c.(9610-9612)CGT>CAT	p.R3204H	HUWE1_uc004dsn.2_Missense_Mutation_p.R2012H	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3204					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TCGGTGTAGACGGCTAGTATT	0.557													55	97	---	---	---	---	capture	Missense_Mutation	SNP	53576344	53576344	HUWE1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7386	118
DCAF12L1	139170	broad.mit.edu	37	X	125686329	125686329	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125686329G>A	uc004eul.2	-	1	514	c.263C>T	c.(262-264)ACG>ATG	p.T88M		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	88										skin(3)|ovary(1)	4						TTGGCGCTCCGTCAGCAGCTC	0.657													56	62	---	---	---	---	capture	Missense_Mutation	SNP	125686329	125686329	DCAF12L1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4223	118
MAGEC1	9947	broad.mit.edu	37	X	140995245	140995245	+	Silent	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140995245G>A	uc004fbt.2	+	4	2341	c.2055G>A	c.(2053-2055)GGG>GGA	p.G685G	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	685							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCTGAGGGGGAGGATTCCC	0.577										HNSCC(15;0.026)			86	152	---	---	---	---	capture	Silent	SNP	140995245	140995245	MAGEC1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	9094	118
HAUS7	55559	broad.mit.edu	37	X	152735936	152735936	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152735936G>A	uc004fho.1	-	1	668	c.110C>T	c.(109-111)GCG>GTG	p.A37V	HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA|HAUS7_uc004fhn.1_Missense_Mutation_p.A37V|HAUS7_uc004fhp.1_RNA|HAUS7_uc011myq.1_RNA	NM_017518	NP_059988	Q99871	HAUS7_HUMAN	HAUS augmin-like complex subunit 7	37					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding				0						CTCCACAGCCGCCCTGGACAC	0.726													11	23	---	---	---	---	capture	Missense_Mutation	SNP	152735936	152735936	HAUS7	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6898	118
KRT81	3887	broad.mit.edu	37	12	52685111	52685112	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52685111_52685112insG	uc001sab.2	-	1	188_189	c.138_139insC	c.(136-141)GGCAGCfs	p.G46fs	KRT86_uc010snq.1_Intron|KRT86_uc009zmg.2_Intron|KRT81_uc001sac.2_Intron	NM_002281	NP_002272	Q14533	KRT81_HUMAN	keratin, hair, basic, 1	46_47	Head.					keratin filament	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		ACGCTGTGGCTGCCGAAGCCCC	0.748													9	302	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	52685111	52685112	KRT81	12	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	8415	118
MC2R	4158	broad.mit.edu	37	18	13885215	13885216	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:13885215_13885216insG	uc002ksp.1	-	2	479_480	c.302_303insC	c.(301-303)ACAfs	p.T101fs		NM_000529	NP_000520	Q01718	ACTHR_HUMAN	melanocortin 2 receptor	101	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding			ovary(4)|skin(1)	5					Corticotropin(DB01285)|Cosyntropin(DB01284)	TGTCATCGGCTGTGGTTTCAAA	0.480													7	149	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	13885215	13885216	MC2R	18	-	G	G	G	1	0	1	1	0	0	0	0	0	704	55	5	5	9277	118
DNAH1	25981	broad.mit.edu	37	3	52409985	52409986	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-0616-01	TCGA-12-0616-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52409985_52409986insA	uc011bef.1	+	46	7435_7436	c.7174_7175insA	c.(7174-7176)GAAfs	p.E2392fs		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2392	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACTCCTTGGAGAAAAAAGCTAC	0.609													74	135	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	52409985	52409986	DNAH1	3	-	A	A	A	1	0	1	1	0	0	0	0	0	429	33	5	5	4555	118
